Fish & Shellfish Immunology 46 (2015) 315e322
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Grouper voltage-dependent anion selective channel protein 2 is required for nervous necrosis virus infection Jui-Shin Chang, Shau-Chi Chi* Department of Life Science, National Taiwan University, Taipei 10617, Taiwan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 April 2015 Received in revised form 13 May 2015 Accepted 28 May 2015 Available online 4 June 2015
Nervous necrosis virus (NNV) is a non-enveloped virus with 2 segmented positive-sense single-stranded RNAs. NNV-induced mass mortality has occurred worldwide in many species of cultured marine fish and resulted in substantial economic losses. In our previous study, we cloned the gene of voltage-dependent anion selective channel protein 2 (GVDAC2), and the NNV RNA2 expression level decreased in GVDAC2knockdown GF-1 cells 24 h after infection. Here, we investigated the role of GVDAC2 in the NNV infection in GF-1 cells. NNV infection did not considerably affect GVDAC2 gene expression. After performing immunostaining, we detected GVDAC2 at the mitochondria and GVDAC2 was colocalized with NNV-RNAdependent RNA polymerase. However, these 2 proteins did not interact with each other in immunoprecipitation assay. The cellular ATP level in GVDAC2-downregulated cells was lower than that in control cells, and NNV-induced apoptosis was delayed in GVDAC2-siRNA-transfected cells. Therefore, we suggest that GVDAC2 is required for NNV infection for maintaining the cellular ATP level and has positive impact on virus-induced apoptosis. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Grouper Nervous necrosis virus (NNV) Grouper voltage-dependent anion selective channel protein 2 (GVDAC2) Apoptosis
1. Introduction Viral nervous necrosis (VNN) disease, induced by the nervous necrosis virus (NNV), has caused mass mortality in many species of cultured marine fish [1,2]. The NNV genome comprises 2 segments of positive single-stranded RNAs, RNA1 and RNA2. RNA1 encodes RNA-dependent RNA polymerase (RdRp), and RNA2 encodes the structural capsid protein [3]. RNA3, a subgenome of RNA1, encodes B1 and B2 proteins [4]. The B1 protein participates in antinecrotic cell death by reducing the mitochondrial membrane potential (MMP) loss, and thus sustains cell viability [5]. The B2 protein binds to newly synthesized viral double-stranded RNA to prevent host RNA-interference mediated cleavage [6], and induces mitochondria-mediated cell death at late stage [7]. Apoptosis is a process of highly controlled programmed cell death [8]. It is initiated by an extrinsic or intrinsic pathway in mammals [9]. In the extrinsic pathway, a death ligand binds to a death receptor, such as the Fas complex or tumor necrosis receptor, and triggers the caspase-8 cascade to active the apoptotic pathway [10]. The intrinsic pathway is triggered by different extracellular or
* Corresponding author. E-mail address: [email protected] (S.-C. Chi). http://dx.doi.org/10.1016/j.fsi.2015.05.040 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
intracellular signals, such as oxidative stress and viral infection, resulting in the activation of the initiator caspase-9. Subsequently, caspase-9 activates caspase-3, which is responsible for degrading cellular substrates [11]. Mitochondrial membrane permeabilization precedes the signs of apoptotic and necrotic cell death [12]. Thus, the MMP loss is necessary for a caspase activation pathway, which depends on cytochrome c release from the mitochondria to cytosol [13]. Cytochrome c release is initiated by the interaction of the mitochondria with one or more Bcl-2 family members and other downstream proteins, such as Bax and Bak [14,15]. Voltagedependent anion selective channel protein (VDAC) is mainly located on the mitochondrial outer membrane [16]. VDAC has 3 isoforms: VDAC1, VDAC2, and VDAC3. In mammals, each isoform has 65%e70% identity with other isoforms [17,18]. VDAC can bind adenine nucleotide translocase (ANT), forming a hydrophilic pore, and regulate the Ca2þ and ATP permeability of the mitochondria [19e21]. In addition, VDAC is associated with cell apoptosis [22]. Proteins of many viruses, such as influenza virus, EpsteineBarr virus (EBV), and infectious bursal disease virus (IBDV), can regulate cell apoptosis through VDAC [23e25]. In groupers, 2 VDACs have been identified: GVDAC1 and GVDAC2. GVDAC1 was reported to induce apoptosis when overexpressed in fathead minnow cells and participates in antibacterial immune response [26]. GVDAC2 was initially identified in our previous study, and downregulation of
316
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
2. Materials and methods
and actin (Gactin235_RT_F/R). cDNA was added to the real-time PCR buffer, which included 0.5 mM forward and reverse primers in 1 iQ SYBR Green Supermix (Bio-Rad). Amplification was performed on an iCycler iQ real-time PCR detection system (Bio-Rad) with a PCR program of 94 C for 3 min, followed by 40 cycles of 94 C for 20 s, 55 C for 20 s, and 72 C for 20 s, and fluorescence detection was set at 85 C for 20 s. All samples were analyzed in triplicate. PCR product specificity was confirmed by conducting melting curve analysis, and relative gene expression levels were normalized with the actin expression level. The statistical significance was analyzed with Student's t test to determine differences between groups.
