Author’s Accepted Manuscript A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of staphylococcus aureus Yan Lian, Fengjiao He, Huan Wang, Feifei Tong www.elsevier.com/locate/bios
PII: DOI: Reference:
S0956-5663(14)00804-5 http://dx.doi.org/10.1016/j.bios.2014.10.017 BIOS7199
To appear in: Biosensors and Bioelectronic Received date: 28 June 2014 Revised date: 26 August 2014 Accepted date: 7 October 2014 Cite this article as: Yan Lian, Fengjiao He, Huan Wang and Feifei Tong, A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of staphylococcus aureus, Biosensors and Bioelectronic, http://dx.doi.org/10.1016/j.bios.2014.10.017 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
A new Aptamer/Graphene Interdigitated Gold Electrode Piezoelectric Sensor for Rapid and Specific Detection of Staphylococcus aureus
Yan Lian, Fengjiao He*, Huan Wang, Feifei Tong
State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082, China *To whom correspondence should be addressed: E-mail: [email protected] Fax:+86-731-8864 1495 *
Corresponding author. Tel: +86 731 88272269; fax: +86 731 88055818. E-mail address: [email protected](Fengjiao He)
ABSTRACT A novel aptamer/graphene interdigitated gold electrode piezoelectric sensor was developed for the rapid and specific detection of Staphylococcus aureus (S. aureus) by
employing
S.
aureus
aptamer
as
a
biological
recognition
element.
4-Mercaptobenzene-diazonium tetrafluoroborate (MBDT) salt was used as a molecular cross-linking agent to chemically bind graphene to interdigital gold electrodes (IDE) that are connected to a series electrode piezoelectric quartz crystal (SPQC). S. aureus aptamers were assembly immobilized onto graphene via the π-π stacking of DNA bases. Due to the specific binding between S. aureus and aptamer, when S. aureus is present, the DNA bases interacted with the aptamer, thereby dropping the aptamer from the surface of the graphene. The electric parameters of the
electrode surface was changed and resulted in the change of oscillator frequency of the SPQC. This detection was completed within 60 min. The constructed sensor demonstrated a linear relationship between resonance frequency shifts with bacterial concentrations ranging from 4.1×101 – 4.1×105 cfu/mL with a detection limit of 41 cfu/mL. The developed strategy can detect S. aureus rapidly and specifically for clinical diagnosis and food testing.
Keywords: IDE-SPQC; Staphylococcus aureus; aptamer; graphene; diazonium salts; rapid detection.
1. INTRODUCTION S. aureus is a Gram-positive, widely distributed bacterium, found in air, water and inadequately treated food. S. aureus is an important food-borne and iatrogenic pathogen that causes a wide range of diseases, including septicemia, gastrointestinal tract infections, food poisoning toxic shock syndrome and endocarditis under uncontrolled conditions (Rooijakkers et al. 2005). S. aureus can be detected via many methods. Traditional culture-based assays are time-consume(requiring 2-4 days). Rapid and automated detection methods, including polymerase chain reaction (PCR), enzyme-linked immunosorbent assay, nucleic acid-based molecular biology methodsˈhave been developed (Carroll 2008; Kipp et al. 2004; Bennett 2005). They are relatively time-saving (requiring 1-5 h)
(Wellinghausen et al. 2009; Jeyaratnam et al. 2008). However, these methods have some shortcomings, such as low automation degree, expensive instruments and complicated sample pre-treatments. Therefore, a novel rapid, specific and sensitive method for the detection of S. aureus is needed. Graphene is a new type of carbon materials with remarkable electrical, thermal and mechanical characters (He et al. 2010) and has been widely used in biosensors (Dreyer et al. 2010; Liu et al. 2013; Liu et al. 2013; Sheng et al. 2012; Deng et al. 2012). In particular, graphene, which is a two-dimensional (2D) monolayer of carbon material, has attracted increasing interest owing to their strong π−π interactions compared to other carbon materials (Moumita et al. 2013). Among all kinds of various graphene-based materials, graphene oxide (GO), an aqueous dispersible oxygenated derivative of graphene (Yun et al. 2012), has been widely successfully utilized in molecular hybrids (Yang et al. 2010) or biocompatible (Liu et al. 2010) scaffolds or substrates, and patterned carbon films after being chemically reduced or modified to tune the material properties. Aptamers are single-stranded oligonucleotides or peptides (typically DNA or RNA) that are selected in vitro using a method known as the systematic evolution of ligands by exponential enrichment (SELEX) (Tuerk and Gold 1990) from a library of nucleic acids containing ~1015 individual sequences. Aptamers react with their targets (proteins, small molecules, ions, and even cells) with high affinity and specificity, similar to antibodies (Bunka and Stockley 2006). Aptamers possess additional advantages compared to antibodies: aptamers are easily synthesized, have a higher
specificity and stability and a wider range of targets, are inexpensive, and can be simply modified with functional groups. Aptamers can be applied for both therapeutics and diagnoses. A large number of aptamers have been used in fluorescent, (Breaker 1997; Duan et al. 2012; Wu et al. 2011; Chang et al. 2010), colorimetric (Xia et al. 2010), electrochemiluminescence (Hamula et al. 2006) and potentiometric (Zelada-Guillén et al. 2012; Bai et al. 2012) sensors for targets detection. SPQC technology is highly sensitive, has a low cost and is easy to operate. IDE connected to piezoelectric quartz crystal in series was successfully used to detect Pseudomonas aeruginosa in our group (He et al. 2007). Changes in the electrical parameters can be efficiently detected because the steady state can be established quickly in small distances between the anode and cathode electrode systems and because the signal-to-noise ratio was improved (Varshney and Li 2009; Thomas et al. 2004). In this study, a novel aptamer/graphene interdigitated gold electrode piezoelectric sensor for S. aureus was constructed by immobilizing S. aureus aptamers as recognition elements on the graphene surface of IDE. Graphene was immobilized onto the surface of IDE through 4-mercapto-benzenediazonium tetrafluoroborate; which the bonding mechanism of diazonium salt to the graphene surface has been clearly described by Cui et al (Cui et al. 2011). This sensor is rapid, simple, free-labeled, and high sensitive and selectivie, offering a valuable method for the fast and specific detection of S. aureus.
2. EXPERMENTS 2.1.
Materials
99.95% Graphite powders (325 mesh, Alfa Aesar,USA); 4-Amino Thiophenol (Alfa Aesar, USA). Isoamyl nitrite (Sinopharm Chemical Reagent Co., Ltd., China). Fluoroboric acid (Tianjin Kermel Chemical Reagent Co., Ltd., China). Tris-HCl buffered solution (50 mM pH=7.4, with 5 mM KCl, 100 mM NaCl and 5 mM MgCl2) All of the regents were pure analytical grade. Deionized water was used for the preparation of all of the solutions. S. aureus aptamers were collected from the Shanghai Sangon Biological Science and Technology Company Co., Ltd (Shanghai, China). The DNA sequence of the S. aureus aptamers was 5'-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAG CGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA3'. 2.2. 1
Apparatus
H NMR spectra (Varian INOVA-400 instrument); Raman spectra (BWS 435-785sy
Confocal Raman spectrometer, USA); FT-IR spectrophotometer (Thermo Nicolet 5700); SEM (Hitachi S4800); IDE-SPQC detection system (made by ourselves, Fig. S1). 2.3.
