Bull Tokyo Dent Coll (2015) 56(2): 93–103
Original Article
Glucose-PTS Involvement in Maltose Metabolism by Streptococcus mutans Yutaka Sato1), Kazuko Okamoto-Shibayama2) and Toshifumi Azuma1,3) Department of Biochemistry, Tokyo Dental College, 2-9-18 Misaki-cho, Chiyoda-ku, Tokyo 101-0061, Japan 2) Department of Microbiology, Tokyo Dental College, 2-1-14 Misaki-cho, Chiyoda-ku, Tokyo 101-0061, Japan 3) Oral Health Science Centre, Tokyo Dental College, 2-9-18 Misaki-cho, Chiyoda-ku, Tokyo 101-0061, Japan 1)
Received 9 December, 2014/Accepted for publication 2 February, 2015
Abstract Streptococcus mutans grows with starch-derived maltose in the presence of saliva. Maltose transported into the cells is mediated by the MalQ protein (4-alpha-glucanotransferase) to produce glucose and maltooligosaccharides. Glucose can be phosphorylated to glucose 6-phosphate, which can enter the glycolysis pathway. The MalQ enzyme is essential in the catabolism of maltose when it is the sole carbon source, suggesting the presence of a downstream glucokinase of the MalQ enzyme reaction. However, a glucokinase gene-inactivated mutant (glk mutant) grew with maltose as the sole carbon source, with no residual glucokinase activity. This left a phosphoenolpyruvate-dependent phosphotransferase system (PTS) as the only candidate pathway for the phosphorylation of glucose in its transport as a substrate. Our hypothesis was that intracellular glucose derived from maltose mediated by the MalQ protein was released into the extracellular environment, and that such glucose was transported back into the cells by a PTS. The mannose PTS encoded by the manL, manM, and manN genes transports glucose into cells as a high affinity system with concomitant phosphorylation. The purpose of this study was to investigate extracellular glucose by using an enzyme-linked photometrical method, monitoring absorbance changes at 340 nm in supernatant of S. mutans cells. A significant amount of glucose was detected in the extracellular fluid of a glk, manLM double mutant. These results suggest that the glk and manLMN genes participate in maltose catabolism in this organism. The significance of multiple metabolic pathways for important energy sources, including maltose, in the oral environment is discussed. Key words:
Streptococcus mutans — Glucokinase — Maltose metabolism — Glucose PTS — 4-alpha-glucanotransferase
Introduction
tat is dental plaque, an oral biofilm, where it is continually subjected to alternating periods of abundance and depletion with respect to carbohydrate energy sources (the so-called
Streptococcus mutans is a major etiologic agent of human dental caries4), and its natural habi93
94
Sato Y et al.
Fig. 1 Theoretical metabolic pathway for maltose and maltooligosaccharides from membrane transport to glycolysis Asterisked maltooligosaccharides enter intracellular pool to repeatedly form substrates for 4-alphaglucanotransferase (MalQ) and glycogen phosphorylase (GlgP) enzymes, releasing glucose and G1P from their reducing and non-reducing ends, respectively. Symbols: open hexagon, glucose residues at reducing ends; shaded hexagon, non-reducing glucose residues. Abbreviations: circled P, phosphate residues; MalT, maltose-PTS; MalXFGK, binding proteindependent ABC transporter for maltooligosaccharides; MapP, putative maltose-6-phosphate phosphatase; MalQ, 4-alpha-glucanotransferase; Glk, glucokinase; GlgP, glycogen phosphorylase; Pgm, phosphoglucomutase.