2.1. Virus, cells, and antibodies
2.4. Western blotting
The GF-1 cell line was derived from grouper (Epinephelus coioides) fin tissue [29] and cultured in Leibovitz's L-15 medium (Gibco) with 5% fetal bovine serum (FBS) (Gibco). NNV was isolated from grouper larvae with VNN disease [30]. NNV was proliferated in GF-1 cells with a multiplicity of infection (MOI) of 1, and infected cells were incubated in L-15 medium with 2% FBS at 28 C. After a complete cytopathic effect (CPE) was observed, the culture supernatant was collected through centrifugation at 12,000 g for 10 min and then titrated in GF-1 cells. The NNV RdRp and GVDAC2specific polyclonal antibodies were prepared as described in our previous studies [27,31].
We extracted total GF-1 proteins through sonication for 10 min by using a protein lysis buffer containing 50 mM TriseHCl (pH 8), 150 mM NaCl, 1 mM EDTA, 0.1% NP-40, 1 mM DTT, and 1 protease inhibitor (Roche). The total protein lysate was centrifuged at 10,000 g at 4 C for 10 min, the concentration was adjusted to 10 mg per well for 10% SDS-PAGE, and the proteins were transferred to a PVDF membrane. The membrane was blocked with 5% skim milk in a TBST buffer (50 mM TriseHCl, 150 mM NaCl, 0.1% Tween20, pH 7.5) for 1 h at room temperature and then incubated with 1:1000-diluted rabbit antiserum against GVDAC2 for 1 h at room temperature. After extensive washing, the antigen signal was developed using the ECL Select™ Western Blotting Detection Reagent (GE Healthcare) and visualized through autoradiography. Protein intensities were analyzed using ImageJ software [32].
GVDAC2 reduced NNV RNA replication [27]. However, the underlying mechanism of GVDAC2 siRNA-induced reduction of NNV RNA synthesis remains unclear. NNV infection can induce apoptosis and post-apoptotic necrotic cell death through MMP loss and cytochrome c release. A study suggested that apoptosis promotes the release of newly synthesized viral particles from host cells [28]. Here, we investigated the role of GVDAC2 in NNV replication by downregulation through siRNA, and then analyzed ATP levels and NNV-induced apoptosis during infection.
2.2. GVDAC2 RNA knockdown GVDAC2 short-interfering RNAs of GVDAC2 (GVDAC2-siRNAs) and negative control nonsilencing siRNA (NS-siRNA) were prepared in our previous study [27]. Table 1 shows the siRNA sequences. These siRNAs were transfected into GF-1 cells by using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. GF-1 cells were separately transfected with GVDAC2-siRNA or NS-siRNA for 24 h and then infected with NNV (MOI ¼ 10). After 24 or 48 h of NNV infection, total cellular RNA was extracted for realtime reverse transcription (RT)-PCR analysis of the target genes, and GVDAC2 protein levels were analyzed through Western blotting (WB). The virions extracted from both sets of NNV-infected cells at 24 or 48 h post infection (hpi) were frozen and thawed for 3 times and then titrated.