Stock and Test culture
Improved YC medium (yeast extract, 2 g; beef extract, 1 g; D-glucose, 40 g, 18AA amino acids, 16 mL; deionized water, 1000 mL; pH 7.2±0.2 ; our laboratory).
2.4.
Bacterial strains and culture media
The quality control strains: S. aureus ATCC 25923 was provided by Hunan Children’s Hospital. These strains were inoculated from a blood plate into a liquid medium and were grown for 18 h at 37 °C. Then the colonies on the plates were counted to determine the number of colony-forming units per milliliter (cfu/mL). The used experimental strains were as follows: Salmonella Typhimurium (S. Typhimurium) ATCC 50761, Group A Streptococcus (GAS) ATCC 19615, Pseudomonas aeruginosa (P. aeruginosa) ATCC 27853, Enterococcus faecalis (E. faecalis) ATCC 51299, Klebsiella pneumoniae (K. pneumoniae) ATCC 700603 and Escherichia coli (E. coli) ATCC 25922, provided by Hunan Children’s Hospital. The bacteria were cultured overnight under aerobic conditions at 37 °C in YC media. The concentrations of the six strains were determined by the poured plate counts (PPC) method. 2.5.
Modification of interdigital gold electrodes
The interdigital gold electrodes were sonicated for 5 min in acetone and cleaned by isopropanol and ethanol for 5 min, respectively. The electrodes were then rinsed with deionized water for 5 min and then dried under a stream of nitrogen gas. A 70 mM of MBDT (Fig. S3) of solution in acetonitrile was added dropwise to a flask containing the graphene dispersion (Li et al. 2008; Hummers Jr and Offeman 1958; Kovtyukhova et al. 1999). The mixture was stirred for 7 h at room temperature. Then, the prepared interdigital electrodes were immersed in the mixture solution for 18 h at 38 °C, after which the electrodes were removed, washed thoroughly with acetonitrile and acetone
and blown with nitrogen gas to remove the solvent. Next, the aptamers (5 µL) were added dropwise to the modified electrodes, and incubated at 37 °C for 16 h. The modified electrodes were washed twice with buffer solution (50 mM Tris-HCl pH=7.4, 5 mM KCl, 100 mM NaCl, and 5 mM MgCl2) and then with deionized water to remove the free aptamers. 2.6.
Detection of S. aureus by IDE-SPQC sensor
Aliquots (1 mL) of different concentrations of S. aureus were added to the test tubes, and the modified electrode was placed into the detected solution. The frequency shift curves were recorded automatically by the SPQC software. 3. RESULTS AND DISCUSSIONS 3.1.
The frequency shift response characteristics of electric parameter properties
Fig. S1A is the apparatus diagram of IDE-SPQC, its equivalent circuit was shown in Fig. S1B, where, 1 is the equivalent electric circuit model of quartz crystal, C0, Lq, Cq, Rq are static capacitance, motional inductance, motional capacitance and motional resistance, respectively; 2 is the equivalent electric circuit model of electrode modified with layer films, Cf and Rf are membrane capacitance and membrane resistance of modified layer of electrodes, respectively; 3 is the equivalent electric circuit model of solution, Cs and Rs are equivalent capacitance and equivalent resistance of solution, respectively. Because the solution parameters changed little during the detection process, so the Fig. S1B is simplified to Fig. S1C. The complex impedance Z of this model:
é ù wLq -1 2 ê ú Rf wC f R f wC q ê ú Z = R + jC = j 2 1 + (wC f R f ) 2 ê1 + (wC f R f ) 1 + C0 - w 2 L C ú q 0 Cq ê ú ë û
(1)
Where R is the impedance real part, X is the reactive component, j = - 1 . According to the phase conditions of oscillation theory, when the phase is zero, the phase angle of oscillation is -θ, - q = tan -1 ( C ) , make A = tan q , there are: R
C A + tan(-q ) = A + ( ) = 0 R AR f + wC f R 2f 1 + (wC f R f )
2
Because
wLq 1+
1 wCq
C0 - wLq C0 Cq
w = 2pF , bring F0 =
(2)
=0 (3)
1 to (3), 2p LqCq
(
)
é ù pF0Cq 2pF0 R 2f C f - AR f F = F0 ê1 + ú 2 2 ëê 1 - 2pF0C0 R f A + 4p F0 R f C f (C0 + C f )ûú
(4)
For our IDE-SPQC system,
F = f (R f , C f )
dF =
(5)
¶F ¶F dR f + dC f ¶R f ¶C f
ì A - 4p 2 F02C 2f R 2f A - 4pF0C f R f ¶F ï = pF02Cq í 2 2 2 ¶R f ï î 1 - 2pF0C0 R f A + 4p F0 R0 C f (C0 + C f
[
(6)
ü ï 2 ý (7) ) ïþ
]
ì 1 - 4p 2 F02C 2f R 2f + 4pF0C f R f A ¶F ï 2 3 = 2p F0 Cq í 2 2 2 ¶C f ï 1 - 2pF0C0 R f A + 4p F0 R f C f (C0 + C f î
[
ü ï ý (8) ï þ
)]
2
Where F0, C0 and A are all considered to be constants in formula (7) (8). While Rf
and Cf are initial resistance and capacitance of modified electrodes. Therefore,
P1 =
P2 =
ì A - 4p 2 F02C 2f R 2f A - 4pF0C f R f ¶F ï = pF02Cq í 2 2 2 ¶R f ï î 1 - 2pF0C0 R f A + 4p F0 R0 C f (C0 + C f
[
ì 1 - 4p 2 F02C 2f R 2f + 4pF0C f R f A ¶F ï = 2p 2 F03Cq í 2 2 2 ¶C f ï 1 - 2pF0C0 R f A + 4p F0 R f C f (C0 + C f î
[
)]
2
)]
2
ü ï ý ï þ
ü ï ý ï þ
(9)
(10)
Taking P1, P2 into equation (6):
dF = P1dR f + P2dC f
(11)
This is the relationship among frequency shift of contructed sensor with electric paramters of electrode. 3.2.
The response mechanism of constructed sensor to S. aureus
A diagram of the detection mechanism of the proposed sensor is shown in Scheme 1. 4-Mercapto-benzene diazonium tetrafluoroborate (MBDT) salt was used a molecular bridge to connect the interdigital gold electrode and graphene, bound to the electrode via the formation of Au-S bonds and to graphene via a diazonium functional group chemical bond. The S. aureus aptamer was bond to graphene via the π-π stacking of DNA bases. In the presence of S. aureus, the aptamer will break off from the graphene surface of the electrode because the binding force between the aptamer and graphene is lower than that between the aptamer and its target. As graphene has a
good electronic conductivity, and the aptamer is nonconductive, the electric characteristics of the electrode will change markedly, conferring a sensitive response to the constructed sensor. Scheme 1.
3.3.