“feast and famine” cycle)6). A major carbon source during a “feast” period is dietary starch, although this does not act as a direct carbon source for its growth; rather, S. mutans grows well with starch-derived maltose or maltooligosaccharides in the presence of saliva. These starch derivatives are imported through two sugar transport systems, the phosphoenolpyruvate-dependent maltosephosphotransferase system (PTS) and the binding protein-dependent ABC transporter system for maltooligosaccharides, which are encoded by the malT (symbolized as ptsG in the genome data)15) and malXFGK genes8,16), respectively, in the genome of this organism. Maltose transported via the maltose-PTS (MalT) is phosphorylated to maltose 6-phosphate, which was recently demonstrated to be dephosphorylated by a novel maltose 6-phosphate phosphatase (MapP) in Enterococcus faecalis 9). The mapP gene is located downstream from the enterococcal malT gene encoding the maltose-specific PTS. The chromosomal malT and putative mapP gene (SMU_2046c) arrange-
ment in S. mutans is the same as that in E. faecalis. This suggests that extracellular maltose is also transported and subsequently metabolized as intracellular maltose in S. mutans. Our group recently characterized the malQ and glgP genes, which encode 4-alphaglucanotransferase and glycogen phosphorylase, respectively10). The MalQ protein catalyzes maltose and maltooligosaccharides, resulting in their conversion to glucose and differentsized malto-oligomers, while the GlgP protein degrades these oligomers from their nonreducing ends to produce glucose 1-phosphate (Fig. 1). This indicates that maltose- and ABC transporter system (MalXFGK)-derived mal tooligosaccharides repeatedly enter an intracellular maltooligosaccharide pool to become substrates for the MalQ and GlgP proteins. Meanwhile, glucose and glucose 1-phosphate (G1P) act as substrates for enzymes in the glycolysis pathway, thus serving as energy sources (Fig. 1). It was demonstrated that, unlike GlgP, the MalQ protein was essential when maltose or maltooligosaccharide was
Glc-PTS in S. mutans Maltose Metabolism
the only available carbon source. This suggests that, for glycolysis to take place, a kinase is essential to mediate reactions downstream of the MalQ enzyme. The glk gene in S. mutans was identified as a potential candidate for this. However, in characterizing the glk gene, which encodes glucokinase, it was found that this was not the case. Therefore, it was necessary to raise another hypothesis with regard to the phosphorylation mechanism for glucose, and the candidates were the PTSs underlying transportation of glucose as a substrate. One glucose-transporting PTS, the mannose-PTS, encoded by the manL, manM, and manN genes, has been reported as a high affinity system to glucose2). Growth of the glk and manLM double mutant was partially inhibited in the presence of maltose as the sole carbon source, and glucose was detected in the extracellular fluid of this mutant. The possibility that a glucose-PTS substitutes for the glucokinase reaction in the maltose catabolism of S. mutans not only in the glknegative condition, but also under physiological conditions, is discussed.
Materials and Methods 1. Bacterial strains The S. mutans strains used were UA1593) and its mutants cvU8 (glk), cmU1 (manLM), cmvU1 (glk, manLM), and blcmvU1 (pgm, glk, manLM). Streptococci were maintained on Todd-Hewitt (TH) broth/agar plates with or without appropriate antibiotics. Escherichia coli strain TOP10 was used as a host with the vector pBAD/HisA for the expression of the cloned gene as a N-terminal histidine-tagged protein. 2. PCR amplification of fragments to express or inactivate specific genes in S. mutans The PCR primers used in this study are listed in Table 1. All amplification reactions were carried out with high fidelity DNA polymerase, KOD-Plus (Toyobo, Osaka, Japan), without terminal deoxynucleotidyl transferase activity. Regions corresponding to the glk
95
gene in strain UA159 were amplified with the primer set expglk5/expglk3. Amplified fragments were purified with the PureLink Quick PCR Purification Kit (Invitrogen, Lohne, Germany), digested with XhoI, and subcloned into XhoI/PvuII-double digested pBAD/ HisA. Splicing was performed by the overlapping extension method7) to construct the linear fragments used for transformation of S. mutans, in which a markerless mutagenesis method reported by Xie et al.17) was employed to construct some mutants. Briefly, these markerless mutants were constructed by a two-step transformation procedure using the IFDC2 cassette containing the negative- and positive-selection markers (p-Cl-Phes and Emr) for the first step screening and the two homologous upstream and downstream fragments directly ligated together without the intervening IFDC2 cassette for the second step. The resulting markerless mutants were p-Cl-Pher and Ems. Gene arrangements at the target sites in these mutants were confirmed by PCR amplification. 3. Monitoring growth of S. mutans and preparation of culture supernatant Growth of S. mutans strains and mutants in BTR-sugar broth11) was measured at an optical density (OD) of 660 nm with the Ultrospec 500 pro spectrophotometer (GE Healthcare Life Sciences, Uppsala, Sweden). Values of OD660 nm were recorded at 1-hr intervals following inoculation of cultures into screwcapped glass tubes containing BTR-sugar broth. Sugars included 2.75 mM maltose or 5.5 mM glucose. Aliquots of BTR-maltose broth cultures at appropriate growth points were collected and centrifuged. The supernatant was filtrated through a disposable membrane filter unit Dismic-03CP045AN (Advantec, Tokyo, Japan) to obtain samples. 4. Preparation of permeabilized cells of S. mutans Cells from the BTR-maltose or glucose broth culture at the mid-exponential phase (OD660 nm, 0.4–0.5) were harvested following centrifugation, washed twice, and sus-
96
Sato Y et al.
