Gonadal Development and Gonadotropin Gene Expression During Puberty in Cultured Chub Mackerel (Scomber japonicus) Author(s): Mitsuo Nyuji, Ryoko Kodama, Keitaro Kato, Shinji Yamamoto, Akihiko Yamaguchi and Michiya Matsuyama Source: Zoological Science, 31(6):398-406. 2014. Published By: Zoological Society of Japan DOI: http://dx.doi.org/10.2108/zs130254 URL: http://www.bioone.org/doi/full/10.2108/zs130254

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research.

ZOOLOGICAL SCIENCE 31: 398–406 (2014)

¤ 2014 Zoological Society of Japan

Gonadal Development and Gonadotropin Gene Expression During Puberty in Cultured Chub Mackerel (Scomber japonicus) Mitsuo Nyuji1†, Ryoko Kodama1, Keitaro Kato2, Shinji Yamamoto2, Akihiko Yamaguchi1, and Michiya Matsuyama1* 1

Laboratory of Marine Biology, Faculty of Agriculture, Kyushu University, Fukuoka 812-8581, Japan 2 Fisheries Laboratory of Kinki University, Shirahama, Wakayama 649-2211, Japan

Understanding puberty is important for establishing aquaculture in fish. In this study, we analyzed the timing and completion of pubertal development along with changes in pituitary gonadotropin genes (fshb and lhb) in cultured chub mackerel (Scomber japonicus). At 45 days post-hatching (dph), gonadal sex differentiation was observed. The onset of puberty occurred at 192 dph in females with the start of vitellogenesis, whereas it occurred at 164 dph in males, with the beginning of spermatogenesis (proliferation and differentiation of germ cells). The completion of puberty was at 326 dph in females when vitellogenesis completed, and it was at 338 dph in males during spermiation. All fish sampled during the spawning season completed pubertal development. In the pituitary of female fish, fshb expression was activated during early secondary growth and was maintained high throughout vitellogenesis, whereas lhb expression was highest at the completion of vitellogenesis. In male fish, fshb and lhb expression were activated from the onset of spermatogenesis and further activated during late pubertal development; fshb remained high between late spermatogenesis and spermiation, whereas lhb was highest during spermiation. Key words: puberty, gonadal development, gonadotropin, follicle-stimulating hormone, luteinizing hormone, chub mackerel

INTRODUCTION The chub mackerel (Scomber japonicus), which belongs to the order Perciformes and the family Scombridae, is one of the most important pelagic fish resources in Japan. These fish are widely distributed from the East China Sea to the Sea of Japan, and the Pacific coast of Japan. Like many other pelagic species, chub mackerel is a multiple spawning fish, and shows a seasonal reproductive cycle. The spawning period for chub mackerel is between January and June in the East China Sea, and between April and June near central Japan (Asano and Tanaka, 1989; Watanabe and Yatsu, 2006; Yukami et al., 2009). Recently, the importance of chub mackerel aquaculture has been recognized as a response to declining wild populations (Watanabe and Yatsu, 2004; Mendiola et al., 2008). Knowledge about the process of reproduction in captive-reared chub mackerel is required for successful establishment of its aquaculture. Like other reared fish, female chub mackerel complete vitellogenesis in captivity but usually fail to undergo final oocyte maturation (FOM), ovulation, and spawning (Shiraishi * Corresponding author. Tel. : +81-92-642-2887; Fax : +81-92-642-2888; E-mail : [email protected] † Present address: National Research Institute of Aquaculture, Fisheries Research Agency, Minamiise, Watarai, Mie 516-0193, Japan doi:10.2108/zs130254

et al., 2005). However, in one report, eggs were continuously spawned from 3-year-old fishes that were cultured in a net-pen and relocated to a 50,000-L land tank before the spawning season (Murata et al., 2005). Ovulation and spawning are induced using hormonal treatments, such as human chorionic gonadotropin (hCG) and gonadotropinreleasing hormone analog (GnRHa), in wild chub mackerel that are farmed after catching (Shiraishi et al., 2005, 2008; Nyuji et al., 2011). Thus, eggs can be produced in chub mackerel under captive conditions using artificial manipulation when adult fish complete vitellogenesis and spermatogenesis. Puberty is defined as the time at which reproduction first becomes possible, and is a key factor in influencing growth and egg production in fish (Taranger et al., 2010). The size and age of chub mackerel at first maturity, which varies by population and year-class, ranging from 200 to 250 mm and from 1 to 2 years, respectively, were estimated by field investigation (Ouchi and Hamasaki, 1979; Kishida, 1986; Watanabe and Yatsu, 2006). In cultured chub mackerel, growth and changes in gonadosomatic index (GSI) after hatching were previously analyzed (Ishibashi et al., 2006, 2007). The process of gonadal formation and sex differentiation of cultured fish has recently been demonstrated using histological analysis (Kobayashi et al., 2011). Some studies of chub mackerel rearing have thus been made; however, the timing of puberty and the frequency of sexual maturation have not been examined in detail.