2.5. Immunoprecipitation assay GF-1 cells were infected with NNV (MOI ¼ 100) for 72 h, and total proteins were harvested using a protein lysis buffer. Proteins extracted from non-infected GF-1 cells were used as the control. Immunoprecipitation (IP) and WB assays were conducted using an ImmunoCruz IP/WB optima F system (Santa Cruz) according to the manufacturer's instructions. The possible GVDAC2 and NNV RdRp protein complex was immunoprecipitated using rabbit antiserum against GVDAC2 and then analyzed through WB by using rabbit antiserum against NNV RdRp. The rabbit pre-immune antiserum was used in as negative control. 2.6. Immunofluorescence staining
2.3. Real-time RT-PCR Total RNAs from siRNA-transfected cells at different time points of NNV infection were extracted and reverse transcribed into cDNA by using dT20 and NNVR3 primers. The expression levels of GVDAC2, NNV RNA2, and actin (internal control) were assayed using real-time PCR. Table 1 lists the sequences of the primer sets for GVDAC2 (GVDAC2_RT229_F/R), NNV RNA2 (NNVRNA2_RT_F/R),
Table 1 Primers and siRNAs used in this study. Primer name
Sequence (50 e30 )
NNVR3 GVDAC2_RT229_F GVDAC2_RT229_R Gactin235_RT_F Gactin235_RT_R NNVRNA2_RT_F NNVRNA2_RT_R GVDAC2-siRNA Non-silencing control siRNA
CGAGTCAACACGGGTGAAGA AAACTGGCGCAGAACAACTT TGTTCACTTTGGCAGACAGC GGCCGCGACCTCACAGACTACCTC CCTCTGGGCAACGGAACCTCTCAT CAGTCCGACCTCAGTACAC AACACTCCAGCGACACAG r(GAAGUGGAACACUGACAAC)dTdT r(UUCUUCGAACGUGUCACGU)dTdT
GF-1 cells, preseeded on cover glasses, were stained with MitoTracker® Mitochondrion-Selective Probes (Invitrogen) for 15 min and then fixed with 10% formalin in phosphate-buffered saline (PBS) for 10 min at room temperature. The fixed cells were treated with 0.5% Triton X-100 (Sigma) in PBS for membrane permeabilization. After 3 washes with PBS, the cells were incubated with a blocking buffer (5% BSA in PBS) for 1 h at room temperature and then reacted with 1:200-diluted rabbit anti-GVDAC2 for 1 h. After washing, the cells were incubated with fluorescein isothiocyanate (FITC)-labeled anti rabbit antiserum for 1 h. Cell nuclei were stained with Hoechst 33258 (1:500 diluted in PBS) for 30 min. Finally, the cells were observed and the images were captured using a fluorescence microscope (Olympus IX70). To investigate the colocalization of GVDAC2 with the NNV RdRp protein in GF-1 cells, the cells were infected with NNV (MOI ¼ 100) for 72 h. After 3 washes with PBS, the cells were incubated with rabbit anti-GVDAC2 antibodies. The cells were washed 3 times with PBS and separately immunostained with FITC-labeled anti-rabbit antibodies. The NNV RdRp protein was detected using a rhodamine-labeled rabbit antibody against the NNV RdRp protein.
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
317
Fig. 1. Real-time PCR analysis of (A) GVDAC2 and (B) NNV RNA2 gene expression levels during NNV infection. GF-1 cells were infected with NNV (MOI ¼ 10) and then collected at 24, 48, and 72 hpi. GVDAC2 gene expression level in non-infected cells was regarded as 1 in (A). NNV RNA2 expression level in the cells at 24 hpi was regarded as 1 in (B). Error bars indicate standard deviations.
2.7. Cellular ATP level measurement The ATP level was measured by conducting a luciferin-luciferase reaction using the ApoSENSOR™ Cell Viability Assay Kit (BioVision). Briefly, 5.5 103 GF-1 cells were seeded in an opaque 96well plate. The cells were separately transfected with GVDAC2siRNA or NS-siRNA for 24 h and then infected with NNV for another 24 h. The cells were collected and assayed according to the manufacturer's instructions. The luminescence of a 100 ml lysate was measured immediately by using a luminometer plate reader (FlexStation 3; Molecular Devices, USA). The statistical significance was analyzed with unpaired Student's t test to determine differences between groups. The statistical significance was analyzed with Student's t test to determine differences between groups.