Table 1 Primers used in this study Primer designations
Sequences (5′>3′)
Purpose or target region
Reference
expglk5
ATCTCGAGGCTAAGAAACTTTTAGGGATTGATC
E. coli glk clone
This study
expglk3
GAAATGATAGAGATAATTGACATAATTTTCCT
E. coli glk clone
This study
ldhF
CCGAGCAACAATAACACTC
IFDC2 amplification
17)
ermR
GAAGCTGTCAGTAGTATACC
IFDC2 amplification
17)
dpr51
GGCACATGGGATAAATCAATAACT
S. mutans glk IFDC2 and markerless mutants
This study
3Tglk5R
GCTAAATGACGTGCGTAAAATCAATTCAGCA
S. mutans glk IFDC2 mutant
This study
5Tglk3F
ATTTTACGCACGTCATTTAGCAGAAGA
S. mutans glk IFDC2 mutant
This study
glk31
ACACGAAAATAATTCCAAACAAA
S. mutans glk IFDC2 and markerless mutants
This study
3Tglk5R
GCTAAATGACGTGCGTAAAATCAATTCAGCA
S. mutans glk markerless mutant This study
5Tglk3F
ATTTTACGCACGTCATTTAGCAGAAGA
S. mutans glk markerless mutant This study
manL50
ATTAAACGGAAAAACACAACACAATAA
S. mutans manLM kanr mutant
This study
kanTmanL3
GGGTTTATCCGGGATCCTGGCGATAACGATTCCGA
S. mutans manLM kanr mutant
This study
kanF
GGATCCCGGATAAACCCAG
S. mutans manLM kanr mutant
This study
kanR
GCGGATCCCGAGCTTTT
S. mutans manLM kanr mutant
This study
kanTmanM5 AGCTCGGGATCCGCTCACTCAACTGGTAAAACCAT
S. mutans manLM kanr mutant
This study
manM30
GCAATGGTAATACCTTTTTGTGAAAA
S. mutans manLM kanr mutant
This study
pgm51
GCTTATGCTAAACTTCCCGA
S. mutans pgm Emr mutant
This study
EmTpgm5R
GATACTGCACTATCAACACACTCTTCACCATAAACTTTGTAACCA
S. mutans pgm Emr mutant
This study
Em50
AAGAGTGTGTTGATAGTGCAGTATC
S. mutans pgm Emr mutant
This study
Em30
GGCGCTAGGGACCTCT
S. mutans pgm Emr mutant
This study
EmTpgm3F
AGAGGTCCCTAGCGCCGAAAATCAAATTCTACAT
S. mutans pgm Emr mutant
This study
pgm31
GATACACGAACAGAAATCTTGGT
S. mutans pgm Emr mutant
This study
Underlined sequences are those of added nucleotides for restriction endonuclease reactions or those necessary for splicing by overlapping extension method.