Puberty and GtH in chub mackerel

As in other vertebrates, the brain–pituitary–gonad (BPG) axis is the most important endocrine system controlling the reproductive process in teleosts, and is activated at the onset of puberty (Okuzawa, 2002). Gonadotropin (GtH) plays a central role in the BPG axis (Levavi-Sivan et al., 2010). Hypothalamic GnRH acts on the pituitary and regulates GtH synthesis and release, which in turn act on the gonads to regulate gametogenesis via the production of sex steroids (Planas and Swanson, 1995; Zohar et al., 2010). As in other teleost species, two distinct types of GtHs, folliclestimulating hormone (FSH) and luteinizing hormone (LH), both of which are composed of a common α-subunit and a hormone-specific β-subunit (FSHβ and LHβ), were identified by the use of immunological and molecular techniques in chub mackerel. In female chub mackerel at ages 2–3-yearsold, FSH-producing cells and fshb expression increases as vitellogenesis progresses, whereas LH-producing cells and lhb are abundant at the completion of vitellogenesis (Nyuji et al., 2011, 2012a). An in vitro bioassay of ovaries incubated with native chub mackerel GtHs demonstrated that FSH stimulated estradiol-17β (E2) secretion and LH induced initiation of FOM via 17,20β-dihydroxy-4-pregene-3-one (17,20β-P) production (Nyuji et al., 2013). In the ovary of teleosts, E2 is known to induce vitellogenesis, and 17,20βP is a maturation-inducing hormone in many fishes including chub mackerel (Matsuyama et al., 2005; Lubzens et al., 2010). These previous findings suggest that FSH plays a role in vitellogenesis via E2, whereas LH acts on FOM in female chub mackerel. In male chub mackerel at ages 2–3years-old, annual profiles of FSH- and LH-producing cells and fshb and lhb expression in the pituitary indicated that FSH may be important during early and late spermatogenesis, whereas LH may play a role during late spermatogenesis and spermiation (Nyuji et al., 2012b). Thus, our knowledge of GtH function during chub mackerel reproduction has been recently improved by the study of postpubertal fish. In the present study, we aimed to gain a better understanding of the changes in gonadal development during puberty and the frequency of sexual maturation of 1-year-old cultured chub mackerel. Additionally, we analyzed gene expression profiles of GtHβ to understand the timing of GtH activation during the first sexual maturation. MATERIALS AND METHODS Animals and sampling All fish used in this study were maintained in the Fisheries Laboratory of Kinki University, Shirahama, Wakayama Prefecture, Japan. Fertilized eggs were artificially obtained from 3-year-old cultured chub mackerel (310–320 mm in fork length [FL]). On 25 May 2010, fish were taken from the stock in a net-pen, anaesthetized with 2-phenoxyethanol (100 ppm, Wako), and injected with hCG (500 IU/kg, gonadotropin, ASKA Pharmaceutical) dissolved in 0.6% NaCl solution. The following day, eggs stripped from two ovulating females were fertilized and incubated in 500-L polycarbonate tanks. The larvae hatched on 29 May, and they were fed rotifers (Brachionus plicatilis sp. complex) and Artemia at 3–10 and 9–22 days posthatching (dph), respectively. The water temperature during the period between the induction of ovulation and egg incubation was around 21°C. From 15 to 33 dph, the fish were fed a commercial feed (New-Artech, Marubeni Nisshin Feed). From 34 dph onwards, they were moved to a net-pen and fed commercial dry pellets (EP, Marubeni Nisshin Feed). About 15 fish were sampled once or twice per month between 29 May 2010 and 26 July 2011 (0–423 dph),

399

where all samplings were performed between 10:00 and 12:00. FL and body weight (BW) were recorded for each fish. After fish decapitation, whole body without head (15–72 dph) or excised gonads (95–423 dph) were fixed in 10% formalin or Bouin’s solution, while whole head or excised brain and pituitary were immersed in RNAlater (QIAGEN) for 1 week and stored at –20°C until RNA extraction. All animal experiments were performed in accordance with the Guidelines for Animal Experimentation of the Kinki University. Gonadal histology and in vitro bioassay Whole body without head or piece of gonad fixed in 10% formalin or Bouin’s solution were dehydrated through a graded series of ethanol, embedded in paraffin, sectioned at 5-μm and stained with hematoxylin and eosin for light microscopy. To confirm that fully-grown vitellogenic ovaries undergo FOM, the in vitro bioassay for hCG was performed on May 2011 (338 dph) using piece of ovaries removed from females immediately after the usual sampling, according to the method described by Ohga et al. (2012). Quantitative real-time PCR Since the pituitary gland could be separated from the brain in the fish sampled from 30 dph onwards, the expression levels of GtHβ mRNAs in the pituitary were analyzed in fish sampled between 30 and 423 dph. After removing RNAlater, the pituitary was homogenized in 0.8 ml of ISOGEN (Nippon Gene), and total RNA was extracted and treated with DNase I (Invitrogen). cDNA was synthesized using Superscript III reverse transcriptase (Invitrogen) and random hexamer primers (Takara), as described in the manufacturer’s protocol. Quantitative real-time PCR detection of chub mackerel GtHβ genes (fshb and lhb) was performed using a Stratagene Mx3000P system with gene specific primers and the Brilliant III Fast SYBR Green QPCR master mix (Stratagene) as described elsewhere (Nyuji et al., 2012a). Briefly, a total of 10 μl of reaction mixture contained 5 μl of 2× master mix and 10 nM reference dye (both reagents were supplied with a Brilliant III Ultra-Fast SYBR Green QPCR Master Mix), 1 μl of cDNA (corresponding to 3 ng of the total RNA), and 0.1 μM each primer. Serial 10-fold dilutions (from 103 to 109 copies/μl) of the plasmids containing fulllength of each gene was made and added to the reaction mixture in place of template cDNAs to generate standard curves. The thermal cycling conditions were set as 95°C for 5 min and 40 cycles of 95°C for 10 s and 60°C for 30 s and threshold cycle (Ct) data were collected with MxPro-Mx3000P software (Stratagene). All samples were amplified with duplicate and the mean was obtained for further analysis. The absolute copy numbers of fshb and lhb transcripts were normalized to the expression of the transcript abundance of βactin, which was shown to be stable across groups (data not shown). Primers used in this study are shown in Table 1. Statistical analyses Temporal and stage-specific variations within each GtHβ gene expressions were compared using one-way ANOVA followed by Tukey’s multiple comparison test to identify significant differences, which were determined as P < 0.05.

Table 1.

