IJC International Journal of Cancer
GMCSF-armed vaccinia virus induces an antitumor immune response €ha €-Koskela1, Anna Kanerva1,3, Suvi Parviainen1*, Marko Ahonen1*, Iulia Diaconu1, Anja Kipar2, Mikko Siurala1, Markus Va 4 1 Vincenzo Cerullo * and Akseli Hemminki * 1
Cancer Gene Therapy Group, Department of Pathology and Transplantation Laboratory, Haartman Institute, University of Helsinki, Helsinki, Finland Finnish Centre for Laboratory Animal Pathology, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland 3 Department of Obstetrics and Gynecology, Helsinki University Central Hospital, Helsinki, Finland 4 Laboratory of Immunovirotherapy, Faculty of Pharmacy, Centre for Drug Research and Division of Biopharmaceutics and Pharmacokinetics, University of Helsinki, Helsinki, Finland 2
Oncolytic vaccinia virus is appealing for cancer gene therapy owing to several characteristics. Wild-type vaccinia viruses have been used in hundreds of millions of humans as a vaccine for the eradication of smallpox. In addition to its solid safety profile in humans, vaccinia virus has a strong oncolytic effect owing to its fast replication cycle1 and high tropism for cancer tissue,2 which has led to the design of novel cancer therapeutics based on vaccinia backbones.3,4 In our studies, we use double-deleted Western Reserve vaccinia virus (vvdd)
with deletions in the virally encoded thymidine kinase (TK) and vaccinia growth factor (VGF) genes.5–7 These genes are necessary for replication in normal cells but not in cancer cells, and both genes have been shown to reduce the pathogenicity of the virus.8,9 Good safety and preliminary evidence of efficacy have been seen with oncolytic vaccinia virus in preclinical models and clinical trials.10–12 The replication of oncolytic virus in the tumor is an immunogenic phenomenon, and their antitumor efficacy
Key words: GMCSF, oncolytic vaccinia virus, immunotherapy Abbreviations: BrdU: bromodeoxyuridine; ELISA: enzyme-linked immunosorbent assay; FACS: fluorescence-activated cell sorting; GMCSF: granulocyte-macrophage colony-stimulating factor; PBS: phosphate-buffered saline; PFU: plaque-forming unit; TK: thymidine kinase; VGF: vaccinia growth factor Additional Supporting Information may be found in the online version of this article. Anja Kipar’s current address is: Institute of Veterinary Pathology, Vetsuisse Faculty, University of Zurich, Zurich, Switzerland. Conflict of interest: A.H. is shareholder in Oncos Therapeutics, Ltd., shareholder in and employee of TILT Biotherapeutics Ltd. M.S. is currently an employee of TILT Biotherapeutics Ltd. The other authors declare that they have no competing financial interest *S.P. and M.A. contributed equally as first authors and V.C and A.H. contributed equally as last authors and as corresponding authors. Grant sponsor: Marie Curie; Grant number: FP7-IRG-2008; Grant sponsors: Integrative Life Sciences Doctoral Program, Helsinki Biomedical Graduate School, University of Helsinki Postdoctoral Grant, European Research Council, HUCH Research Funds (EVO), Finnish Cancer Society, Sigrid Juselius Foundation, Academy of Finland, University of Helsinki, Orion-Farmos Research Foundation, K. Albin Johansson Foundation, Ida Montini Foundation, Biocentrum Helsinki, Biocenter Finland, University of Helsinki and ASCO Foundation DOI: 10.1002/ijc.29068 History: Received 13 Feb 2014; Accepted 23 June 2014; Online 8 Jul 2014 Correspondence to: Akseli Hemminki, Haartman Institute, University of Helsinki, Haartmaninkatu 3, 00290 Helsinki, Finland, Fax: 13589-1912–5465, E-mail: akseli.hemminki@helsinki.fi or Vincenzo Cerullo, University of Helsinki, Viikinkaari 5 E, P.O. Box 56, 00790 Helsinki, Finland, E-mail: vincenzo.cerullo@helsinki.fi
C 2014 UICC Int. J. Cancer: 136, 1065–1072 (2015) V
Tumor Immunology
Oncolytic Western Reserve strain vaccinia virus selective for epidermal growth factor receptor pathway mutations and tumorassociated hypermetabolism was armed with human granulocyte-macrophage colony-stimulating factor (GMCSF) and a tdTomato fluorophore. As the assessment of immunological responses to human transgenes is challenging in the most commonly used animal models, we used immunocompetent Syrian golden hamsters, known to be sensitive to human GMCSF and semipermissive to vaccinia virus. Efficacy was initially tested in vitro on various human and hamster cell lines and oncolytic potency of transgene-carrying viruses was similar to unarmed virus. The hGMCSF-encoding virus was able to completely eradicate subcutaneous pancreatic tumors in hamsters, and to fully protect the animals from subsequent rechallenge with the same tumor. Induction of specific antitumor immunity was also shown by ex vivo co-culture experiments with hamster splenocytes. In addition, histological examination revealed increased infiltration of neutrophils and macrophages in GMCSF-virus-treated tumors. These findings help clarify the mechanism of action of GMCSF-armed vaccinia viruses undergoing clinical trials.