pended in 1/100 volume of 50 mM potassium phosphate buffer (pH 7.0) containing 5 mM 2-mercaptoethanol. Cell density was adjusted to approximately 30 (OD660 nm) and permeabilized with toluene according to the method reported by Vadeboncoeur and Trahan14). 5. Preparation of supernatant samples to determine released glucose from intact and permeabilized cells suspended in buffer containing maltose The permeabilized cells, as well as intact cells, were suspended in 1 ml of 50 mM potassium phosphate buffer (pH 7.0) containing 13.75 mM maltose at an OD660 of 3 and incubated at 37°C for 30 min. Cells were centrifuged immediately after the incubation
period and the supernatant filtrated as described above as an extracellular fluid sample for the glucose assay. 6. Enzyme assays for glucokinase activity and released glucose from cells NADP-linked glucose-6-phosphate dehydrogenase (G6PDH) enzyme reactions were conducted throughout these assays10). Enzyme assays for glucokinase activity in an E. coli glk clone, S. mutans UA159, and its glk mutant were performed in a 1-ml cuvette containing 80 mM TrisCl (pH 7.5), 10 mM MgCl2, 0.5 mM NADP, 2 IU G6PDH (Oriental Yeast Co., Ltd., Tokyo, Japan), 5.5 mM glucose, and a crude extract. The cuvette was pre-warmed in a cuvette holder ( JASCO HMC-358, JASCO Corporation, Tokyo, Japan) incorporated in
97
Glc-PTS in S. mutans Maltose Metabolism
Table 2 Glucokinase activities of E. coli glk clone and S. mutans glk mutant E. coli
S. mutans
pBAD/HisA (vector)
ZFG7 (glk clone)
cvU8 (glk)
UA159 (wild type)
0.111±0.019*
22.5±5.9*
0.00753±0.00269**
0.573±0.123** (IU)
Crude extract added in cuvette: ZFG7 (E. coli glk clone), 1.8–4.7 μg; pBAD/HisA (E. coli vector clone), 5.1–10.6 μg; cvU8 (S. mutans glk mutant), 34–49 μg; UA159 (wild type), 37–74 μg. Mean±SD. Data represent results from three or four independent experiments. * p
Original Article
Glucose-PTS Involvement in Maltose Metabolism by Streptococcus mutans Yutaka Sato1), Kazuko Okamoto-Shibayama2) and Toshifumi Azuma1,3) Department of Biochemistry, Tokyo Dental College, 2-9-18 Misaki-cho, Chiyoda-ku, Tokyo 101-0061, Japan 2) Department of Microbiology, Tokyo Dental College, 2-1-14 Misaki-cho, Chiyoda-ku, Tokyo 101-0061, Japan 3) Oral Health Science Centre, Tokyo Dental College, 2-9-18 Misaki-cho, Chiyoda-ku, Tokyo 101-0061, Japan 1)
Received 9 December, 2014/Accepted for publication 2 February, 2015
Abstract Streptococcus mutans grows with starch-derived maltose in the presence of saliva. Maltose transported into the cells is mediated by the MalQ protein (4-alpha-glucanotransferase) to produce glucose and maltooligosaccharides. Glucose can be phosphorylated to glucose 6-phosphate, which can enter the glycolysis pathway. The MalQ enzyme is essential in the catabolism of maltose when it is the sole carbon source, suggesting the presence of a downstream glucokinase of the MalQ enzyme reaction. However, a glucokinase gene-inactivated mutant (glk mutant) grew with maltose as the sole carbon source, with no residual glucokinase activity. This left a phosphoenolpyruvate-dependent phosphotransferase system (PTS) as the only candidate pathway for the phosphorylation of glucose in its transport as a substrate. Our hypothesis was that intracellular glucose derived from maltose mediated by the MalQ protein was released into the extracellular environment, and that such glucose was transported back into the cells by a PTS. The mannose PTS encoded by the manL, manM, and manN genes transports glucose into cells as a high affinity system with concomitant phosphorylation. The purpose of this study was to investigate extracellular glucose by using an enzyme-linked photometrical method, monitoring absorbance changes at 340 nm in supernatant of S. mutans cells. A significant amount of glucose was detected in the extracellular fluid of a glk, manLM double mutant. These results suggest that the glk and manLMN genes participate in maltose catabolism in this organism. The significance of multiple metabolic pathways for important energy sources, including maltose, in the oral environment is discussed. Key words:
Streptococcus mutans — Glucokinase — Maltose metabolism — Glucose PTS — 4-alpha-glucanotransferase
Introduction
tat is dental plaque, an oral biofilm, where it is continually subjected to alternating periods of abundance and depletion with respect to carbohydrate energy sources (the so-called
Streptococcus mutans is a major etiologic agent of human dental caries4), and its natural habi93
94
Sato Y et al.