2.8. Apoptosis analysis The percentage of cells undergoing apoptosis was determined through flow cytometry by using the FITC Annexin V Apoptosis Detection Kit I (BD Pharmingen™) according to the manufacturer's instructions. GF-1 cells were infected with NNV (MOI ¼ 10) for 24, 48, or 72 h. Approximately 1 105 GF-1 cells were harvested and resuspended in a binding buffer and were mixed with annexin VFITC and propidium iodide (PI). After incubation for 15 min in the dark, a flow cytometer (FACSCanto II; BD, USA) was used to analyze
cellular apoptosis. For detecting apoptosis in GVDAC2-knockdown cells, GF-1 cells were transfected with GVDAC2-siRNA or NS-siRNA for 24 h and then infected with NNV (MOI ¼ 10) for an additional 24 or 48 h. The cells were collected for cellular apoptosis analysis. 3. Results 3.1. NNV infection did not considerably affect GVDAC2 gene expression To analyze the effect of NNV infection on GVDAC2 gene expression, NNV-infected GF-1 cells were collected at 24, 48, and 72 hpi, and the GVDAC2 gene expression level was detected through real time RT-PCR. Compared with non-infected cells, the GVDAC2 gene expression level in NNV-infected cells did not vary considerably over 72 h (Fig. 1A). The NNV RNA2 expression level was detected at the same time points as those for the experimental control and considerably increased at 72 hpi (Fig. 1B). 3.2. GVDAC2-knockdown reduced NNV RNA2 levels and titers in GF-1 cells In our previous study, we knocked down 70% of the GVDAC2 gene expression level at 24 h post transfection (hpt) by using a
Fig. 2. The siRNA downregulation of GVDAC2 protein expression. GF-1 cells were transfected with GVDAC2-specific siRNA for downregulation, and nonsilencing siRNA (NS-siRNA) was used as a negative control. (A) GVDAC2 protein expression levels were determined through WB at 24 and 48 h post transfection. (B) The intensity of the GVDAC2 protein was analyzed using ImageJ software and normalized with the loading control (actin). The GVDAC2 protein level in theNS-siRNA knockdown (negative control) was considered 1.
318
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
Fig. 3. NNV RNA expression levels and titers in GVDAC2-knockdown GF-1 cells. After GVDAC2-siRNA transfection, GF-1 cells were infected with NNV (MOI ¼ 10), and NNV RNA2 expression levels at 24 hpi (A) and viral titers at 24 and 48 hpi (B) were examined. The level in the negative control was regarded as 1. Error bars indicate standard deviations. **, P < 0.01 (n ¼ 3).
specific siRNA [27]. In the present study, the GVDAC2 protein level after GVDAC2-siRNA transfection was examined. Compared with NS-siRNA-transfected cells, the GVDAC2 protein expression level in GVDAC2-siRNA-transfected cells decreased to 92% and 74% at 24 hpt and 48 hpt, respectively (Fig. 2). The cells at 24 hpt were further infected with NNV for an additional 24 h, and the relative NNV RNA2 gene expression level decreased by 40% in GVDAC2-knockdown cells (Fig. 3A). NNV titers in GVDAC2-knockdown cells were 1.3 103 tissue culture infective dose (TCID50) ml1 and 1.5 105 TCID50 ml1 at 24 hpi and 48 hpi,
respectively (Fig. 3B). Both titers were lower than those of NSsiRNA-knockdown cells, particularly at 48 hpi. 3.3. GVDAC2 located at mitochondria and colocalized with NNV RdRp VDAC is reported to locate on mitochondrial outer membrane [16,33]. To confirm the location of the GVDAC2 protein, we labeled the mitochondria with MitoTracker® and then immunostained the mitochondria with GVDAC2-specific antibodies. A colocalizing
Fig. 4. Localization of GVDAC2, mitochondria and NNV according to immunofluorescence staining. (A) GF-1 cells were infected with NNV (MOI ¼ 10) for 72 h (bottom panel). Noninfectied GF-1 cells (top) were used as control cells. The cells were stained with MitoTracker® and anti-GVDAC2 antibodies. (B) NNV-infected GF-1 cells were immunostained with anti-GVDAC2 and anti-NNV RdRp antibodies. Cell nuclei were stained with Hoechst 33258. Samples were observed under a fluorescence microscope.
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
319
Fig. 5. Immunoprecipitation of GVDAC2 with NNV RdRp. (A) The cell lysates from NNV-infected at 72 hpi and non-infected GF-1 cells were used as input for an IP assay. (B) WB of proteins immunoprecipitated by a rabbit antibody against GVDAC2. (C) WB of proteins immunoprecipitated by a pre-immune rabbit antiserum as negative control.