1066
GMCSF-armed vaccinia virus
Tumor Immunology
What’s new? Oncolytic vaccinia viruses have shown promising results in cancer treatment. Tumor oncolysis is also an immunogenic phenomenon, thus it has been proposed to enhance activation of the immune system by arming the viruses with immunostimulatory molecules like granulocyte-macrophage colony-stimulating factor (GMCSF). However, this approach has not been studied much in model systems due to species incompatibility issues, even in the case of viruses in late-stage clinical investigation like JX-594. This study provides insight into the mechanism of action of a human GMCSF-expressing Western Reserve strain double-deleted vaccinia virus as well as clues on how JX-594 exert their effects in humans.
might partly be due to activation of the immune system against the virus-infected tumor cells.13–15 There is no doubt that the immune system can mediate antitumor effects, but exciting recent developments indicate that the activity of an oncolytic virus within tumor tissue can boost this response and lead to enhanced tumor rejection and possibly even break immune tolerance induced by tumors.16 Conversely, the immune system can also hinder viral replication and spreading by multiple mechanisms.15 For most human solid tumors, there is wide variation to which degree they are infiltrated by cells of the immune system, and a predictive or prognostic immunoscore has been proposed.17 Nevertheless, despite the presence of immune cells, tumors frequently remain refractory and continue progressing, owing to the immunosuppressive nature of the tumor microenvironment.18 To enhance antitumor potency, different strategies have been used to arm oncolytic viruses. One promising immunostimulatory transgene is granulocyte-macrophage colony-stimulating factor (GMCSF), which can recruit dendritic cells and natural killer cells and mediate induction of tumor-specific CD81 cytotoxic T-lymphocytes.11,19 We have previously shown that antitumor efficacy and tumor-specific immunity can be induced after intratumoral injection of oncolytic adenovirus coding for hGMCSF.20,21 Another virus that has shown promising results and proceeded rapidly in clinical trials is Wyeth strain vaccinia virus encoding hGMCSF (JX-594).12,22 However, its mechanism of action is poorly understood. Specifically, the relative contribution of oncolysis and immune response are not known. Moreover, the immunological consequences of GMCSF arming are especially relevant, as also counterproductive effects are possible through recruitment of myeloid-derived suppressor cells.23 Because of species incompatibility issues it is difficult to study immunological responses to vaccinia virus in animal models and thus armed oncolytic vaccinia viruses have not been studied much in immunocompetent systems. Human GMCSF is not active in mice but it is active in Syrian hamsters,14,24 and in addition, vaccinia virus has been shown to replicate in hamster cells both in vitro and in vivo.25 In our article, we describe the generation of vvdd-tdTomato-hGMCSF and its preclinical testing in immunocompetent Syrian hamsters.