Characterization of the materials
The Raman spectra of graphite, graphite oxide and graphene are shown in Fig. S3A. For graphite, only the G peak appears at 1567 cm-1 (curve a); for graphite oxide, two peaks appear at 1591 cm-1 (G peak shifts) and 1335 cm-1 (new D peak) (curve b); for graphene, two peaks appear at1598 cm-1 (G peak shifts) and 1352 cm-1 (D peak to) (curve c). The increase in the D/G intensity ratio of graphene compared to that of pristine graphite (Dresselhaus and Eklund 2000) indicates a decrease in the size of the in-plane sp2 domains and an increase in the partially ordered crystal structure (Ferrari and Robertson 2000). The Raman spectrum of graphene diazotized with MBDT is shown in Fig. S3B. Some new peaks appeared at 1097 cm-1 (C-N symmetric stretching) and 995 cm-1 (S-H antisymmetric stretching), respectively (Jiang et al. 2006). These peaks result from the bonding between mercaptophenyl groups with the graphene basal plane (El'kin et al. 2005). These spectroscopic characteristics fully demonstrate the successful diazotization of graphene with MBDT (Cui et al. 2011). The FE-SEM images of electrodes without and with graphene sheets are shown in Fig. S4A and Fig. S4B, respectively. Wrinkle-shaped graphene layers were disorderly distributed on the surface of the modified electrode, and some of graphene sheet
stacked together to form a multilayer structure. The images confirm that a graphene sheet was successfully immobilized on the electrode surface. 3.4.
Typical response curve of Staphylococcus aureus detected by aptame
/graphene IDE-SPQC The typical response curve of S. aureus detected by the proposed sensor is shown in Fig. 3, the curve (h). The concentration of S. aureus was 106 cfu/mL and was detection at 37 °C. For comparison, the response curves that were detected by the modified electrodes in detection medium without S. aureus and bare gold electrodes in detection medium containing S. aureus are shown in Fig. 3, the curve (a) and the curve (b), respectively. The frequency shift (F=Fi-F0) decreased only in the curve (h) and reached a plateau at approximately 60 min. This frequency decrease was caused by the aptamers bing stripped from the surface of graphene due to the reaction between the aptamers and S. aureus. The entire detection was completed within 60 min. In the curve (a) and the curve (b), neither the S. aureus nor aptamer was present, resulting in no frequency response. 3.5.
Effect of aptamer concentration
The effect of different concentrations of aptamers on the sensor response of S. aureus (106 cfu/mL) is shown in Fig. 2A. The frequency shifts continuously increased as the aptamer concentration varied from 50-600 nM. The maximum frequency shift was reached at the aptamer concentration of 600 nM, indicating that 600 nM is the best concentration for detecting S. aureus. There were no obvious changes in the
frequency shift when the aptamer concentration was greater than 600 nM. Therefore, 600 nM was used for further analyses. Figure 2. 3.6.
Specificity studies of the proposed method
Six other pathogenic bacteria (E. coli, K. pneumoniae, S. typhimurium, E. faecalis, GAS, and P. aeruginosa) were selected to study the specific response of the proposed sensor to S. aureus. These bacteria were inoculated at 37 °C in detection cells at concentrations of 105 cfu/mL. The detection results are shown in Fig. 2B. These six common bacteria produced no obvious signal responses, demonstrating that this approach has a good selectivity for S. aureus. 3.7.
The response of different concentrations of Staphylococcus aureus
The response curves of different concentrations of Staphylococcus aureus were detected by the proposed method and are shown in Fig. 3. The results demonstrate a continuous increase in the frequency shifts as the S. aureus concentrations varied from 101-107 cfu/mL (Fig. 3A). A linear relationship between the logarithmic values of the S. aureus concentrations and the frequency shifts was obtained as the S. aureus concentrations changed from 4.1×101-4.1×105 cfu/mL (Fig. 3B), following the equation = 12.967 + 8.604 with a linear correlation coefficient of 0.9879. The detection limit was low at 41 cfu/mL according to the triple standard deviation (σ) rule, that was, the signal reached 3 times of the standard deviation from the blank response at this S. aureus concentration. The relative standard deviation (RSD) of the five parallel experiments was in the range from 2-6%, indicating good reproducibility.
Figure 3. 3.8.
Regeneration of the sensor
After the analyses, the IDE was removed and washed thoroughly with acetonitrile and acetone and blown with nitrogen gas. In order to regenerate the sensor, the aptamers (5 µL) were again added dropwise to the modified electrodes and incubated at 37 °C for 16 h. The re-modified electrodes were washed twice with buffer solution and then with deionized water to remove the free aptamers. Finally, the aptamer was re-bound to the graphene, and the sensor was thoroughly regenerated. After these regeneration treatments, the frequency shift of the S. aureus detection (the cells with concentrations of 1×105 cfu/mL) using this regenerated sensor was 81 Hzˈwhich is very close to the frequency shift of the initial sensor which was 83Hz, indicating that the sensor can be thoroughly regenerated. After 10 regenerations in 10 days, the frequency shift was decreased by less than 5%, demonstrating that our sensor can be reused at least 10 times. 3.9.
Detection of S. aureus in milk
Milk samples were prepared by inoculation with different concentrations of S. aureus that were detected at 37 °C. The detection results from the proposed method and classical plate-counting methods are shown in Table 1. The detection limit in milk samples of the proposed method for S. aureus was 4.1×101 cfu/mL. The detection results of the developed bioassay were similar to those of the plate-counting method, indicating that this method can be used to detect real samples. The plate-counting method requires more than ten hours for bacteria to grow before
counting. Moreover, the plate count method is usually performed with dilutions, making the method tedious. Furthermore, the bacterium in the sample is often difficult to completely disperse into single bacterial cells before inoculation. Therefore, the plate-counting method produces a count that is lower than the actual results. However, the proposed method is performed without dilutions, and only a small amount of sample is added into the detection pool. Therefore, compared to the plate-counting method, the proposed method offers several key advantages, such as easy operation and rapid detection, among others. Table 1. 4. CONCLUSIONS In this study, a new aptamer/graphene-modified IDE-SPQC was constructed for the simple, rapid and specific detection of S. aureus. The aptamers are assembly on graphene and are used as molecular recognition probes, providing an efficient way to capture S. aureus. Importantly, the whole detection can be completed within 60 min, which is rapid compared to other methods. In addition, selective experiments typically demonstrate that this method is specific for S. aureus. Furthermore, this method was successfully used to detect of S. aureus in milk samples. This proposed method can be used as a detection platform for S. aureus in the future. We also will further study the impact of the geometries of IDE on the sensitivity of the sensor, hoping to demonstrate a higher sensitivity with a detection limit as low as 5 cfu/mL using the present method.
ACKNOWLEDGMENT This research work was supported by the National Natural Science Foundation of China (No.21275042) and National High Technology Research and Development Program of China (863 Program, No.2013AA020203).