Primer sequences used in real-time PCR.

GenBank Target Accession number fshb

JF495132

Primer

fshb-FW fshb-RV lhb JF495133 lhb-FW lhb-RV bactin GU731674 bactin-FW bactin-RV

Seqence 5′-3′ TGTGAAGGACAGTGTTACCACAGGG TCATAGGTCCAGTCACCGC GAAACAACCATCTGCAGCG AAAAGTCCCGATACGTGCAC ACCGGTATTGTCATGGACTC TCATGAGGTAGTCTGTGAGGTC

400

M. Nyuji et al.

RESULTS Growth Throughout the rearing period, similar changes were observed in average FL and BW for both female and male chub mackerel (Fig. 1). The average FL and BW of chub mackerel was 55 mm and 1.8 g, respectively, at 30 dph (28 June 2010). Thereafter, the average FL increased, reaching 228 mm in females and 217 mm in males at 338 dph (2 May 2011) during the spawning season. The average BW increased from 30 to 213 dph (28 December), but decreased prior to the spawning season, between January and March 2011, and rose again from April, reaching 158.5 g in females and 145.4 g in males at 338 dph. The water temperature was 18°C on 2 May 2011. Gonadal development At 15 dph, primordial germ cells (PGCs) were found in the gonadal anlagen (Fig. 2A, B). The gonadal anlagen

Fig. 1. Temporal changes in water temperature, and fork length (FL) and body weight (BW) of chub mackerel during pubertal development (30–423 dph). Vertical bars indicate standard errors of the mean (SEM).

stromal cells proliferated at 30 dph (Fig. 2C). Gonadal sex differentiation was observed at 45 dph when the water temperature was 25°C. In the ovary, the ovarian cavity was formed, and primary growth oocytes in the chromatin nucleolus stage were present along the wall inside the cavity (Fig. 2D). In the testis, sperm duct and spermatogonia were found (Fig. 2K). Ovarian development in females after gonadal sex differentiation was classified into seven stages. In the immature (IM) ovaries, the ovarian cavity were just formed (IM1; Fig. 2D) and then the ovarian lamellae were formed, showing ovarian lumen, and primary growth oocytes during the perinucleolus stage occupied the ovary (IM2; Fig. 2E). In the early secondary growth (ESG) ovaries, oocytes during the cortical alveolus stage were found with the majority of primary growth oocytes (Fig. 2F). The ovarian stages of fish during vitellogenesis (i.e., late phase of secondary growth) were represented by developmental stages of the most advanced group of oocytes based on histological analysis with paraffin-embedded sections; oocytes of diameter < 250 μm, 250–500 μm, and > 500 μm were deemed to represent early, middle, and late vitellogenesis (EV, MV, and LV), respectively (Fig. 2G–I). Absorption of atretic oocytes was observed in the ovary during post-spawning (PS) (Fig. 2J). The number of females observed in each stage of ovarian development is shown in Table 2. From 45 to 164 dph (from 13 July to 9 November 2010), all females were IM1 and IM2. Females in ESG were found in fish sampled from 213 to 276 dph (from 28 December 2010 to 1 March 2011). Females in EV appeared at 192 dph (7 December 2010) when the water temperature was 19°C, and thereafter the percentage of females in EV and MV increased continuously until 297 dph (22 March 2011), with the increase of water temperature from a minimum of 12°C (late January) to 15°C. Females in LV appeared at 310 dph (4 April) when the water temperature reached 16°C, and all females sampled at 326 and 338 dph (20 April and 2 May) had fully-grown vitellogenic oocytes. Using ovaries harvested from females sampled at 338 dph, an in vitro bioassay for hCG was performed. After 28 h incubation with hCG, FOM were induced in all females. At 423 dph (26 July), the water temperature exceeded 27°C and all females were in PS. Testicular development after sex differentiation was classified into six stages in males. In the IM testes, only type A spermatogonia were observed (Fig. 2K, L). During early spermatogenesis (ES), testes contained type B spermatogonia and spermatocytes, but they did not contain spermatozoa (Fig. 2M). During middle spermatogenesis (MS), germ cells of all stages were found in the testes, including infrequent spermatozoa (Fig. 2N). During late spermatogenesis (LS), spermiogenesis was active (Fig. 2O). The lobular lumina and sperm duct were filled with spermatozoa during spermiation (SP) (Fig. 2P). Spermatozoa were not observed in the testes during resting (RS) (Fig. 2Q). The number of males during each stage of testicular development is shown in Table 3. During the period from 45 to 151 dph (from 13 July to 27 October 2010), all males were IM. ES and MS males appeared at 164 dph (9 November) when the water temperature dropped to < 22°C, and increased thereafter. All males were in LS at 276 dph (1 March 2011) when the water temperature exceeded 15°C. A male in SP appeared at 297 dph

Puberty and GtH in chub mackerel

401

Fig. 2. Histological examination of gonadal development before sex differentiation (A–C), and during pubertal development of female (D–J) and male (K–Q) chub mackerel. Part of gonad from (A) is enlarged in (B). Before sex differentiation, histological analyses were performed in fish sampled at 15 dph (A, B) and 30 dph (C). Sex differentiation was recognized in fish sampled at 45 dph, and ovary (D) and testes (K) were distinguished. Ovarian development was classified into seven stages as follows: IM1 and IM2, immature (D) and (E); ESG, early secondary growth (F); EV, early vitellogenesis (G); MV, middle vitellogenesis (H); LV, late vitellogenesis (I); PS, post-spawning (J). Testicular development was divided into six stages as follows: IM, immature (K, L); ES, early spermatogenesis (M); MS, middle spermatogenesis (N); LS, late spermatogenesis (O); SP, spermiation (P); RS, resting (Q). CA, oocytes during cortical alveolus stage; M, muscle; MD, mesonephric duct; OC, ovarian cavity; OL, ovarian lumen; PG, primary growth oocytes; PGC, primordial germ cell; SC, spermatocyte; SD, sperm duct; SGA, type A spermatogonia; SGB, type B spermatogonia; SZ, spermatozoa; SPD, spermatid; V, oocytes during vitellogenesis. Bar = 50 μm (A–C, J–N) or 100 μm (D–I, O–Q).