leukemic cell line) and CV-1 cells (African green monkey kidney fibroblasts) were obtained from ATCC (Manassas, VA). The hamster renal cancer cell line HaK26 was courtesy of Prof. William S.M. Wold (St. Louis, MO) and Syrian golden hamster pancreatic cancer cells Hap-T127 was kindly provided by Dr. Hernandez-Alcoceba (Pamplona, Spain). All cell lines were maintained in the recommended conditions. Vaccinia viruses
For generation of vvdd-tdtomato, the tdTomato gene28 was cloned into pSC65 (a kind gift from Bernie Moss, National Institutes of Health, Bethesda, MD) under the control of the P7.5 promoter to create pSC65-tdTomato. hGMCSF cDNA was inserted under the control of the pE/L promoter to create pSC65-tdTomato-hGMCSF. These shuttle plasmids were co-transfected with vvdd-luc in CV-1 cells. Viruses were amplified on A549 cells and purified over a sucrose cushion, and titers were determined with a standard plaque assay on Vero cells as described previously.5 Plaque-forming unit (PFU) virus titers (PFU/ml) were determined by plaque assay. The presence of the inserted genes was verified by polymerase chain reaction (PCR), with fluorescent microscope and with FACSarray from the cells infected with virus. In vitro cytotoxicity assay
A total of 104 cells were seeded on 96-well plates and infected with different concentrations of virus suspended in growth medium containing 2% fetal calf serum (FCS). One hour later, cells were washed and incubated in growth medium containing 5% FCS. Three days after infection, MTS [3-(4,5-dimethylthiazol-2-yl)25-(3carboxymethoxyphenyl)22-(4-sulfophenyl)22H-tetrazolium] cytotoxicity assay was performed (Cell Titer 96 AQueous One Solution proliferation assay; Promega, Madison, WI). GMCSF expression
Cells on 24-well plates were infected with different concentrations of virus suspended in growth medium containing 2% FCS. Thirty minutes later, cells were washed and incubated in complete growth medium for different amount of time. Supernatant was collected and analyzed on different time points according to the manufacturer’s manual (FACSarray for hGMCSF).
Material and Methods Cell lines
Functionality of GMCSF
A549 (human lung adenocarcinoma cells), Vero (African green monkey kidney epithelial cells), TF-1 (human erythro-
A549 cells were grown in growth medium with 2% FCS and infected with 0.1 PFU/cell of vvdd-tdTomato-hGMCSF. C 2014 UICC Int. J. Cancer: 136, 1065–1072 (2015) V
1067
Parviainen et al.
Supernatant was collected 48 hr later and filtered through a 0.02-lm inorganic membrane filter (Whatman, Maidstone, UK). A volume of 0.1, 1 or 10 ll of filtered supernatant from vvdd-tdTomato-hGM-CSF-infected A549 cells was applied on TF1 cells. hGMCSF (2 ng/ml) was applied on the positive control cells. TF1 cells without hGMCSF supplementation were used as a negative control.
vvdd-tdTomato-hGMCSF and supernatant was collected and filtered 24 hr later. Supernatant was used as an attractant of the receiver plate of the assay and carboxyfluorescein succinimidyl ester-labeled splenocytes were added on top of the filter plate. Amount of migrated splenocytes was measured with FACS Accuri after 20 hr of incubation. Proliferation assay
Animal experiments were approved by the Experimental Animal Committee of the University of Helsinki, Finland. Syrian hamsters (Mesocricetus auratus) were obtained from Harlan (Indianapolis, IN) at 11 weeks of age and quarantined for at least 1 week. Each 107 Hap-T1 cells (hamster pancreatic carcinoma n 5 16 hamsters/group) were injected subcutaneously into both flanks. When tumors reached the size of 5 mm in diameter, phosphate-buffered saline (PBS), 107 PFU of vvdd-tdTomato or vvdd-tdTomato-hGMCSF was injected into each tumor. Tumor growth was followed every other day. On day 32, when mock tumors reached their maximal permitted size according to the animal regulations, all animals were euthanized and spleens were collected for co-culturing with tumor cells. Na€ıve hamsters and hamsters previously cured with vvdd-tdTomato or vvddtdTomato-hGMCSF were rechallenged with the same tumor (HapT1) or a different hamster renal cancer tumor (HaK), and tumor growth was measured over time (n 5 5 hamsters/group). Co-culturing experiment