REFERENCES Bennett, R.W., 2005. J. Food Pro. 68, 1264-1270. Breaker, R.R., 1997. Cur. Opin. Chem. Biol. 1, 26-31. Bunka, D.H.J., Stockley, P.G., 2006. Nat. Rev. Microbiol. 4, 588-596. Bai, L.J., Yuan, R., Chai, Y.Q., Zhuo, Y., Yuan, Y.L., Wang, Y., 2012. Biomater. 33, 1090-1096. Carroll, K.C., 2008. Mol. Diagn. Ther. 12, 15-24. Chang, H.X., Tang, L.H., Wang, Y., Jiang, J.H., Li, J.H., 2010. Anal. Chem. 82, 2341-2346. Cui, P., Seo, S., Lee, J.Y., Wang, L.Y., Lee, E., Min, M., Lee, H., 2011. ACS Nano 5, 6826-6833. Deng, S., Tjoa, V., Fan, H.M., Tan, H.R., Sayle, D.C., Olivo, M.,
Mhaisalkar, S.,
Wei, J., Sow, C.H., 2012. J. Am. Chem. Soc. 134, 4905-4917. Dresselhaus, M.S., Eklund, P.C., 2000. Adv. Phy49, 705-814. Dreyer, D.R., Jia, H.P., Bielawski, C.W., 2010. Angew. Chem. 122, 6965-6968. Duan, N., Wu, S.J., Zhu, C.Q., Ma, X.Y., Wang, Z.P., Yu, Y., Jiang,Y., 2012. Anal. Chim. Acta 723, 1-6. El'kin, P.M., Pulin, V.F., Kosterina, E.K., 2005. J. Appl. Spectrosc. 72, 483-487. Ferrari, A.C., Robertson, J., 2000. Phys. Rev. B 61, 14095-14107. Hamula, C.L.A., Guthrie, J.W., Zhang, H., Li, X.F., Le, X.C., 2006. TrAC Trends Anal. Chem. 25, 681-691. Hummers Jr, W.S., Offeman, R.E., 1958. J. Am. Chem. Soc. 80, 1339-1339. He, F.J., Ren, J.L., Liu, Z.H., 2007. Sensors Actuators B 123, 1057-1063.
He, S.J., S, B., Li, D., Zhu, C.F., Qi, W.P., Wen, Y.Q., Wang, L.H., Song, S.P., Fang, H.P., Fan, C.H., 2010. Adv. Funct. Mater. 20, 453-459. Jeyaratnam, D., Gottlieb, A., Ajoku, U., French, G. L., 2008. Diagn. Micr. Infec. Dis 61, 1-5. Jiang, Y., Cui, Y., Gu, R.N., 2006. Spectrosc Spectral Anal. 26, 1260-1263. Kipp, F., Becker, K., Peters, G., Eiff, Von. C., 2004. J. Clin. Microbiol. 42, 1277-1279. Kovtyukhova, N.I., Ollivier, P.J., Martin, B.R., Mallouk, T.E., Chizhik, S.A., Buzaneva, E.V., Gorchinskiy, A.D., 1999. Chem. Mater. 11, 771-778. Li, D., Mueller, M.B., Gilje, S., Kaner, R.B., Wallace, G.G., 2008. Nat. Nanotech. 451, 101-105. Liu, F., Ha, H.D., Han, D. J., Tae Seok Seo, T.S., 2013. Small 9, 3410-3414. Liu, F., Piao, Y.X., Choi, J.S., Seo, T.S., 2013. Biosens. Bioelectron. 50, 387-392. Liu, F., Jong, Y.C., Tae, S.S., 2010. Biosens. Bioelectron. 25, 2361-2365. Moumita, K., Anil, K.B., 2013. J. Phys. Chem. C 117, 25865-25875 Rooijakkers, S.H.M., Van Kessel, K.P.M., Van Strijp, J.A.G., 2005. Trends Microbiol. 13, 596-601. Sheng, Z.H., Zheng, X.Q., Xu, J.Y., Bao, W.J., Wang, F.B., Xia, X.H., 2012. Biosens. Bioelectron. 34, 125-131. Thomas, J.H., Kim, S.K., Hesketh, P.J., Halsall, H.B., Heineman, W.R., 2004. Anal. Biochem. 328, 113-122. Tuerk, C., Gold, L., 1990. Sci. 249, 505-510. Varshney, M., Li, Y., 2009. Biosens. Bioelectron. 24, 2951-2960. Wellinghausen, N., Siegel, D., Gebert, S., Winter, J., 2009. Eur. J. Clin. Microbiol. Infect. Diseas. 28, 1001-1005. Wu, M., Kempaiah, R., Huang, P.J.J., Maheshwari, V., Liu, J., 2011. Langmuir 27, 2731-2738. Xia, F., Zuo, X.L., Yang, R.Q., Xiao, Y., Kang, D., Vallée-Bélisle, A., Gong, X., Yuen, J., Hsu, B.B., Heeger, A.J., Plaxco, K.W., 2010. PNAS. 107, 10837-10841.
Yang, S.B., Feng, X.L., Ivanovici, S., Klaus, M., 2010. Angew. Chem. 122, 8586-8589. Yun, J.M., Kyoung, N.K., Ju, Y.K., Dong, O.S., Lee, W.J., Lee, S.H., Marya, L., Sang, O.K., 2012. Angew. Chem. 124,936-939. Zelada-Guillén, G.A., Sebastián-Avila, J.L., Blondeau, P., Riu, Jordi., Rius, F.X., 2012. Biosens. Bioelectron. 31, 226-232.
Figure caption: Scheme 1. Response mechanism diagram of proposed sensor: (A) the synthesis of MBDT salt and self-assembled on graphene. (B) immobilization of aptamer onto graphene modified on electrode through MBDT salt. (C) aptamers were break off from graphene in the presence of S. aureus, and resulted in the sensitive response of SPQC.
Fig 2. A: the effect of aptamers concentration on response of IDE-SPQC and B: selectivity of aptamer/graphene IDE-SPQC sensor toward different bacteria. The illustrated error bars represent the standard deviation of six repetitive measurements.
Figure 3. (A) Response curves of different concentrations (cfu/mL) of S. aureus. The concentrations (cfu/mL) were: a, blank; b, bare electrode; c, 101; d, 102 ; e, 103 ; f, 104 ; g, 105 ; h, 106 ; I, 107 ; (B) Relationship curve between values of frequency shift and S.aureus concentration. c=4.1×101~4.1×105 cfu/mL.
Table 1. Detection results of S. aureus in milk.
Table 1.
S. aureus Samples
Plate counting method (cfu/mL)
RSD (%)
Proposed method (cfu/mL)
RSD (%)
1
42
4.26
59
4.85
2
412
1.86
318
2.13
3
4078
0.31
2894
0.61
4
41031
0.042
30796
0.071
5
408954
0.0045
329856
0.0069
Highlight: 1) Aptamer/Graphene Interdigitated Gold Electrode Piezoelectric Sensor was used for the first time to detect Staphylococcus aureus which shows a high sensitivity, specificity and rapid detection time. 2) The novel biosensor was proposed using Staphylococcus aureus aptamer as a biological recognition element and the graphene could improve the electron transfer rate between the interdigital gold electrodes. The proposed sensor is stable high selectivity and sensitive without complicated modifications, so the detection limit is low. 3) The proposed sensor has been successfully applied in the analysis of Staphylococcus aureus in milk. Comparing to the common assay, the proposed method needs no pretreatment process of the sample. It is simpler and the equipment cost low.