signal (yellow) of the mitochondria and GVDAC2 was observed, and GVDAC2 remained on the mitochondria after NNV infection (Fig. 4A). To determine whether GVDAC2 could colocalize with NNV RdRp, GF-1 cells were infected with NNV (MOI ¼ 100) for 72 h and then immunostained with specific antibodies separately against NNV RdRp and GVDAC2. The specific colocalizing signal (yellow) of NNV RdRp and GVDAC2 was observed (Fig. 4B). 3.4. GVDAC2 did not immunoprecipitate with NNV RdRp Because NNV RdRp colocalized with GVDAC2 during NNV infection, we further analyzed the interaction between these 2 proteins by performing an IP assay. The result revealed that GVDAC2 did not interact with NNV RdRp (Fig. 5B). 3.5. Cellular ATP level decreased in GVDAC2-knockdown GF-1 cells We demonstrated that the NNV RNA2 expression significantly decreased at 24 hpi in the GVDAC2-knockdown cells (Fig. 3A). Because NNV RNA synthesis requires ATP and nucleic acids from host cells, and VDAC participates in ATP transportation through the mitochondria [21]. Therefore, we examined ATP levels in GVDAC2knockdown cells and NNV-infected cells. The results are shown in Fig. 6. The ATP level in the cells without GVDAC2-knockdown was considered 1, and the ATP level significantly decreased to 0.6 in GVDAC2-knockdown cells. At 24 h after NNV infection, the ATP
level in the cells without GVADAC2 knockdown significantly decreased to 0.49, and that in GVDAC2-knockdown cells decreased to 0.54. 3.6. GVDAC2-knockdown delayed NNV-induced apoptosis in GF-1 cells NNV induces apoptosis in host cells [34], and VDAC protein has been reported to mediate apoptosis in mammalian cells [35,36]. We thus examined the apoptosis by using FITC-annexin V and PI staining. Propidium iodide (PI) is a membrane impermeant dye that is generally excluded from viable cells, and FITC-annexin V is used to detect apoptotic cells. The early apoptotic cells were PI negative and FITC-annexin V positive. The cells at late apoptosis were both PI and FITC-annexin V positive. Necrotic cells were PI positive and FITC-annexin V negative. The annexin V-positive signal was evident at 24 hpi, and the PI-positive signal was highly expressed by the cells from 48 to 72 hpi (Fig. 7A). The percentage of apoptotic and necrotic cells was analyzed through flow cytometry. The ratio of early apoptosis (Q4) increased from 24 to 72 hpi, and late apoptotic (Q2) and necrotic (Q1) cells mainly appeared at 72 hpi (Fig. 7B). Because early apoptosis began occurring 24 h after NNV infection and the ratios of early apoptotic could be clearly differentiated between 24 and 48 hpi, we thus analyzed the early apoptosis in GVDAC2-knockdown GF-1 cells at 24 and 48 h after NNV infection. To evaluate the effect of GVDAC2 on NNV-induced cellular apoptosis, we examined the ratio of apoptotic cells in GVDAC2knockdown GF-1 cells. The ratio of early apoptotic cells (Q4) was 8.7% at 24 hpi and increased to 11.8% at 48 hpi in NS-siRNAtransfected cells (Fig. 8). However, the ratios of apoptotic cells in GVDAC2-knockdown cells were 4.9% at 24 hpi and 6.5% at 48 hpi, respectively; these ratios were much lower than those in the NSsiRNA-transfected cells at the same time periods. Moreover, the ratio of early apoptotic GVDAC2-knockdown cells at 48 hpi (6.5%) was much lower than that of early apoptotic NS-siRNA-transfected cells at 24 hpi (8.7%), indicating that the NNV-induced progression of apoptosis was delayed in GVDAC2-knockdown cells. 4. Discussion
Fig. 6. Cellular ATP levels in GVDAC2-knockdown cells and NNV-infected cells. GF-1 cells were transfected with GVDAC2-siRNA for 24 h and then infected with NNV (MOI ¼ 10) for additional 24 h. Mock-infected cells were analyzed at 48 hpt. The ATP level in the NS-siRNA transfected cells was considered 1. Error bars indicate standard deviations. *, P < 0.05 (n ¼ 3).
In our previous study, we cloned and identified GVDAC2 from GF-1 cells. NNV RNA2 expression significantly decreased after 24 h of NNV infection in GVDAC2-knockdown cells; however, the IP assay results revealed that GVDAC2 did not interact with the NNV capsid protein [27]. In the present study, we further investigated the role of GVDAC2 during NNV infection. Grass carp reovirus (GCRV), white spot syndrome virus (WSSV), EBV, and mud crab reovirus (MCRV) are reported to enhance the expression of VDAC gene in certain cell lines or organisms [24,37e39]. However, the GVDAC2 gene expression level did not significantly increase after NNV infection. We transfected GF-1 cells
320
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
Fig. 7. Progression of NNV-induced apoptosis in GF-1 cells. GF-1 cells were infected with NNV (MOI ¼ 10) and collected at 24, 48, and 72 hpi. The apoptotic cells were stained with FITC-annexin V and PI. Fluorescence signals were observed through (A) fluorescence microscopy and (B) flow cytometry. Annexin V (X-axes) and PI (Y-axes) signals were measured from 10,000 cells. The percentage of cells at Q1Q4 in the subpopulations is shown. Q1, necrotic cells (annexin V/PIþ); Q2, late apoptotic cells (annexin Vþ/PIþ); Q3, viable cells (annexin V/PI); and Q4, early apoptotic cells (annexin Vþ/PI).