Spleens collected from the PBS or virus-treated animals were homogenized, filtered through a 70-mm filter and cultured for 24 hr. A total of 5 3 104 Hap-T1 or HaK cells were cultured on 96-well plates and splenocytes were added at different ratios. Cell viability was measured by MTS assay after 24 hr. Histology and immunohistology
At day 8 post-treatment, the tumors of two animals from each group (PBS, vvdd-tdTomato and vvdd-tdTomatohGMCSF) were excised immediately after euthanasia. Tumor samples were fixed in 10% buffered formalin for 24 hr, followed by storage in 70% EtOH and subsequent trimming and routine paraffin wax embedding. Sections (3–5 mm) were prepared and stained with hematoxylin–eosin or used to demonstrate T cells (CD3-positive) and macrophages/heterophils (calprotectin-positive) by immunohistology. The following cross-reacting primary antibodies were used: rabbit antihuman CD3 (Dako, Glostrup, Denmark) and mouse antihuman calprotectin (clone MAC387; AbDserotec, D€ usseldorf, Germany; cross reaction with heterophils of guinea pigs). The streptavidin peroxidase method with heat pretreatment (citrate buffer pH 6.0) for antigen retrieval and diaminobenzidin as chromogen was applied, as previously published.29
Splenocytes from vvdd-tdTomato-hGMCSF-treated hamsters were cultured ex vivo. Amount of newly synthesized DNA indicating proliferation of the cells was measured by assessing the amount of BrdU after 24 hr of culturing (BrdU cell proliferation ELISA kit, Abcam ab126556). Viral DNA load in tumors of hamsters
DNA was extracted from fixed tumors (n 5 8/group) using QIAmp DNA FFPE tissue kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. PCR targeted viral HA J7R gene. Amplification was based on primers and probe targeting the HA J7R gene (OPHA-probe AGTGCTTGGTATAAGGAG, OPHA-F89 GATGATGCAACTCTATCATGTA and OPHA-R219 GTATAATTATCAAAATAC AAG ACG TC; Applied Biosystems UK, Cheshire, UK). Hamster GAPDH primers and probe were used as an internal control and to normalize viral DNA copies per amount of genomic DNA (GAPDH-probe: CAAGAGTGACCCCACTCTTCCACCTTTGA, primerFW: CACCGAGGACCAGGTTGTCT and primerRV: CATACCAGGAGATGAGCTTTACGA). Quantitative PCR was performed by LightCycler 480 II (Roche Applied Diagnostics, Mannheim, Germany) under the following conditions: 2 min at 50 C, 10 min at 95 C, 50 cycles of 15 sec at 95 C and 1 min at 60 C and 10 min at 40 C. All samples were run in triplicates and water was used as a negative control. A standard curve was generated for absolute quantification by using HA-vaccinia plasmid kindly donated by Prof. Vapalahti, Haartman Institute, University of Helsinki. A standard curve for GADPH was established using known amounts of DNA extracted from cultured cells (1,800–0.18 ng). Statistical analysis
All values are indicated as mean and standard error of the mean (SEM). Tumor sizes as a function of time were compared by Mann–Whitney test (MedCalc software) and p-values of
GMCSF-armed vaccinia virus induces an antitumor immune response €ha €-Koskela1, Anna Kanerva1,3, Suvi Parviainen1*, Marko Ahonen1*, Iulia Diaconu1, Anja Kipar2, Mikko Siurala1, Markus Va 4 1 Vincenzo Cerullo * and Akseli Hemminki * 1
Cancer Gene Therapy Group, Department of Pathology and Transplantation Laboratory, Haartman Institute, University of Helsinki, Helsinki, Finland Finnish Centre for Laboratory Animal Pathology, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland 3 Department of Obstetrics and Gynecology, Helsinki University Central Hospital, Helsinki, Finland 4 Laboratory of Immunovirotherapy, Faculty of Pharmacy, Centre for Drug Research and Division of Biopharmaceutics and Pharmacokinetics, University of Helsinki, Helsinki, Finland 2
Oncolytic vaccinia virus is appealing for cancer gene therapy owing to several characteristics. Wild-type vaccinia viruses have been used in hundreds of millions of humans as a vaccine for the eradication of smallpox. In addition to its solid safety profile in humans, vaccinia virus has a strong oncolytic effect owing to its fast replication cycle1 and high tropism for cancer tissue,2 which has led to the design of novel cancer therapeutics based on vaccinia backbones.3,4 In our studies, we use double-deleted Western Reserve vaccinia virus (vvdd)