402 Table 2.

M. Nyuji et al. Ovarian development of chub mackerel during puberty.

Sample date 2010

13-Jul 28-Jul 9-Aug 1-Sep 25-Sep 27-Oct 9-Nov 7-Dec 28-Dec 2011 31-Jan 14-Feb 1-Mar 22-Mar 4-Apr 20-Apr 2-May 26-Jul

Days posthatching 45 60 72 95 119 151 164 192 213 247 261 276 297 310 326 338 423

Stage of ovarian development IM1 IM2 ESG EV MV LV PS 6 3 8 6 9 11 9 9 8 2 2

1 1 1 3 2

1 1 3 2

2 3 4 7

2 7 7 7

IM, immature; ESG, early secondary growth; EV, early vitellogenesis; MV, middle vitellogenesis; LV, late vitellogenesis; PS, postspawning Table 3.

Testicular development of chub mackerel during puberty.

Sample date 2010

13-Jul 28-Jul 9-Aug 1-Sep 25-Sep 27-Oct 9-Nov 7-Dec 28-Dec 2011 31-Jan 14-Feb 1-Mar 22-Mar 4-Apr 20-Apr 2-May 26-Jul

Days posthatching 45 60 72 95 119 151 164 192 213 247 261 276 297 310 326 338 423

Stage of testicular development IM 7 7 7 8 4 4 2

1

ES

MS

3 1 1

1 2 3 7 5

LS

SP

RS

2 4 6 4 5

1 1 3 6 8

IM, immature; ES, early spermatogenesis; MS, middle spermatogenesis; LS, late spermatogenesis; SP, spermiation; RS, resting

(22 March), and soon thereafter, all males were in SP at 338 dph (2 May). At 423 dph (26 July), all males were in RS. Temporal changes in gene expression of FSHβ β and LHβ β in the pituitary In female chub mackerel, a nonsignificant trend toward increasing fshb expression was found between 192 dph (7 December 2010) and 261 dph (14 February 2011) when females in ESG, EV, and MV appeared. Then, fshb expression gradually increased from 276 dph (1 March), peaked at 310 dph (4 April 2011) when females in LV appeared, and remained high until 338 dph (2 May) (Fig. 3A). Expression of lhb increased at 261 dph (14 February 2011), when

Fig. 3. Temporal changes (means ± SEM) in FSHβ (A) and LHβ (B) mRNA expressions in female chub mackerel pituitary during pubertal development. The sampling date and the number of fish are shown in Table 2. Expression levels of fish sampled at 164 dph were not analyzed because extraction of total RNA failed. Changes in ovarian development were indicated along the X-axis. Arrowheads indicate the timing of sex differentiation. Significant differences are indicated by different letters (P < 0.05, one-way ANOVA followed by Tukey’s multiple comparison test).

females in MV appeared, dramatically increased at 310 dph when females in LV appeared, remained high until 338 dph (2 May), and then decreased at 423 dph (26 July) during PS (Fig. 3B). In male fish, both fshb and lhb expression showed nonsignificant trends toward increasing levels between 164 dph (9 November 2010) and 192 dph (7 December), when males in ES and MS appeared. These levels were maintained until 276 dph (1 March 2011), and they markedly increased at 297 dph (22 March), when a male fish in SP appeared. The fshb expression reached a peak at 310 dph (4 April) and was decreased at 326 and 338 dph (20 April and 2 May) during the spawning season, whereas the lhb expression peaked at 326 dph when males in SP increased (Fig. 4B). Stage-dependent changes in gene expression of FSHβ β and LHβ β in the pituitary Data for fshb and lhb expression were also analyzed stage by stage for females and males, separately. In female chub mackerel, fshb expression increased during ESG, gradually increased until LV, and significantly declined during PS (Fig. 5A). Conversely, lhb expression increased during ESG, remaining at this level until MV; it then, and increased further during LV, but decreased during