PII: DOI: Reference:
S0956-5663(14)00804-5 http://dx.doi.org/10.1016/j.bios.2014.10.017 BIOS7199
To appear in: Biosensors and Bioelectronic Received date: 28 June 2014 Revised date: 26 August 2014 Accepted date: 7 October 2014 Cite this article as: Yan Lian, Fengjiao He, Huan Wang and Feifei Tong, A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of staphylococcus aureus, Biosensors and Bioelectronic, http://dx.doi.org/10.1016/j.bios.2014.10.017 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
A new Aptamer/Graphene Interdigitated Gold Electrode Piezoelectric Sensor for Rapid and Specific Detection of Staphylococcus aureus
Yan Lian, Fengjiao He*, Huan Wang, Feifei Tong
State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082, China *To whom correspondence should be addressed: E-mail: [email protected] Fax:+86-731-8864 1495 *
Corresponding author. Tel: +86 731 88272269; fax: +86 731 88055818. E-mail address: [email protected](Fengjiao He)
ABSTRACT A novel aptamer/graphene interdigitated gold electrode piezoelectric sensor was developed for the rapid and specific detection of Staphylococcus aureus (S. aureus) by
employing
S.
aureus
aptamer
as
a
biological
recognition
element.
4-Mercaptobenzene-diazonium tetrafluoroborate (MBDT) salt was used as a molecular cross-linking agent to chemically bind graphene to interdigital gold electrodes (IDE) that are connected to a series electrode piezoelectric quartz crystal (SPQC). S. aureus aptamers were assembly immobilized onto graphene via the π-π stacking of DNA bases. Due to the specific binding between S. aureus and aptamer, when S. aureus is present, the DNA bases interacted with the aptamer, thereby dropping the aptamer from the surface of the graphene. The electric parameters of the
electrode surface was changed and resulted in the change of oscillator frequency of the SPQC. This detection was completed within 60 min. The constructed sensor demonstrated a linear relationship between resonance frequency shifts with bacterial concentrations ranging from 4.1×101 – 4.1×105 cfu/mL with a detection limit of 41 cfu/mL. The developed strategy can detect S. aureus rapidly and specifically for clinical diagnosis and food testing.
Keywords: IDE-SPQC; Staphylococcus aureus; aptamer; graphene; diazonium salts; rapid detection.
1. INTRODUCTION S. aureus is a Gram-positive, widely distributed bacterium, found in air, water and inadequately treated food. S. aureus is an important food-borne and iatrogenic pathogen that causes a wide range of diseases, including septicemia, gastrointestinal tract infections, food poisoning toxic shock syndrome and endocarditis under uncontrolled conditions (Rooijakkers et al. 2005). S. aureus can be detected via many methods. Traditional culture-based assays are time-consume(requiring 2-4 days). Rapid and automated detection methods, including polymerase chain reaction (PCR), enzyme-linked immunosorbent assay, nucleic acid-based molecular biology methodsˈhave been developed (Carroll 2008; Kipp et al. 2004; Bennett 2005). They are relatively time-saving (requiring 1-5 h)
(Wellinghausen et al. 2009; Jeyaratnam et al. 2008). However, these methods have some shortcomings, such as low automation degree, expensive instruments and complicated sample pre-treatments. Therefore, a novel rapid, specific and sensitive method for the detection of S. aureus is needed. Graphene is a new type of carbon materials with remarkable electrical, thermal and mechanical characters (He et al. 2010) and has been widely used in biosensors (Dreyer et al. 2010; Liu et al. 2013; Liu et al. 2013; Sheng et al. 2012; Deng et al. 2012). In particular, graphene, which is a two-dimensional (2D) monolayer of carbon material, has attracted increasing interest owing to their strong π−π interactions compared to other carbon materials (Moumita et al. 2013). Among all kinds of various graphene-based materials, graphene oxide (GO), an aqueous dispersible oxygenated derivative of graphene (Yun et al. 2012), has been widely successfully utilized in molecular hybrids (Yang et al. 2010) or biocompatible (Liu et al. 2010) scaffolds or substrates, and patterned carbon films after being chemically reduced or modified to tune the material properties. Aptamers are single-stranded oligonucleotides or peptides (typically DNA or RNA) that are selected in vitro using a method known as the systematic evolution of ligands by exponential enrichment (SELEX) (Tuerk and Gold 1990) from a library of nucleic acids containing ~1015 individual sequences. Aptamers react with their targets (proteins, small molecules, ions, and even cells) with high affinity and specificity, similar to antibodies (Bunka and Stockley 2006). Aptamers possess additional advantages compared to antibodies: aptamers are easily synthesized, have a higher
specificity and stability and a wider range of targets, are inexpensive, and can be simply modified with functional groups. Aptamers can be applied for both therapeutics and diagnoses. A large number of aptamers have been used in fluorescent, (Breaker 1997; Duan et al. 2012; Wu et al. 2011; Chang et al. 2010), colorimetric (Xia et al. 2010), electrochemiluminescence (Hamula et al. 2006) and potentiometric (Zelada-Guillén et al. 2012; Bai et al. 2012) sensors for targets detection. SPQC technology is highly sensitive, has a low cost and is easy to operate. IDE connected to piezoelectric quartz crystal in series was successfully used to detect Pseudomonas aeruginosa in our group (He et al. 2007). Changes in the electrical parameters can be efficiently detected because the steady state can be established quickly in small distances between the anode and cathode electrode systems and because the signal-to-noise ratio was improved (Varshney and Li 2009; Thomas et al. 2004). In this study, a novel aptamer/graphene interdigitated gold electrode piezoelectric sensor for S. aureus was constructed by immobilizing S. aureus aptamers as recognition elements on the graphene surface of IDE. Graphene was immobilized onto the surface of IDE through 4-mercapto-benzenediazonium tetrafluoroborate; which the bonding mechanism of diazonium salt to the graphene surface has been clearly described by Cui et al (Cui et al. 2011). This sensor is rapid, simple, free-labeled, and high sensitive and selectivie, offering a valuable method for the fast and specific detection of S. aureus.
2. EXPERMENTS 2.1.
Materials
99.95% Graphite powders (325 mesh, Alfa Aesar,USA); 4-Amino Thiophenol (Alfa Aesar, USA). Isoamyl nitrite (Sinopharm Chemical Reagent Co., Ltd., China). Fluoroboric acid (Tianjin Kermel Chemical Reagent Co., Ltd., China). Tris-HCl buffered solution (50 mM pH=7.4, with 5 mM KCl, 100 mM NaCl and 5 mM MgCl2) All of the regents were pure analytical grade. Deionized water was used for the preparation of all of the solutions. S. aureus aptamers were collected from the Shanghai Sangon Biological Science and Technology Company Co., Ltd (Shanghai, China). The DNA sequence of the S. aureus aptamers was 5'-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAG CGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA3'. 2.2. 1
Apparatus
H NMR spectra (Varian INOVA-400 instrument); Raman spectra (BWS 435-785sy
Confocal Raman spectrometer, USA); FT-IR spectrophotometer (Thermo Nicolet 5700); SEM (Hitachi S4800); IDE-SPQC detection system (made by ourselves, Fig. S1). 2.3.