with deletions in the virally encoded thymidine kinase (TK) and vaccinia growth factor (VGF) genes.5–7 These genes are necessary for replication in normal cells but not in cancer cells, and both genes have been shown to reduce the pathogenicity of the virus.8,9 Good safety and preliminary evidence of efficacy have been seen with oncolytic vaccinia virus in preclinical models and clinical trials.10–12 The replication of oncolytic virus in the tumor is an immunogenic phenomenon, and their antitumor efficacy
Key words: GMCSF, oncolytic vaccinia virus, immunotherapy Abbreviations: BrdU: bromodeoxyuridine; ELISA: enzyme-linked immunosorbent assay; FACS: fluorescence-activated cell sorting; GMCSF: granulocyte-macrophage colony-stimulating factor; PBS: phosphate-buffered saline; PFU: plaque-forming unit; TK: thymidine kinase; VGF: vaccinia growth factor Additional Supporting Information may be found in the online version of this article. Anja Kipar’s current address is: Institute of Veterinary Pathology, Vetsuisse Faculty, University of Zurich, Zurich, Switzerland. Conflict of interest: A.H. is shareholder in Oncos Therapeutics, Ltd., shareholder in and employee of TILT Biotherapeutics Ltd. M.S. is currently an employee of TILT Biotherapeutics Ltd. The other authors declare that they have no competing financial interest *S.P. and M.A. contributed equally as first authors and V.C and A.H. contributed equally as last authors and as corresponding authors. Grant sponsor: Marie Curie; Grant number: FP7-IRG-2008; Grant sponsors: Integrative Life Sciences Doctoral Program, Helsinki Biomedical Graduate School, University of Helsinki Postdoctoral Grant, European Research Council, HUCH Research Funds (EVO), Finnish Cancer Society, Sigrid Juselius Foundation, Academy of Finland, University of Helsinki, Orion-Farmos Research Foundation, K. Albin Johansson Foundation, Ida Montini Foundation, Biocentrum Helsinki, Biocenter Finland, University of Helsinki and ASCO Foundation DOI: 10.1002/ijc.29068 History: Received 13 Feb 2014; Accepted 23 June 2014; Online 8 Jul 2014 Correspondence to: Akseli Hemminki, Haartman Institute, University of Helsinki, Haartmaninkatu 3, 00290 Helsinki, Finland, Fax: 13589-1912–5465, E-mail: akseli.hemminki@helsinki.fi or Vincenzo Cerullo, University of Helsinki, Viikinkaari 5 E, P.O. Box 56, 00790 Helsinki, Finland, E-mail: vincenzo.cerullo@helsinki.fi
C 2014 UICC Int. J. Cancer: 136, 1065–1072 (2015) V
Tumor Immunology
Oncolytic Western Reserve strain vaccinia virus selective for epidermal growth factor receptor pathway mutations and tumorassociated hypermetabolism was armed with human granulocyte-macrophage colony-stimulating factor (GMCSF) and a tdTomato fluorophore. As the assessment of immunological responses to human transgenes is challenging in the most commonly used animal models, we used immunocompetent Syrian golden hamsters, known to be sensitive to human GMCSF and semipermissive to vaccinia virus. Efficacy was initially tested in vitro on various human and hamster cell lines and oncolytic potency of transgene-carrying viruses was similar to unarmed virus. The hGMCSF-encoding virus was able to completely eradicate subcutaneous pancreatic tumors in hamsters, and to fully protect the animals from subsequent rechallenge with the same tumor. Induction of specific antitumor immunity was also shown by ex vivo co-culture experiments with hamster splenocytes. In addition, histological examination revealed increased infiltration of neutrophils and macrophages in GMCSF-virus-treated tumors. These findings help clarify the mechanism of action of GMCSF-armed vaccinia viruses undergoing clinical trials.
1066
GMCSF-armed vaccinia virus
Tumor Immunology
What’s new? Oncolytic vaccinia viruses have shown promising results in cancer treatment. Tumor oncolysis is also an immunogenic phenomenon, thus it has been proposed to enhance activation of the immune system by arming the viruses with immunostimulatory molecules like granulocyte-macrophage colony-stimulating factor (GMCSF). However, this approach has not been studied much in model systems due to species incompatibility issues, even in the case of viruses in late-stage clinical investigation like JX-594. This study provides insight into the mechanism of action of a human GMCSF-expressing Western Reserve strain double-deleted vaccinia virus as well as clues on how JX-594 exert their effects in humans.