Puberty and GtH in chub mackerel

403

PS (Fig. 5B). In males, fshb expression gradually increased from the lowest levels during IM, remained high between MS and SP, and decreased during RS (Fig. 5C). Conversely, lhb expression increased from IM to MS, remaining at this level until LS; it then, and increased further during SP, but decreased during RS (Fig. 5D). DISCUSSION Information on puberty is important for the establishment of aquaculture in fish. This study histologically examined the timing and completion of puberty, and the frequency of sexual maturation in 1-year-old cultured chub mackerel. Previous studies demonstrated that female and male chub mackerel cultured after hatching completed vitellogenesis and spermatogenesis, respectively, after rearing for one or more years in a net-pen, although gonadal development information was limited to GSI and the frequency of sexual maturation was not investigated (Ishibashi et al., 2006, 2007). In the present study, we provide further details of the reproductive biology and physiology of pubertal development in the cultured chub mackerel. The average FL of 220 mm during the spawning season in this study was within the range of 185–278 mm, which is the FL of 1-year-old chub mackerel cultured previously (Ishibashi et al., 2006). The average BW in this study increased from hatching to early December, but thereafter declined to early March and then Fig. 4. Temporal changes (means ± SEM) in FSHβ (A) and LHβ rose again just before the spawning season. Though a (B) mRNA expressions in male chub mackerel pituitary during pubertal development. The sampling date and the number of fish decrease in BW before the spawning season did not occur are shown in Table 3. Changes in testicular development were indiin 1-year-old fish in the previous study, it was observed in cated along the X-axis. Arrowheads indicate the timing of sex differ2- and 3-year old chub mackerel, with a transient decrease entiation. Significant differences are indicated by different letters (P in BW during March (Ishibashi et al., 2006). < 0.05, one-way ANOVA followed by Tukey’s multiple comparison A detailed histological analysis of early gonadal formatest). tion and sex differentiation in cultured chub mackerel was performed previously, including an examination of larval growth (Kobayashi et al., 2011). Similar to the results obtained in that previous study, gonadal anlagen were formed by 15 dph, and gonadal sex differentiation was observed between 30 and 45 dph in the present study. The present study further analyzed the timing and completion of puberty. The onset of puberty in teleosts is generally characterized by the beginning of vitellogenesis in females and the appearance of type B spermatogonia or primary spermatocytes (i.e., the beginning of spermatogenesis) in males (Holland et al., 2000; Okuzawa, 2002). In the present study, a female in EV first appeared at 192 dph in December, indicating the onset of puberty. The number of females in EV and MV rapidly increased from February to early April, with the increase of water temperature from a minimum of 12°C–15°C, and all females sampled at 326 dph in late April had completed the vitellogenesis (LV stage) when Fig. 5. Stage-dependent changes (means ± SEM) in FSHβ (A, C) and LHβ (B, D) the water temperature exceeded 16°C. In mRNA expressions in female (A, B) and male (C, D) chub mackerel pituitary during the present in vitro bioassay, FOM were puberty. Significant differences are indicated by different letters (P < 0.05, one-way ANOVA followed by Tukey’s multiple comparison test). induced by hCG stimulation in all ovaries

404

M. Nyuji et al.

from females possessing fully-grown vitellogenic ovaries. These results indicate that all these females completed puberty and their ovaries were capable of undergoing FOM. On the other hand, in male chub mackerel, type B spermatogonia and spermatocytes were first observed at 164 dph in November before the decrease in water temperature to a minimum, indicating the onset of puberty. The number of males in MS and LS increased rapidly from late January to late April, and all males sampled at 338 dph in early May were in SP, indicating the completion of puberty. The above results indicate that all chub mackerel completed pubertal development at one year of age under captive conditions in this study. According to field investigations, the size and age at first maturity ranges 200–250 mm and 1–2 years, respectively, and the percentage of maturing females at one year of age is assumed to be about 50% (Ouchi and Hamasaki, 1979; Kishida, 1986; Watanabe and Yatsu, 2006). Watanabe and Yatsu (2006) suggested that in wild stock, growth rate during the first year of life may affect the maturation of chub mackerel; an increase in growth rate positively affects the maturation rate. Furthermore, age and size at puberty decline in fish reared under farming conditions compared with wild fishes (Svåsand et al., 1996; Thorpe, 2007). Thus, our results indicate that farming conditions may shorten the age and size of chub mackerel at first maturity. Activation of the BPG axis is crucial for the onset and progress of puberty in teleosts (Taranger et al., 2010). In the present study, the temporal relationship between pubertal development and GtHβ gene expression in pituitary was determined in female and male chub mackerel. In females, fshb expression gradually increased from late December to late March, corresponding to the period of pubertal development, and reached a peak in early April when the completion of puberty was first observed, whereas lhb expression dramatically increased at the completion of puberty (Fig. 3). Similar changes were reported in salmonids, whose GtH function has been studied in more detail, where the fshb expression and plasma content of FSH increased during early pubertal development, whereas lhb expression and plasma LH were elevated at the completion of vitellogenesis and ovulation (Gomez et al., 1999; Andersson et al., 2013). In addition to increased gene expression and plasma hormones, in vivo and in vitro studies indicate that FSH acts on vitellogenesis via E2, whereas LH acts on FOM via 17,20βP production (Suzuki et al., 1988; Tyler et al., 1991; Planas and Swanson, 1995). Consistent with this, in chub mackerel, the in vitro cultivation of ovaries with purified GtH suggested that FSH is mainly involved in vitellogenesis because it promotes E2 secretion, whereas LH, but not FSH, acts on FOM because it induces the onset of FOM via 17,20β-P production (Nyuji et al., 2013). In the present study, therefore, the gradual increase in fshb expression during pubertal development may be related to FSH action on vitellogenesis, whereas lhb expression may be remarkably up-regulated at the completion of pubertal development to act on FOM. To explore the relationship between GtHβ gene expression and gonad developmental stage, gene expression data were further analyzed stage by stage. Interestingly, both fshb and lhb expression increased during ESG (Fig. 5A, B). As noted above, the role of FSH in vitellogenesis has been demonstrated mainly in salmonid species, but FSH function