Stock and Test culture
Improved YC medium (yeast extract, 2 g; beef extract, 1 g; D-glucose, 40 g, 18AA amino acids, 16 mL; deionized water, 1000 mL; pH 7.2±0.2 ; our laboratory).
2.4.
Bacterial strains and culture media
The quality control strains: S. aureus ATCC 25923 was provided by Hunan Children’s Hospital. These strains were inoculated from a blood plate into a liquid medium and were grown for 18 h at 37 °C. Then the colonies on the plates were counted to determine the number of colony-forming units per milliliter (cfu/mL). The used experimental strains were as follows: Salmonella Typhimurium (S. Typhimurium) ATCC 50761, Group A Streptococcus (GAS) ATCC 19615, Pseudomonas aeruginosa (P. aeruginosa) ATCC 27853, Enterococcus faecalis (E. faecalis) ATCC 51299, Klebsiella pneumoniae (K. pneumoniae) ATCC 700603 and Escherichia coli (E. coli) ATCC 25922, provided by Hunan Children’s Hospital. The bacteria were cultured overnight under aerobic conditions at 37 °C in YC media. The concentrations of the six strains were determined by the poured plate counts (PPC) method. 2.5.
Modification of interdigital gold electrodes
The interdigital gold electrodes were sonicated for 5 min in acetone and cleaned by isopropanol and ethanol for 5 min, respectively. The electrodes were then rinsed with deionized water for 5 min and then dried under a stream of nitrogen gas. A 70 mM of MBDT (Fig. S3) of solution in acetonitrile was added dropwise to a flask containing the graphene dispersion (Li et al. 2008; Hummers Jr and Offeman 1958; Kovtyukhova et al. 1999). The mixture was stirred for 7 h at room temperature. Then, the prepared interdigital electrodes were immersed in the mixture solution for 18 h at 38 °C, after which the electrodes were removed, washed thoroughly with acetonitrile and acetone
and blown with nitrogen gas to remove the solvent. Next, the aptamers (5 µL) were added dropwise to the modified electrodes, and incubated at 37 °C for 16 h. The modified electrodes were washed twice with buffer solution (50 mM Tris-HCl pH=7.4, 5 mM KCl, 100 mM NaCl, and 5 mM MgCl2) and then with deionized water to remove the free aptamers. 2.6.
Detection of S. aureus by IDE-SPQC sensor
Aliquots (1 mL) of different concentrations of S. aureus were added to the test tubes, and the modified electrode was placed into the detected solution. The frequency shift curves were recorded automatically by the SPQC software. 3. RESULTS AND DISCUSSIONS 3.1.
The frequency shift response characteristics of electric parameter properties
Fig. S1A is the apparatus diagram of IDE-SPQC, its equivalent circuit was shown in Fig. S1B, where, 1 is the equivalent electric circuit model of quartz crystal, C0, Lq, Cq, Rq are static capacitance, motional inductance, motional capacitance and motional resistance, respectively; 2 is the equivalent electric circuit model of electrode modified with layer films, Cf and Rf are membrane capacitance and membrane resistance of modified layer of electrodes, respectively; 3 is the equivalent electric circuit model of solution, Cs and Rs are equivalent capacitance and equivalent resistance of solution, respectively. Because the solution parameters changed little during the detection process, so the Fig. S1B is simplified to Fig. S1C. The complex impedance Z of this model:
é ù wLq -1 2 ê ú Rf wC f R f wC q ê ú Z = R + jC = j 2 1 + (wC f R f ) 2 ê1 + (wC f R f ) 1 + C0 - w 2 L C ú q 0 Cq ê ú ë û
(1)
Where R is the impedance real part, X is the reactive component, j = - 1 . According to the phase conditions of oscillation theory, when the phase is zero, the phase angle of oscillation is -θ, - q = tan -1 ( C ) , make A = tan q , there are: R
C A + tan(-q ) = A + ( ) = 0 R AR f + wC f R 2f 1 + (wC f R f )
2
Because
wLq 1+
1 wCq
C0 - wLq C0 Cq
w = 2pF , bring F0 =
(2)
=0 (3)
1 to (3), 2p LqCq
(
)
é ù pF0Cq 2pF0 R 2f C f - AR f F = F0 ê1 + ú 2 2 ëê 1 - 2pF0C0 R f A + 4p F0 R f C f (C0 + C f )ûú
(4)
For our IDE-SPQC system,
F = f (R f , C f )
dF =
(5)
¶F ¶F dR f + dC f ¶R f ¶C f
ì A - 4p 2 F02C 2f R 2f A - 4pF0C f R f ¶F ï = pF02Cq í 2 2 2 ¶R f ï î 1 - 2pF0C0 R f A + 4p F0 R0 C f (C0 + C f
[
(6)
ü ï 2 ý (7) ) ïþ
]
ì 1 - 4p 2 F02C 2f R 2f + 4pF0C f R f A ¶F ï 2 3 = 2p F0 Cq í 2 2 2 ¶C f ï 1 - 2pF0C0 R f A + 4p F0 R f C f (C0 + C f î
[
ü ï ý (8) ï þ
)]
2
Where F0, C0 and A are all considered to be constants in formula (7) (8). While Rf
and Cf are initial resistance and capacitance of modified electrodes. Therefore,
P1 =
P2 =
ì A - 4p 2 F02C 2f R 2f A - 4pF0C f R f ¶F ï = pF02Cq í 2 2 2 ¶R f ï î 1 - 2pF0C0 R f A + 4p F0 R0 C f (C0 + C f
[
ì 1 - 4p 2 F02C 2f R 2f + 4pF0C f R f A ¶F ï = 2p 2 F03Cq í 2 2 2 ¶C f ï 1 - 2pF0C0 R f A + 4p F0 R f C f (C0 + C f î
[
)]
2
)]
2
ü ï ý ï þ
ü ï ý ï þ
(9)
(10)
Taking P1, P2 into equation (6):
dF = P1dR f + P2dC f
(11)
This is the relationship among frequency shift of contructed sensor with electric paramters of electrode. 3.2.
The response mechanism of constructed sensor to S. aureus
A diagram of the detection mechanism of the proposed sensor is shown in Scheme 1. 4-Mercapto-benzene diazonium tetrafluoroborate (MBDT) salt was used a molecular bridge to connect the interdigital gold electrode and graphene, bound to the electrode via the formation of Au-S bonds and to graphene via a diazonium functional group chemical bond. The S. aureus aptamer was bond to graphene via the π-π stacking of DNA bases. In the presence of S. aureus, the aptamer will break off from the graphene surface of the electrode because the binding force between the aptamer and graphene is lower than that between the aptamer and its target. As graphene has a
good electronic conductivity, and the aptamer is nonconductive, the electric characteristics of the electrode will change markedly, conferring a sensitive response to the constructed sensor. Scheme 1.
3.3.