Fig. 1 Theoretical metabolic pathway for maltose and maltooligosaccharides from membrane transport to glycolysis Asterisked maltooligosaccharides enter intracellular pool to repeatedly form substrates for 4-alphaglucanotransferase (MalQ) and glycogen phosphorylase (GlgP) enzymes, releasing glucose and G1P from their reducing and non-reducing ends, respectively. Symbols: open hexagon, glucose residues at reducing ends; shaded hexagon, non-reducing glucose residues. Abbreviations: circled P, phosphate residues; MalT, maltose-PTS; MalXFGK, binding proteindependent ABC transporter for maltooligosaccharides; MapP, putative maltose-6-phosphate phosphatase; MalQ, 4-alpha-glucanotransferase; Glk, glucokinase; GlgP, glycogen phosphorylase; Pgm, phosphoglucomutase.
“feast and famine” cycle)6). A major carbon source during a “feast” period is dietary starch, although this does not act as a direct carbon source for its growth; rather, S. mutans grows well with starch-derived maltose or maltooligosaccharides in the presence of saliva. These starch derivatives are imported through two sugar transport systems, the phosphoenolpyruvate-dependent maltosephosphotransferase system (PTS) and the binding protein-dependent ABC transporter system for maltooligosaccharides, which are encoded by the malT (symbolized as ptsG in the genome data)15) and malXFGK genes8,16), respectively, in the genome of this organism. Maltose transported via the maltose-PTS (MalT) is phosphorylated to maltose 6-phosphate, which was recently demonstrated to be dephosphorylated by a novel maltose 6-phosphate phosphatase (MapP) in Enterococcus faecalis 9). The mapP gene is located downstream from the enterococcal malT gene encoding the maltose-specific PTS. The chromosomal malT and putative mapP gene (SMU_2046c) arrange-
ment in S. mutans is the same as that in E. faecalis. This suggests that extracellular maltose is also transported and subsequently metabolized as intracellular maltose in S. mutans. Our group recently characterized the malQ and glgP genes, which encode 4-alphaglucanotransferase and glycogen phosphorylase, respectively10). The MalQ protein catalyzes maltose and maltooligosaccharides, resulting in their conversion to glucose and differentsized malto-oligomers, while the GlgP protein degrades these oligomers from their nonreducing ends to produce glucose 1-phosphate (Fig. 1). This indicates that maltose- and ABC transporter system (MalXFGK)-derived mal tooligosaccharides repeatedly enter an intracellular maltooligosaccharide pool to become substrates for the MalQ and GlgP proteins. Meanwhile, glucose and glucose 1-phosphate (G1P) act as substrates for enzymes in the glycolysis pathway, thus serving as energy sources (Fig. 1). It was demonstrated that, unlike GlgP, the MalQ protein was essential when maltose or maltooligosaccharide was
Glc-PTS in S. mutans Maltose Metabolism
the only available carbon source. This suggests that, for glycolysis to take place, a kinase is essential to mediate reactions downstream of the MalQ enzyme. The glk gene in S. mutans was identified as a potential candidate for this. However, in characterizing the glk gene, which encodes glucokinase, it was found that this was not the case. Therefore, it was necessary to raise another hypothesis with regard to the phosphorylation mechanism for glucose, and the candidates were the PTSs underlying transportation of glucose as a substrate. One glucose-transporting PTS, the mannose-PTS, encoded by the manL, manM, and manN genes, has been reported as a high affinity system to glucose2). Growth of the glk and manLM double mutant was partially inhibited in the presence of maltose as the sole carbon source, and glucose was detected in the extracellular fluid of this mutant. The possibility that a glucose-PTS substitutes for the glucokinase reaction in the maltose catabolism of S. mutans not only in the glknegative condition, but also under physiological conditions, is discussed.