in fishes remains poorly understood (Levavi-Sivan et al., 2010). A recent study of transcriptional regulation in ovarian follicles of coho salmon (Oncorhynchus kisutch) indicated that FSH may be involved in the onset of secondary growth of oocytes just before vitellogenesis, including cell survival and differentiation (Luckenbach et al., 2011). In coho salmon, E2 promotes the growth and accumulation of cortical alveoli, suggesting a critical role of FSH in the early secondary growth of oocytes (Forsgren and Young, 2012). Similarly, a previous study of chub mackerel GtH receptors (FSHR and LHR) indicated the possibility that FSH may play an important role during early secondary growth of oocytes because fshr, but not lhr, was expressed in ovarian follicle cells during perinucleolus and cortical alveolus stages and FSHR strongly bound to FSH (Nyuji et al., 2013). Thus, our findings showing that fshb expression is elevated in association with the appearance of cortical alveoli support the view that FSH may play a role in the early secondary growth of oocytes, prior to the vitellogenesis, in chub mackerel. On the other hand, the reason for the increase in lhb expression during this period remains unclear. Positive feedback by E2 on lhb expression has been reported in some fishes (e.g., coho salmon [Dickey and Swanson, 1998]; sea bass [Mateos et al., 2002]). Thus, elevation of lhb expression may be affected by steroid feedback, as chub mackerel FSH stimulates E2 secretion in the ovary (Nyuji et al., 2013), although effects of steroid feedback on GtH expression have not yet been investigated. After the beginning of secondary growth, the fshb gradually increased, peaking during LV, while a hallmark of lhb expression is a significant increase from MV to LV (Fig. 5A, B). These profiles between IM and PS are very similar to changes in fshb and lhb expression during the reproductive cycle of postpubertal female chub mackerel at ages 2–3-year-old, although this previous study analyzed restricted four-stages (IM, EV, LV, and PS) and female in ESG was not investigated (Nyuji et al., 2012a). Although fshb and lhb showed a distinct seasonal pattern of expression in the pituitary of female chub mackerel, both peaked at the late phase of vitellogenesis. This implies that the possibility that FSH and LH may be present simultaneously in the plasma, especially during the spawning season. Unlike salmonids that exhibit synchronous oocyte development, chub mackerel is a multiple spawning fish with an asynchronous-type ovary, which contains oocytes at various stages of development (Asano and Tanaka, 1989). We previously demonstrated that fshr highly expresses in ovarian follicles throughout vitellogenesis, whereas lhr expression significantly increase in ovarian follicles which complete vitellogenesis (Nyuji et al., 2013). Accordingly, it has been assumed that, in chub mackerel, asynchronous development of oocytes is regulated by stage-dependent expression of GtH receptors that selectively respond to FSH and/or LH, as shown in other multiple spawning fishes (Chauvigné et al., 2010; Kitano et al., 2011; Nyuji et al., 2013). Temporal changes in GtHβ gene expression of male chub mackerel pituitary showed that fshb and lhb expression tended to be high between late December and early March, corresponding the period from the onset of puberty to late spermatogenesis. Thereafter, both increased further in late March when spermiating males appeared, and fshb expression reached a peak in early April before the comple-

Puberty and GtH in chub mackerel

tion of puberty, whereas lhb expression peaked in late April around the completion of puberty (Fig. 4). In salmonids, fshb expression and plasma FSH increased at the onset of puberty, whereas lhb expression and plasma LH increased during spermiation (Gomez et al., 1999; Campbell et al., 2003; Maugars and Schmitz, 2008). A similar pattern of gene expression during pubertal testicular development was found in non-salmonid fish species such as Atlantic cod (Gadus morhus) (de Almeida et al., 2011). Although the physiological function of GtH on teleost spermatogenesis is still not defined, these GtH profiles suggest that FSH acts on the initiation of spermatogenesis, whereas LH is involved in the late phase of spermatogenesis (Schulz et al., 2010). A recent study of transcriptional regulation in pubertal testes of rainbow trout (Oncorhynchus mykiss) also suggested that FSH plays a role in the proliferation and differentiation of germ cells and that LH is involved in sperm maturation (Sambroni et al., 2012). In Japanese eel (Anguilla japonica), both recombinant FSH and recombinant LH induce the onset of puberty (i.e., spermatogonial proliferation and differentiation) (Ohta et al., 2007; Hayakawa et al., 2009; Kobayashi et al., 2010). In the present study, transcription of fshb and lhb were synchronously activated during early pubertal development, suggesting a role of both FSH and LH in the onset of puberty. Conversely, the peak of lhb expression was later than that of fshb expression, suggesting a significant role of LH in the late phase of spermatogenesis. Stage-dependent gene expression analysis showed that in male chub mackerel, fshb expression gradually increased from IM, remaining high between LS and SP, whereas lhb expression increased during ES, and then increased further during SP (Fig. 5C, D). These profiles are consistent with changes in fshb and lhb expression during the reproductive cycle of postpubertal male chub mackerel at ages 2–3years-old, with slight differences between LS and SP (Nyuji et al., 2012b). In the older fish, fshb expression increased from LS to SP, whereas lhb peaked during LS and SP, although males in ES and MS were not analyzed in the previous study. Since peak levels of fshb expression occurred earlier than the older fish, FSH may play a more critical role in the pubertal development of male chub mackerel. Finally, we provide the basis for the study of pubertal development in cultured chub mackerel. In this study, all chub mackerel cultured in captivity completed pubertal development after rearing for one year post-hatching, suggesting the earlier pubertal development than wild fishes. In the aquaculture industry, the gamete quality affects the reproductive success for seed production (Bobe and Labbé, 2010). Since the gamete quality is influenced by the growth, further studies are needed to evaluate differences in the reproductive success between 1-year-old and older adult chub mackerel, and wild adult fishes. The control of puberty is crucial for the establishment of aquaculture in fish; however, the mechanisms underlying BPG-axis activation during puberty are still unclear. Our results demonstrated that in female chub mackerel, fshb expression is up-regulated from the early secondary growth to vitellogenesis, whereas lhb expression is activated at the completion of puberty. In male chub mackerel, fshb and lhb expression were activated from the onset of puberty and further activated during late pubertal development, but fshb was highest just before the completion

405

of puberty, whereas lhb was highest at the completion of puberty. The present study may provide useful information for future analysis of the regulation of puberty by the BPG-axis. ACKNOWLEDGMENTS We thank the students in the Fisheries Laboratory of Kinki University, especially Mr. Y. Bae, Mr. M. Yamamoto, and Mr. A. Ikeda, for fish care and sampling support. This study was supported by a grant for Technological Development for Selection and Secure Stock of Broodstock for Culture of Bluefin Tuna from the Agriculture, Forestry, and Fisheries Research Council (AFFRC) of Japan. This study was also supported in part by a Grant-in-Aid for Scientific Research (23658163) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. M. N. is supported by a Japan Society for the Promotion of Science (JSPS) Research Fellowship for Young Scientists.