with a specific siRNA to downregulate the cellular GVDAC2 and observed that the NNV RNA2 expression level significantly decreased at 24 hpi, and the viral titer was significantly downregulated at 48 hpi, indicating that GVDAC2 is essential for NNV replication. NNV RdRp is located on the mitochondrial outer membrane during viral genome replication [40]. Through immunostaining, we
confirmed that GVDAC2 is also located at the mitochondria and colocalized with NNV RdRp. We assumed that if GVDAC2 is beneficial to the enzyme function of NNV RdRp function, both proteins might interact with each other. However, the IP assay result rejected our assumption. On the other hand, NNV RNA synthesis requires host resources, including energy (ATP) and nucleic acids, and VDAC is essential in ATP transportation between the
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
321
Fig. 8. Progression of NNV-induced apoptosis in GVDAC2-knockdown GF-1 cells. GF-1 cells were transfected with GVDAC2-siRNA for 24 h and then infected with NNV (MOI ¼ 10). The cells were collected at 24 and 48 hpi, and the PI/FITC-annexin V dual-staining fluorescence signal was measured from 10,000 cells. The percentage in Q1, Q2 and Q4 indicates the ratio of cells at necrotic, late apoptotic, and early apoptotic stages, respectively. The percentage in Q3 represented the ratio of cells neither apoptosis nor necrosis.
mitochondria and cytosol [21]. Thus, the decrease in the NNV RNA2 level in GVDAC2-knockdown cells might result from the defect of ATP transportation. We demonstrated that the ATP level in GVDAC2-siRNA-transfected cells was only 60% of that in NS-siRNAtransfected cells, indicating that GVDAC2 downregulation significantly reduced the ATP level in host cells. In addition, the ATP level in NNV-infected cells at 24 hpi was significantly lower than that in non-infected cells, confirming that the early stage of NNV replication rapidly depleted host ATP. Therefore, the low expression level of NNV RNA2 detected at 24 hpi in GVDAC2-knowdown cells was possibly caused by the low level of ATP attributable to GVDAC2siRNA transfection. Another major function of VDAC is the regulation of cellular apoptosis [35]. Because NNV induces apoptosis during infection, we examined whether GVDAC2 participates in the NNV-induced apoptosis. During NNV infection, the ratio of early apoptotic cells (Q4) constantly increased from 24 to 48 hpi in NS-siRNA- and GVDAC2-siRNA-transfected cells (Fig. 8). However, the ratio of early apoptotic cells (Q4) in GVDAC2-knockdown cells (4.9% at 24 hpi and 6.5% at 48 hpi) was much lower than that in NS-siRNA-transfected cells (8.7% at 24 hpi and 11.8% at 48 hpi), indicating that GVDAC2 downregulation reduced the percentage of early apoptotic cells from 24 to 48 hpi; in other words, it delayed apoptosis progression. Because apoptosis and the following necrosis are associated with the release of progeny virions, delayed progression of early apoptosis may result in a lower NNV titer observed at 48 hpi in GVDAC2-siRNA-transfected cells than that in NS-siRNA-transfected cells. In summary, this is the first study to identify the roles of the grouper VDAC2 protein during NNV infection, including
maintaining the transport of sufficient ATP for NNV RNA synthesis and the progression of NNV-induced apoptosis in host cells. Acknowledgment We appreciate the technical assistance and support provided by the Technology Commons, College of Life Science, National Taiwan University, with regard to luminometer plate reader, flow cytometry, and real-time PCR. The work was partially supported by the Ministry of Science and Technology Taiwan under contract no. MOST 103-2313-B-002-046. References [1] S. Chi, J. Shieh, S. Lin, Genetic and antigenic analysis of betanodaviruses isolated from aquatic organisms in Taiwan, Dis. Aquat. Org. 55 (2003) 221e228. [2] B. Munday, J. Kwang, N. Moody, Betanodavirus infections of teleost fish: a review, J. Fish. Dis. 25 (2002) 127e142. [3] K. Mori, T. Nakai, K. Muroga, M. Arimoto, K. Mushiake, I. Furusawa, Properties of a new virus belonging to nodaviridae found in larval striped jack (Pseudocaranx dentex) with nervous necrosis, Virology 187 (1992) 368e371. [4] I. Sommerset, A.H. Nerland, Complete sequence of RNA1 and subgenomic RNA3 of Atlantic halibut nodavirus (AHNV), Dis. Aquat. Org. 58 (2004) 117e125. [5] L.