Materials and Methods 1. Bacterial strains The S. mutans strains used were UA1593) and its mutants cvU8 (glk), cmU1 (manLM), cmvU1 (glk, manLM), and blcmvU1 (pgm, glk, manLM). Streptococci were maintained on Todd-Hewitt (TH) broth/agar plates with or without appropriate antibiotics. Escherichia coli strain TOP10 was used as a host with the vector pBAD/HisA for the expression of the cloned gene as a N-terminal histidine-tagged protein. 2. PCR amplification of fragments to express or inactivate specific genes in S. mutans The PCR primers used in this study are listed in Table 1. All amplification reactions were carried out with high fidelity DNA polymerase, KOD-Plus (Toyobo, Osaka, Japan), without terminal deoxynucleotidyl transferase activity. Regions corresponding to the glk
95
gene in strain UA159 were amplified with the primer set expglk5/expglk3. Amplified fragments were purified with the PureLink Quick PCR Purification Kit (Invitrogen, Lohne, Germany), digested with XhoI, and subcloned into XhoI/PvuII-double digested pBAD/ HisA. Splicing was performed by the overlapping extension method7) to construct the linear fragments used for transformation of S. mutans, in which a markerless mutagenesis method reported by Xie et al.17) was employed to construct some mutants. Briefly, these markerless mutants were constructed by a two-step transformation procedure using the IFDC2 cassette containing the negative- and positive-selection markers (p-Cl-Phes and Emr) for the first step screening and the two homologous upstream and downstream fragments directly ligated together without the intervening IFDC2 cassette for the second step. The resulting markerless mutants were p-Cl-Pher and Ems. Gene arrangements at the target sites in these mutants were confirmed by PCR amplification. 3. Monitoring growth of S. mutans and preparation of culture supernatant Growth of S. mutans strains and mutants in BTR-sugar broth11) was measured at an optical density (OD) of 660 nm with the Ultrospec 500 pro spectrophotometer (GE Healthcare Life Sciences, Uppsala, Sweden). Values of OD660 nm were recorded at 1-hr intervals following inoculation of cultures into screwcapped glass tubes containing BTR-sugar broth. Sugars included 2.75 mM maltose or 5.5 mM glucose. Aliquots of BTR-maltose broth cultures at appropriate growth points were collected and centrifuged. The supernatant was filtrated through a disposable membrane filter unit Dismic-03CP045AN (Advantec, Tokyo, Japan) to obtain samples. 4. Preparation of permeabilized cells of S. mutans Cells from the BTR-maltose or glucose broth culture at the mid-exponential phase (OD660 nm, 0.4–0.5) were harvested following centrifugation, washed twice, and sus-
96
Sato Y et al.