might partly be due to activation of the immune system against the virus-infected tumor cells.13–15 There is no doubt that the immune system can mediate antitumor effects, but exciting recent developments indicate that the activity of an oncolytic virus within tumor tissue can boost this response and lead to enhanced tumor rejection and possibly even break immune tolerance induced by tumors.16 Conversely, the immune system can also hinder viral replication and spreading by multiple mechanisms.15 For most human solid tumors, there is wide variation to which degree they are infiltrated by cells of the immune system, and a predictive or prognostic immunoscore has been proposed.17 Nevertheless, despite the presence of immune cells, tumors frequently remain refractory and continue progressing, owing to the immunosuppressive nature of the tumor microenvironment.18 To enhance antitumor potency, different strategies have been used to arm oncolytic viruses. One promising immunostimulatory transgene is granulocyte-macrophage colony-stimulating factor (GMCSF), which can recruit dendritic cells and natural killer cells and mediate induction of tumor-specific CD81 cytotoxic T-lymphocytes.11,19 We have previously shown that antitumor efficacy and tumor-specific immunity can be induced after intratumoral injection of oncolytic adenovirus coding for hGMCSF.20,21 Another virus that has shown promising results and proceeded rapidly in clinical trials is Wyeth strain vaccinia virus encoding hGMCSF (JX-594).12,22 However, its mechanism of action is poorly understood. Specifically, the relative contribution of oncolysis and immune response are not known. Moreover, the immunological consequences of GMCSF arming are especially relevant, as also counterproductive effects are possible through recruitment of myeloid-derived suppressor cells.23 Because of species incompatibility issues it is difficult to study immunological responses to vaccinia virus in animal models and thus armed oncolytic vaccinia viruses have not been studied much in immunocompetent systems. Human GMCSF is not active in mice but it is active in Syrian hamsters,14,24 and in addition, vaccinia virus has been shown to replicate in hamster cells both in vitro and in vivo.25 In our article, we describe the generation of vvdd-tdTomato-hGMCSF and its preclinical testing in immunocompetent Syrian hamsters.
leukemic cell line) and CV-1 cells (African green monkey kidney fibroblasts) were obtained from ATCC (Manassas, VA). The hamster renal cancer cell line HaK26 was courtesy of Prof. William S.M. Wold (St. Louis, MO) and Syrian golden hamster pancreatic cancer cells Hap-T127 was kindly provided by Dr. Hernandez-Alcoceba (Pamplona, Spain). All cell lines were maintained in the recommended conditions. Vaccinia viruses
For generation of vvdd-tdtomato, the tdTomato gene28 was cloned into pSC65 (a kind gift from Bernie Moss, National Institutes of Health, Bethesda, MD) under the control of the P7.5 promoter to create pSC65-tdTomato. hGMCSF cDNA was inserted under the control of the pE/L promoter to create pSC65-tdTomato-hGMCSF. These shuttle plasmids were co-transfected with vvdd-luc in CV-1 cells. Viruses were amplified on A549 cells and purified over a sucrose cushion, and titers were determined with a standard plaque assay on Vero cells as described previously.5 Plaque-forming unit (PFU) virus titers (PFU/ml) were determined by plaque assay. The presence of the inserted genes was verified by polymerase chain reaction (PCR), with fluorescent microscope and with FACSarray from the cells infected with virus. In vitro cytotoxicity assay
A total of 104 cells were seeded on 96-well plates and infected with different concentrations of virus suspended in growth medium containing 2% fetal calf serum (FCS). One hour later, cells were washed and incubated in growth medium containing 5% FCS. Three days after infection, MTS [3-(4,5-dimethylthiazol-2-yl)25-(3carboxymethoxyphenyl)22-(4-sulfophenyl)22H-tetrazolium] cytotoxicity assay was performed (Cell Titer 96 AQueous One Solution proliferation assay; Promega, Madison, WI). GMCSF expression
Cells on 24-well plates were infected with different concentrations of virus suspended in growth medium containing 2% FCS. Thirty minutes later, cells were washed and incubated in complete growth medium for different amount of time. Supernatant was collected and analyzed on different time points according to the manufacturer’s manual (FACSarray for hGMCSF).
Material and Methods Cell lines
Functionality of GMCSF
A549 (human lung adenocarcinoma cells), Vero (African green monkey kidney epithelial cells), TF-1 (human erythro-
A549 cells were grown in growth medium with 2% FCS and infected with 0.1 PFU/cell of vvdd-tdTomato-hGMCSF. C 2014 UICC Int. J. Cancer: 136, 1065–1072 (2015) V
1067
Parviainen et al.