-J. Chen, Y.-C. Su, J.-R. Hong, Betanodavirus non-structural protein B1: A novel anti-necrotic death factor that modulates cell death in early replication cycle in fish cells, Virology 385 (2009) 444e454. [6] B.J. Fenner, R. Thiagarajan, H.K. Chua, J. Kwang, Betanodavirus B2 is an RNA interference antagonist that facilitates intracellular viral RNA accumulation, J. Virol. 80 (2006) 85e94. [7] Y.C. Su, H.W. Chiu, J.C. Hung, J.R. Hong, Beta-nodavirus B2 protein induces hydrogen peroxide production, leading to Drp1-recruited mitochondrial fragmentation and cell death via mitochondrial targeting, Apoptosis 19 (2014)
322
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
1457e1470. [8] M. Chawla-Sarkar, D.J. Lindner, Y.F. Liu, B. Williams, G.C. Sen, R.H. Silverman, et al., Apoptosis and interferons: role of interferon-stimulated genes as mediators of apoptosis, Apoptosis 8 (2003) 237e249. [9] N.N. Danial, S.J. Korsmeyer, Cell death: critical control points, Cell 116 (2004) 205e219. [10] H. Wajant, The fas signaling pathway: more than a paradigm, Science 296 (2002) 1635e1636. [11] D.L. Allen, J.K. Linderman, R.R. Roy, A.J. Bigbee, R.E. Grindeland, V. Mukku, et al., Apoptosis: a mechanism contributing to remodeling of skeletal muscle in response to hindlimb unweighting, Am. J. Physiol. 273 (1997) C579eC587. czky, Rapid [12] M. Madesh, B. Antonsson, S.M. Srinivasula, E.S. Alnemri, G. Hajno kinetics of tBid-induced cytochrome c and Smac/DIABLO release and mitochondrial depolarization, J. Biol. Chem. 277 (2002) 5651e5659. [13] K.F. Ferri, G. Kroemer, Organelle-specific initiation of cell death pathways, Nat. Cell. Biol. 3 (2001) 255e263. [14] S.N. Farrow, R. Brown, New members of the Bcl-2 family and their protein partners, Curr. Opin. Genet. Dev. 6 (1996) 45e49. [15] S. Ma, C. Hockings, K. Anwari, T. Kratina, S. Fennell, M. Lazarou, et al., Assembly of the Bak Apoptotic Pore: a critical role for the bak protein 6 helix in the multimerization of homodimers during apoptosis, J. Biol. Chem. 288 (2013) 26027e26038. [16] B.W. Hoogenboom, K. Suda, A. Engel, D. Fotiadis, The supramolecular assemblies of voltage-dependent anion channels in the native membrane, J. Mol. Biol. 370 (2007) 246e255. [17] Mde C. Cesar, J.E. Wilson, All three isoforms of the voltage-dependent anion channel (VDAC1, VDAC2, and VDAC3) are present in mitochondria from bovine, rabbit, and rat brain, Arch. Biochem. Biophys. 422 (2004) 191e196. [18] A. Messina, S. Reina, F. Guarino, V. De Pinto, VDAC isoforms in mammals, Biochim. Biophys. Acta 2012 (1818) 1466e1476. [19] D. Gincel, H. Zaid, V. Shoshan-Barmatz, Calcium binding and translocation by the voltage-dependent anion channel: a possible regulatory mechanism in mitochondrial function, Biochem. J. 358 (2001) 147e155. [20] W.T. Regenold, M. Pratt, S. Nekkalapu, P.S. Shapiro, T. Kristian, G. Fiskum, Mitochondrial detachment of hexokinase 1 in mood and psychotic disorders: implications for brain energy metabolism and neurotrophic signaling, J. Psychiatr. Res. 46 (2012) 95e104. [21] T.K. Rostovtseva, S.M. Bezrukov, ATP transport through a single mitochondrial channel, VDAC, studied by current fluctuation analysis, Biophys. J. 74 (1998) 2365e2373. [22] T.K. Rostovtseva, W. Tan, M. Colombini, On the role of VDAC in apoptosis: fact and fiction, J. Bioenerg. Biomembr. 37 (2005) 129e142. [23] D. Zamarin, A. García-Sastre, X. Xiao, R. Wang, P. Palese, Influenza virus PB1F2 protein induces cell death through mitochondrial ANT3 and VDAC1, PLoS Pathog. 1 (2005) e4. [24] X. Feng, C.B. Ching, W.N. Chen, EBV up-regulates cytochrome c through VDAC1 regulations and decreases the release of cytoplasmic Ca2þ in the NPC cell line, Cell. Biol. Int. 36 (2012) 733e738.