Table 1 Primers used in this study Primer designations
Sequences (5′>3′)
Purpose or target region
Reference
expglk5
ATCTCGAGGCTAAGAAACTTTTAGGGATTGATC
E. coli glk clone
This study
expglk3
GAAATGATAGAGATAATTGACATAATTTTCCT
E. coli glk clone
This study
ldhF
CCGAGCAACAATAACACTC
IFDC2 amplification
17)
ermR
GAAGCTGTCAGTAGTATACC
IFDC2 amplification
17)
dpr51
GGCACATGGGATAAATCAATAACT
S. mutans glk IFDC2 and markerless mutants
This study
3Tglk5R
GCTAAATGACGTGCGTAAAATCAATTCAGCA
S. mutans glk IFDC2 mutant
This study
5Tglk3F
ATTTTACGCACGTCATTTAGCAGAAGA
S. mutans glk IFDC2 mutant
This study
glk31
ACACGAAAATAATTCCAAACAAA
S. mutans glk IFDC2 and markerless mutants
This study
3Tglk5R
GCTAAATGACGTGCGTAAAATCAATTCAGCA
S. mutans glk markerless mutant This study
5Tglk3F
ATTTTACGCACGTCATTTAGCAGAAGA
S. mutans glk markerless mutant This study
manL50
ATTAAACGGAAAAACACAACACAATAA
S. mutans manLM kanr mutant
This study
kanTmanL3
GGGTTTATCCGGGATCCTGGCGATAACGATTCCGA
S. mutans manLM kanr mutant
This study
kanF
GGATCCCGGATAAACCCAG
S. mutans manLM kanr mutant
This study
kanR
GCGGATCCCGAGCTTTT
S. mutans manLM kanr mutant
This study
kanTmanM5 AGCTCGGGATCCGCTCACTCAACTGGTAAAACCAT
S. mutans manLM kanr mutant
This study
manM30
GCAATGGTAATACCTTTTTGTGAAAA
S. mutans manLM kanr mutant
This study
pgm51
GCTTATGCTAAACTTCCCGA
S. mutans pgm Emr mutant
This study
EmTpgm5R
GATACTGCACTATCAACACACTCTTCACCATAAACTTTGTAACCA
S. mutans pgm Emr mutant
This study
Em50
AAGAGTGTGTTGATAGTGCAGTATC
S. mutans pgm Emr mutant
This study
Em30
GGCGCTAGGGACCTCT
S. mutans pgm Emr mutant
This study
EmTpgm3F
AGAGGTCCCTAGCGCCGAAAATCAAATTCTACAT
S. mutans pgm Emr mutant
This study
pgm31
GATACACGAACAGAAATCTTGGT
S. mutans pgm Emr mutant
This study
Underlined sequences are those of added nucleotides for restriction endonuclease reactions or those necessary for splicing by overlapping extension method.
pended in 1/100 volume of 50 mM potassium phosphate buffer (pH 7.0) containing 5 mM 2-mercaptoethanol. Cell density was adjusted to approximately 30 (OD660 nm) and permeabilized with toluene according to the method reported by Vadeboncoeur and Trahan14). 5. Preparation of supernatant samples to determine released glucose from intact and permeabilized cells suspended in buffer containing maltose The permeabilized cells, as well as intact cells, were suspended in 1 ml of 50 mM potassium phosphate buffer (pH 7.0) containing 13.75 mM maltose at an OD660 of 3 and incubated at 37°C for 30 min. Cells were centrifuged immediately after the incubation
period and the supernatant filtrated as described above as an extracellular fluid sample for the glucose assay. 6. Enzyme assays for glucokinase activity and released glucose from cells NADP-linked glucose-6-phosphate dehydrogenase (G6PDH) enzyme reactions were conducted throughout these assays10). Enzyme assays for glucokinase activity in an E. coli glk clone, S. mutans UA159, and its glk mutant were performed in a 1-ml cuvette containing 80 mM TrisCl (pH 7.5), 10 mM MgCl2, 0.5 mM NADP, 2 IU G6PDH (Oriental Yeast Co., Ltd., Tokyo, Japan), 5.5 mM glucose, and a crude extract. The cuvette was pre-warmed in a cuvette holder ( JASCO HMC-358, JASCO Corporation, Tokyo, Japan) incorporated in
97
Glc-PTS in S. mutans Maltose Metabolism
Table 2 Glucokinase activities of E. coli glk clone and S. mutans glk mutant E. coli
S. mutans
pBAD/HisA (vector)
ZFG7 (glk clone)
cvU8 (glk)
UA159 (wild type)
0.111±0.019*
22.5±5.9*
0.00753±0.00269**
0.573±0.123** (IU)
Crude extract added in cuvette: ZFG7 (E. coli glk clone), 1.8–4.7 μg; pBAD/HisA (E. coli vector clone), 5.1–10.6 μg; cvU8 (S. mutans glk mutant), 34–49 μg; UA159 (wild type), 37–74 μg. Mean±SD. Data represent results from three or four independent experiments. * p