Supernatant was collected 48 hr later and filtered through a 0.02-lm inorganic membrane filter (Whatman, Maidstone, UK). A volume of 0.1, 1 or 10 ll of filtered supernatant from vvdd-tdTomato-hGM-CSF-infected A549 cells was applied on TF1 cells. hGMCSF (2 ng/ml) was applied on the positive control cells. TF1 cells without hGMCSF supplementation were used as a negative control.
vvdd-tdTomato-hGMCSF and supernatant was collected and filtered 24 hr later. Supernatant was used as an attractant of the receiver plate of the assay and carboxyfluorescein succinimidyl ester-labeled splenocytes were added on top of the filter plate. Amount of migrated splenocytes was measured with FACS Accuri after 20 hr of incubation. Proliferation assay
Animal experiments were approved by the Experimental Animal Committee of the University of Helsinki, Finland. Syrian hamsters (Mesocricetus auratus) were obtained from Harlan (Indianapolis, IN) at 11 weeks of age and quarantined for at least 1 week. Each 107 Hap-T1 cells (hamster pancreatic carcinoma n 5 16 hamsters/group) were injected subcutaneously into both flanks. When tumors reached the size of 5 mm in diameter, phosphate-buffered saline (PBS), 107 PFU of vvdd-tdTomato or vvdd-tdTomato-hGMCSF was injected into each tumor. Tumor growth was followed every other day. On day 32, when mock tumors reached their maximal permitted size according to the animal regulations, all animals were euthanized and spleens were collected for co-culturing with tumor cells. Na€ıve hamsters and hamsters previously cured with vvdd-tdTomato or vvddtdTomato-hGMCSF were rechallenged with the same tumor (HapT1) or a different hamster renal cancer tumor (HaK), and tumor growth was measured over time (n 5 5 hamsters/group). Co-culturing experiment
Spleens collected from the PBS or virus-treated animals were homogenized, filtered through a 70-mm filter and cultured for 24 hr. A total of 5 3 104 Hap-T1 or HaK cells were cultured on 96-well plates and splenocytes were added at different ratios. Cell viability was measured by MTS assay after 24 hr. Histology and immunohistology
At day 8 post-treatment, the tumors of two animals from each group (PBS, vvdd-tdTomato and vvdd-tdTomatohGMCSF) were excised immediately after euthanasia. Tumor samples were fixed in 10% buffered formalin for 24 hr, followed by storage in 70% EtOH and subsequent trimming and routine paraffin wax embedding. Sections (3–5 mm) were prepared and stained with hematoxylin–eosin or used to demonstrate T cells (CD3-positive) and macrophages/heterophils (calprotectin-positive) by immunohistology. The following cross-reacting primary antibodies were used: rabbit antihuman CD3 (Dako, Glostrup, Denmark) and mouse antihuman calprotectin (clone MAC387; AbDserotec, D€ usseldorf, Germany; cross reaction with heterophils of guinea pigs). The streptavidin peroxidase method with heat pretreatment (citrate buffer pH 6.0) for antigen retrieval and diaminobenzidin as chromogen was applied, as previously published.29
Splenocytes from vvdd-tdTomato-hGMCSF-treated hamsters were cultured ex vivo. Amount of newly synthesized DNA indicating proliferation of the cells was measured by assessing the amount of BrdU after 24 hr of culturing (BrdU cell proliferation ELISA kit, Abcam ab126556). Viral DNA load in tumors of hamsters
DNA was extracted from fixed tumors (n 5 8/group) using QIAmp DNA FFPE tissue kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. PCR targeted viral HA J7R gene. Amplification was based on primers and probe targeting the HA J7R gene (OPHA-probe AGTGCTTGGTATAAGGAG, OPHA-F89 GATGATGCAACTCTATCATGTA and OPHA-R219 GTATAATTATCAAAATAC AAG ACG TC; Applied Biosystems UK, Cheshire, UK). Hamster GAPDH primers and probe were used as an internal control and to normalize viral DNA copies per amount of genomic DNA (GAPDH-probe: CAAGAGTGACCCCACTCTTCCACCTTTGA, primerFW: CACCGAGGACCAGGTTGTCT and primerRV: CATACCAGGAGATGAGCTTTACGA). Quantitative PCR was performed by LightCycler 480 II (Roche Applied Diagnostics, Mannheim, Germany) under the following conditions: 2 min at 50 C, 10 min at 95 C, 50 cycles of 15 sec at 95 C and 1 min at 60 C and 10 min at 40 C. All samples were run in triplicates and water was used as a negative control. A standard curve was generated for absolute quantification by using HA-vaccinia plasmid kindly donated by Prof. Vapalahti, Haartman Institute, University of Helsinki. A standard curve for GADPH was established using known amounts of DNA extracted from cultured cells (1,800–0.18 ng). Statistical analysis
All values are indicated as mean and standard error of the mean (SEM). Tumor sizes as a function of time were compared by Mann–Whitney test (MedCalc software) and p-values of