Characterization of the materials
The Raman spectra of graphite, graphite oxide and graphene are shown in Fig. S3A. For graphite, only the G peak appears at 1567 cm-1 (curve a); for graphite oxide, two peaks appear at 1591 cm-1 (G peak shifts) and 1335 cm-1 (new D peak) (curve b); for graphene, two peaks appear at1598 cm-1 (G peak shifts) and 1352 cm-1 (D peak to) (curve c). The increase in the D/G intensity ratio of graphene compared to that of pristine graphite (Dresselhaus and Eklund 2000) indicates a decrease in the size of the in-plane sp2 domains and an increase in the partially ordered crystal structure (Ferrari and Robertson 2000). The Raman spectrum of graphene diazotized with MBDT is shown in Fig. S3B. Some new peaks appeared at 1097 cm-1 (C-N symmetric stretching) and 995 cm-1 (S-H antisymmetric stretching), respectively (Jiang et al. 2006). These peaks result from the bonding between mercaptophenyl groups with the graphene basal plane (El'kin et al. 2005). These spectroscopic characteristics fully demonstrate the successful diazotization of graphene with MBDT (Cui et al. 2011). The FE-SEM images of electrodes without and with graphene sheets are shown in Fig. S4A and Fig. S4B, respectively. Wrinkle-shaped graphene layers were disorderly distributed on the surface of the modified electrode, and some of graphene sheet
stacked together to form a multilayer structure. The images confirm that a graphene sheet was successfully immobilized on the electrode surface. 3.4.
Typical response curve of Staphylococcus aureus detected by aptame
/graphene IDE-SPQC The typical response curve of S. aureus detected by the proposed sensor is shown in Fig. 3, the curve (h). The concentration of S. aureus was 106 cfu/mL and was detection at 37 °C. For comparison, the response curves that were detected by the modified electrodes in detection medium without S. aureus and bare gold electrodes in detection medium containing S. aureus are shown in Fig. 3, the curve (a) and the curve (b), respectively. The frequency shift (F=Fi-F0) decreased only in the curve (h) and reached a plateau at approximately 60 min. This frequency decrease was caused by the aptamers bing stripped from the surface of graphene due to the reaction between the aptamers and S. aureus. The entire detection was completed within 60 min. In the curve (a) and the curve (b), neither the S. aureus nor aptamer was present, resulting in no frequency response. 3.5.
Effect of aptamer concentration
The effect of different concentrations of aptamers on the sensor response of S. aureus (106 cfu/mL) is shown in Fig. 2A. The frequency shifts continuously increased as the aptamer concentration varied from 50-600 nM. The maximum frequency shift was reached at the aptamer concentration of 600 nM, indicating that 600 nM is the best concentration for detecting S. aureus. There were no obvious changes in the
frequency shift when the aptamer concentration was greater than 600 nM. Therefore, 600 nM was used for further analyses. Figure 2. 3.6.
Specificity studies of the proposed method
Six other pathogenic bacteria (E. coli, K. pneumoniae, S. typhimurium, E. faecalis, GAS, and P. aeruginosa) were selected to study the specific response of the proposed sensor to S. aureus. These bacteria were inoculated at 37 °C in detection cells at concentrations of 105 cfu/mL. The detection results are shown in Fig. 2B. These six common bacteria produced no obvious signal responses, demonstrating that this approach has a good selectivity for S. aureus. 3.7.
The response of different concentrations of Staphylococcus aureus
The response curves of different concentrations of Staphylococcus aureus were detected by the proposed method and are shown in Fig. 3. The results demonstrate a continuous increase in the frequency shifts as the S. aureus concentrations varied from 101-107 cfu/mL (Fig. 3A). A linear relationship between the logarithmic values of the S. aureus concentrations and the frequency shifts was obtained as the S. aureus concentrations changed from 4.1×101-4.1×105 cfu/mL (Fig. 3B), following the equation = 12.967 + 8.604 with a linear correlation coefficient of 0.9879. The detection limit was low at 41 cfu/mL according to the triple standard deviation (σ) rule, that was, the signal reached 3 times of the standard deviation from the blank response at this S. aureus concentration. The relative standard deviation (RSD) of the five parallel experiments was in the range from 2-6%, indicating good reproducibility.
Figure 3. 3.8.
Regeneration of the sensor
After the analyses, the IDE was removed and washed thoroughly with acetonitrile and acetone and blown with nitrogen gas. In order to regenerate the sensor, the aptamers (5 µL) were again added dropwise to the modified electrodes and incubated at 37 °C for 16 h. The re-modified electrodes were washed twice with buffer solution and then with deionized water to remove the free aptamers. Finally, the aptamer was re-bound to the graphene, and the sensor was thoroughly regenerated. After these regeneration treatments, the frequency shift of the S. aureus detection (the cells with concentrations of 1×105 cfu/mL) using this regenerated sensor was 81 Hzˈwhich is very close to the frequency shift of the initial sensor which was 83Hz, indicating that the sensor can be thoroughly regenerated. After 10 regenerations in 10 days, the frequency shift was decreased by less than 5%, demonstrating that our sensor can be reused at least 10 times. 3.9.
Detection of S. aureus in milk
Milk samples were prepared by inoculation with different concentrations of S. aureus that were detected at 37 °C. The detection results from the proposed method and classical plate-counting methods are shown in Table 1. The detection limit in milk samples of the proposed method for S. aureus was 4.1×101 cfu/mL. The detection results of the developed bioassay were similar to those of the plate-counting method, indicating that this method can be used to detect real samples. The plate-counting method requires more than ten hours for bacteria to grow before
counting. Moreover, the plate count method is usually performed with dilutions, making the method tedious. Furthermore, the bacterium in the sample is often difficult to completely disperse into single bacterial cells before inoculation. Therefore, the plate-counting method produces a count that is lower than the actual results. However, the proposed method is performed without dilutions, and only a small amount of sample is added into the detection pool. Therefore, compared to the plate-counting method, the proposed method offers several key advantages, such as easy operation and rapid detection, among others. Table 1. 4. CONCLUSIONS In this study, a new aptamer/graphene-modified IDE-SPQC was constructed for the simple, rapid and specific detection of S. aureus. The aptamers are assembly on graphene and are used as molecular recognition probes, providing an efficient way to capture S. aureus. Importantly, the whole detection can be completed within 60 min, which is rapid compared to other methods. In addition, selective experiments typically demonstrate that this method is specific for S. aureus. Furthermore, this method was successfully used to detect of S. aureus in milk samples. This proposed method can be used as a detection platform for S. aureus in the future. We also will further study the impact of the geometries of IDE on the sensitivity of the sensor, hoping to demonstrate a higher sensitivity with a detection limit as low as 5 cfu/mL using the present method.
ACKNOWLEDGMENT This research work was supported by the National Natural Science Foundation of China (No.21275042) and National High Technology Research and Development Program of China (863 Program, No.2013AA020203).