REFERENCES de Almeida FFL, Andersson E, Mittelholzer C, Karlsen Ø, Taranger GL, Schulz RW (2011) Pituitary gonadotropin and testicular gonadotropin receptor expression in Atlantic cod (Gadus morthua L.) during the first reproductive season: effects of photoperiod modulation. Gen Comp Endocrinol 173: 111–119 Andersson E, Schulz RW, Male R, Bogerd J, Patiña D, Benedet S, et al. (2013) Pituitary gonadotropin and ovarian gonadotropin receptor transcript levels: seasonal and photoperiod-induced changes in the reproductive physiology of female Atlantic salmon (Salmo salar). Gen Comp Endocrinol 191: 247–258 Asano K, Tanaka S (1989) Ovarian maturation and spawning of the Japanese common mackerel Scomber japonicus. Nippon Suisan Gakkaishi 55: 1715–1726 Bobe J, Labbé C (2010) Egg and sperm quality in fish. Gen Comp Endocrinol 165: 535–548 Chauvigné F, Tingaud-Sequeira A, Agulleiro MJ, Calusinska M, Gómez A, Finn RN, Cerdà J (2010) Functional and evolutionary analysis of flatfish gonadotropin receptors reveals cladal- and lineage-level divergence of the teleost glycoprotein receptor family. Biol Reprod 82: 1088–1102 Dickey JT, Swanson P (1998) Effects of sex steroids on gonadotropin (FSH and LH) regulation in coho salmon (Oncorhynchus kisutch). J Mol Endocrinol 21: 291–306 Forsgren KL, Young G (2012) Stage-specific effects of androgens and estradiol-17beta on the development of late primary and early secondary ovarian follicles of coho salmon (Oncorhynchus kisutch) in vitro. Biol Reprod 87: 64 Gomez JM, Weil C, Ollitrault M, Le Bail PY, Breton B, Le Gac F (1999) Growth hormone (GH) and gonadotropin subunit gene expression and pituitary and plasma changes during spermatogenesis and oogenesis in rainbow trout (Oncorhynchus mykiss). Gen Comp Endocrinol 113: 413–428 Hayakawa Y, Nagaya H, Kaki H, Hotta K, Kobayahi M (2009) Induction of spermatogenesis in Japanese eel by recombinant goldfish gonadotropins. Fish Sci 75: 137–144 Holland MC, Hassin S, Zohar Y (2000) Gonadal development and plasma steroid levels during pubertal development in captivereared striped bass, Morone saxatilis. J Exp Zool 286: 49–63 Ishibashi R, Murata O, Yamamoto S, Oka Y, Yoneshima H, Kato K, et al. (2006) Growth and gonad development of captive chub mackerel Scomber japonicus (Perciformes: Scombridae). Aquaculture Sci 54: 195–200 (in Japanese with English abstract) Ishibashi R, Yamamoto S, Kobayashi T, Izumi K, Miyashita S, Murata O (2007) Effects of HCG injections on one-year-old captive chub mackerel Scomber japonicus. Aquaculture Sci 55: 17–22 (in Japanese with English abstract) Kishida S (1986) Chub mackerel. In: “Fishes of the East China Sea

406

M. Nyuji et al.

and the Yellow Sea” Ed by O Okamura, Seikai Regional Fisheries Research Laboratory, Nagasaki, pp 260–261 (in Japanese) Kitano H, Irie S, Ohta K, Hirai T, Yamaguchi A, Matsuyama M (2011) Molecular cloning of two gonadotropin receptors and their distinct mRNA expression profiles in daily oogenesis of the wrasse Pseudolabrus sieboldi. Gen Comp Endocrinol 172: 268–276 Kobayashi M, Hayakawa Y, Park W, Banba A, Yoshizaki G, Kumamaru K, et al. (2010) Production of recombinant Japanese eel gonadotropins by baculovirus in silkworm larvae. Gen Comp Endocrinol 167: 379–386 Kobayashi T, Ishibashi R, Yamamoto S, Otani S, Ueno K, Murata O (2011) Gonadal morphogenesis and sex differentiation in cultured chub mackerel, Scomber japonicus. Aquac Res 42: 230–239 Levavi-Sivan B, Bogerd J, Mañanós EL, Gómez A, Lareyre JJ (2010) Perspectives on fish gonadotropins and their receptors. Gen Comp Endocrinol 165: 412–437 Lubzens E, Young G, Bobe J, Cerdá J (2010) Oogenesis in teleosts: how fish eggs are formed. Gen Comp Endocrinol 165: 367–389 Luckenbach JA, Dickey JT, Swanson P (2011) Follicle-stimulating hormone regulation of ovarian transcripts for steroidogenesisrelated proteins and cell survival, growth and differentiation factors in vitro during early secondary oocyte growth in coho salmon. Gen Comp Endocrinol 171: 52–63 Mateos J, Mañanos E, Carrillo M, Zanuy S (2002) Regulation of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) gene expression by gonadotropin-releasing hormone (GnRH) and sexual steroids in the Mediterranean sea bass. Comp Biochem Phys B 132: 75–86 Matsuyama M, Shiraishi T, Sundaray JK, Rahman MA, Ohta K, Yamaguchi A (2005) Steroidogenesis in ovarian follicles of chub mackerel, Scomber japonicus. Zool Sci 22: 101–110 Maugars G, Schmitz M (2008) Expression of gonadotropin and gonadotropin receptor genes during early sexual maturation in male Atlantic salmon parr. Mol Reprod Dev 75: 403–413 Mendiola D, Yamashita Y, Matsuyama M, Alvarez P, Tanaka M (2008) Scomber japonicus, H. is a better candidate species for juvenile production activities than Scomber scombrus, L. Aquac Res 39: 1122–1127 Murata O, Yamamoto S, Ishibashi R, Oka Y, Yoneshima H, Kato K, et al. (2005) Egg development and growth of larval and juvenile cultured chub mackerel Scomber japonicus (Perciformes: Scombridae) in a captive spawning experiment. Aquaculture Sci 53: 319–324 (in Japanese with English abstract) Nyuji M, Kitano H, Shimizu A, Lee JM, Kusakabe T, Yamaguchi A, Matsuyama M (2013) Characterization, localization, and stagedependent gene expression of gonadotropin receptors in chub mackerel (Scomber japonicus) ovarian follicles. Biol Reprod 88: 148 Nyuji M, Selvaraj S, Kitano H, Ohga H, Yoneda M, Shimizu A, Kaneko K, Yamaguchi A, Matsuyama M (2012a) Changes in the expression of pituitary gonadotropin subunits during reproductive cycle of multiple spawning female chub mackerel Scomber japonicus. Fish Physiol Biochem 38: 883–897 Nyuji M, Selvaraj S, Kitano H, Shiraishi T, Yamaguchi A, Shimizu A, Matsuyama M (2012b) Immunoreactivity of gonadotrophs (FSH and LH cells) and gonadotropin subunit gene expression in the male chub mackerel Scomber japonicus pituitary during the reproductive cycle. Zool Sci 29: 623–629 Nyuji M, Shiraishi T, Selvaraj S, In VV, Kitano H, Yamaguchi A, et al. (2011) Immunoreactive changes in pituitary FSH and LH cells during seasonal reproductive and spawning cycles of female chub mackerel Scomber japonicus. Fish Sci 77: 731–739 Ohga H, Kaneko K, Shimizu A, Kitano H, Selvaraj S, Nyuji M, et al. (2012) Steroidogenic and maturation-inducing potency of native