REFERENCES Bennett, R.W., 2005. J. Food Pro. 68, 1264-1270. Breaker, R.R., 1997. Cur. Opin. Chem. Biol. 1, 26-31. Bunka, D.H.J., Stockley, P.G., 2006. Nat. Rev. Microbiol. 4, 588-596. Bai, L.J., Yuan, R., Chai, Y.Q., Zhuo, Y., Yuan, Y.L., Wang, Y., 2012. Biomater. 33, 1090-1096. Carroll, K.C., 2008. Mol. Diagn. Ther. 12, 15-24. Chang, H.X., Tang, L.H., Wang, Y., Jiang, J.H., Li, J.H., 2010. Anal. Chem. 82, 2341-2346. Cui, P., Seo, S., Lee, J.Y., Wang, L.Y., Lee, E., Min, M., Lee, H., 2011. ACS Nano 5, 6826-6833. Deng, S., Tjoa, V., Fan, H.M., Tan, H.R., Sayle, D.C., Olivo, M.,
Mhaisalkar, S.,
Wei, J., Sow, C.H., 2012. J. Am. Chem. Soc. 134, 4905-4917. Dresselhaus, M.S., Eklund, P.C., 2000. Adv. Phy49, 705-814. Dreyer, D.R., Jia, H.P., Bielawski, C.W., 2010. Angew. Chem. 122, 6965-6968. Duan, N., Wu, S.J., Zhu, C.Q., Ma, X.Y., Wang, Z.P., Yu, Y., Jiang,Y., 2012. Anal. Chim. Acta 723, 1-6. El'kin, P.M., Pulin, V.F., Kosterina, E.K., 2005. J. Appl. Spectrosc. 72, 483-487. Ferrari, A.C., Robertson, J., 2000. Phys. Rev. B 61, 14095-14107. Hamula, C.L.A., Guthrie, J.W., Zhang, H., Li, X.F., Le, X.C., 2006. TrAC Trends Anal. Chem. 25, 681-691. Hummers Jr, W.S., Offeman, R.E., 1958. J. Am. Chem. Soc. 80, 1339-1339. He, F.J., Ren, J.L., Liu, Z.H., 2007. Sensors Actuators B 123, 1057-1063.
He, S.J., S, B., Li, D., Zhu, C.F., Qi, W.P., Wen, Y.Q., Wang, L.H., Song, S.P., Fang, H.P., Fan, C.H., 2010. Adv. Funct. Mater. 20, 453-459. Jeyaratnam, D., Gottlieb, A., Ajoku, U., French, G. L., 2008. Diagn. Micr. Infec. Dis 61, 1-5. Jiang, Y., Cui, Y., Gu, R.N., 2006. Spectrosc Spectral Anal. 26, 1260-1263. Kipp, F., Becker, K., Peters, G., Eiff, Von. C., 2004. J. Clin. Microbiol. 42, 1277-1279. Kovtyukhova, N.I., Ollivier, P.J., Martin, B.R., Mallouk, T.E., Chizhik, S.A., Buzaneva, E.V., Gorchinskiy, A.D., 1999. Chem. Mater. 11, 771-778. Li, D., Mueller, M.B., Gilje, S., Kaner, R.B., Wallace, G.G., 2008. Nat. Nanotech. 451, 101-105. Liu, F., Ha, H.D., Han, D. J., Tae Seok Seo, T.S., 2013. Small 9, 3410-3414. Liu, F., Piao, Y.X., Choi, J.S., Seo, T.S., 2013. Biosens. Bioelectron. 50, 387-392. Liu, F., Jong, Y.C., Tae, S.S., 2010. Biosens. Bioelectron. 25, 2361-2365. Moumita, K., Anil, K.B., 2013. J. Phys. Chem. C 117, 25865-25875 Rooijakkers, S.H.M., Van Kessel, K.P.M., Van Strijp, J.A.G., 2005. Trends Microbiol. 13, 596-601. Sheng, Z.H., Zheng, X.Q., Xu, J.Y., Bao, W.J., Wang, F.B., Xia, X.H., 2012. Biosens. Bioelectron. 34, 125-131. Thomas, J.H., Kim, S.K., Hesketh, P.J., Halsall, H.B., Heineman, W.R., 2004. Anal. Biochem. 328, 113-122. Tuerk, C., Gold, L., 1990. Sci. 249, 505-510. Varshney, M., Li, Y., 2009. Biosens. Bioelectron. 24, 2951-2960. Wellinghausen, N., Siegel, D., Gebert, S., Winter, J., 2009. Eur. J. Clin. Microbiol. Infect. Diseas. 28, 1001-1005. Wu, M., Kempaiah, R., Huang, P.J.J., Maheshwari, V., Liu, J., 2011. Langmuir 27, 2731-2738. Xia, F., Zuo, X.L., Yang, R.Q., Xiao, Y., Kang, D., Vallée-Bélisle, A., Gong, X., Yuen, J., Hsu, B.B., Heeger, A.J., Plaxco, K.W., 2010. PNAS. 107, 10837-10841.
Yang, S.B., Feng, X.L., Ivanovici, S., Klaus, M., 2010. Angew. Chem. 122, 8586-8589. Yun, J.M., Kyoung, N.K., Ju, Y.K., Dong, O.S., Lee, W.J., Lee, S.H., Marya, L., Sang, O.K., 2012. Angew. Chem. 124,936-939. Zelada-Guillén, G.A., Sebastián-Avila, J.L., Blondeau, P., Riu, Jordi., Rius, F.X., 2012. Biosens. Bioelectron. 31, 226-232.
Figure caption: Scheme 1. Response mechanism diagram of proposed sensor: (A) the synthesis of MBDT salt and self-assembled on graphene. (B) immobilization of aptamer onto graphene modified on electrode through MBDT salt. (C) aptamers were break off from graphene in the presence of S. aureus, and resulted in the sensitive response of SPQC.
Fig 2. A: the effect of aptamers concentration on response of IDE-SPQC and B: selectivity of aptamer/graphene IDE-SPQC sensor toward different bacteria. The illustrated error bars represent the standard deviation of six repetitive measurements.
Figure 3. (A) Response curves of different concentrations (cfu/mL) of S. aureus. The concentrations (cfu/mL) were: a, blank; b, bare electrode; c, 101; d, 102 ; e, 103 ; f, 104 ; g, 105 ; h, 106 ; I, 107 ; (B) Relationship curve between values of frequency shift and S.aureus concentration. c=4.1×101~4.1×105 cfu/mL.
Table 1. Detection results of S. aureus in milk.
Table 1.
S. aureus Samples
Plate counting method (cfu/mL)
RSD (%)
Proposed method (cfu/mL)
RSD (%)
1
42
4.26
59
4.85
2
412
1.86
318
2.13
3
4078
0.31
2894
0.61
4
41031
0.042
30796
0.071
5
408954
0.0045
329856
0.0069
Highlight: 1) Aptamer/Graphene Interdigitated Gold Electrode Piezoelectric Sensor was used for the first time to detect Staphylococcus aureus which shows a high sensitivity, specificity and rapid detection time. 2) The novel biosensor was proposed using Staphylococcus aureus aptamer as a biological recognition element and the graphene could improve the electron transfer rate between the interdigital gold electrodes. The proposed sensor is stable high selectivity and sensitive without complicated modifications, so the detection limit is low. 3) The proposed sensor has been successfully applied in the analysis of Staphylococcus aureus in milk. Comparing to the common assay, the proposed method needs no pretreatment process of the sample. It is simpler and the equipment cost low.