gonadotropic hormones in female chub mackerel, Scomber japonicus. Reprod Biol Endocrin 10: 71 Ohta T, Miyake H, Miura C, Kamei H, Aida K, Miura T (2007) Folliclestimulating hormone induces spermatogenesis mediated by androgen production in Japanese eel, Anguilla japonica. Biol Reprod 77: 970–977 Okuzawa K (2002) Puberty in teleosts. Fish Physiol Biochem 26: 31–41 Ouchi A, Hamasaki S (1979) Population analysis of common mackerel, Scomber japonicus, based on the catch statistics and biological informations in the western Japan Sea and the East China Sea. Bull Seikai Reg Fish Res Lab 53: 125–152 (in Japanese with English abstract) Planas JV, Swanson P (1995) Maturation-associated changes in the response of the salmon testis to the steroidogenic actions of gonadotropins (GTH I and GTH II) in vitro. Biol Reprod 52: 697– 704 Sambroni E, Rolland AD, Lareyre JJ, Le Gac F (2013) Fsh and Lh have common and distinct effects on gene expression in rainbow trout testis. J Mol Endocrinol 50: 1–18 Schulz RW, de França LR, Lareyre JJ, Le Gac F, Chiarini-Garcia H, Nobrega RH, Miura T (2010) Spermatogenesis in fish. Gen Comp Endocrinol 165: 390–411 Shiraishi T, Ketkar SD, Kitano H, Nyuji M, Yamaguchi A, Matsuyama M (2008) Time course of final oocyte maturation and ovulation in chub mackerel Scomber japonicus induced by hCG and GnRHa. Fish Sci 74: 764–769 Shiraishi T, Ohta K, Yamaguchi A, Yoda M, Chuda H, Matsuyama M (2005) Reproductive parameters of the chub mackerel Scomber japonicus estimated from human chorionic gonadotropin-induced final oocyte maturation and ovulation in captivity. Fish Sci 74: 764–769 Suzuki K, Nagahama Y, Kawauchi H (1988) Steroidogenic activities of two distinct salmon gonadotropins. Gen Comp Endocrinol 71: 452–458 Svåsand T, Jørstad KE, Otterå H, Kjesbu OS (1996) Differences in growth performance between Arcto-Norwegian and Norwegian coastal cod reared under identical conditions. J Fish Biol 49: 108–119 Taranger GL, Carrillo M, Schulz RW, Fontaine P, Zanuy S, Felip A, et al. (2010) Control of puberty in farmed fish. Gen Comp Endocrinol 165: 483–515 Thorpe JE (2007) Maturation responses of salmonids to changing developmental opportunities. Mar Ecol Prog Ser 335: 285–288 Tyler CR, Sumpter JP, Kawauchi H, Swanson P (1991) Involvement of gonadotropin in the uptake of vitellogenin into vitellogenic oocytes of the rainbow trout, Oncorhynchus mykiss. Gen Comp Endocrinol 84: 291–299 Watanabe C, Yatsu A (2004) Effects of density-dependence and sea surface temperature on interannual variation in length-atage of chub mackerel (Scomber japonicus) in the KuroshioOyashio area during 1970–1997. Fish Bull 102: 196–206 Watanabe C, Yatsu A (2006) Long-term changes in maturity at age of chub mackerel (Scomber japonicus) in relation to population declines in the waters off northeastern Japan. Fish Res 78: 323–332 Yukami R, Ohshimo S, Yoda M, Hiyama Y (2009) Estimation of the spawning grounds of chub mackerel Scomber japonicus and spotted mackerel Scomber australasicus in the East China Sea based on catch statistics and biometric data. Fish Sci 75: 167–174 Zohar Y, Muñoz-Cueto JA, Elizur A, Kah O (2010) Neuroendocrinology of reproduction in teleost fish. Gen Comp Endocrinol 165: 438–455 (Received December 6, 2013 / Accepted February 13, 2014)