[25] Z. Li, Y. Wang, Y. Xue, X. Li, H. Cao, S.J. Zheng, Critical role for voltagedependent anion channel 2 in infectious bursal disease virus-induced apoptosis in host cells via interaction with VP5, J. Virol. 86 (2012) 1328e1338. [26] Y. Shi, Z. Zhao, X. Hong, K. Chen, X. Zhu, Characterization and functional analysis of voltage-dependent anion channel 1 (VDAC1) from orange-spotted grouper (Epinephelus coioides), J. Biochem. Mol. Toxicol. 28 (2014) 292e301. [27] J.-S. Chang, S.-C. Chi, GHSC70 is involved in the cellular entry of nervous necrosis virus, J. Virol. 89 (2015) 61e70. [28] S.-P. Chen, H.-L. Yang, G.M. Her, H.-Y. Lin, M.-F. Jeng, J.-L. Wu, et al., Betanodavirus induces phosphatidylserine exposure and loss of mitochondrial membrane potential in secondary necrotic cells, both of which are blocked by bongkrekic acid, Virology 347 (2006) 379e391. [29] S. Chi, W. Hu, B. Lo, Establishment and characterization of a continuous cell line (GF-1) derived from grouper, Epinephelus coioides (Hamilton): a cell line susceptible to grouper nervous necrosis virus (GNNV), J. Fish. Dis. 22 (1999) 173e182. [30] S. Chi, B. Lo, S. Lin, Characterization of grouper nervous necrosis virus (GNNV), J. Fish. Dis. 24 (2001) 3e13. [31] Y.-C. Wu, Y.-F. Lu, S.-C. Chi, Anti-viral mechanism of barramundi Mx against betanodavirus involves the inhibition of viral RNA synthesis through the interference of RdRp, Fish. Shellfish Immun. 28 (2010) 467e475. [32] C.A. Schneider, W.S. Rasband, K.W. Eliceiri, NIH Image to ImageJ: 25 years of image analysis, Nat. Methods 9 (2012) 671e675. [33] M. Colombini, VDAC: the channel at the interface between mitochondria and the cytosol, Mol. Cell. Biochem. 256 (2004) 107e115. [34] H.-C. Wu, J.-L. Wu, H.-L. Chu, Y.-C. Su, J.-R. Hong, RGNNV induces mitochondria-mediated cell death via newly synthesized protein dependent pathway in fish cells, Fish. Shellfish Immun. 29 (2010) 451e463. €tz, B. Gillissen, A.M. Hossini, P.T. Daniel, J. Eberle, Disruption of the [35] M. Plo VDAC2-Bak interaction by Bcl-x(S) mediates efficient induction of apoptosis in melanoma cells, Cell. Death Differ. 19 (2012) 1928e1938. [36] E. Cheng, T.V. Sheiko, J.K. Fisher, W.J. Craigen, S.J. Korsmeyer, VDAC2 inhibits BAK activation and mitochondrial apoptosis, Science 301 (2003) 513e517. [37] X. Shen, T. Wang, D. Xu, L. Lu, Proteomic identification, characterization and expression analysis of Ctenopharyngodon idella VDAC1 upregulated by grass carp reovirus infection, Fish. Shellfish Immun. 37 (2014) 96e107. [38] K.C.H.-C. Wang, H. Kondo, I. Hirono, T. Aoki, The Marsupenaeus japonicus voltage-dependent anion channel (MjVDAC) protein is involved in white spot syndrome virus (WSSV) pathogenesis, Fish. Shellfish Immun. 29 (2010) 94e103. [39] H.-D. Xu, H.-J. Su, W.-B. Zou, S.-S. Liu, W.-R. Yan, Q.-Q. Wang, et al., Identification of mud crab reovirus VP12 and its interaction with the voltagedependent anion-selective channel protein of mud crab Scylla paramamosain, Fish. Shellfish Immun. 44 (2015) 224e231. zeth, S. Nylund, H. Henriksen, S. Patel, A.H. Nerland, A.M. Szilvay, RNA[40] K.B. Me dependent RNA polymerase from Atlantic halibut nodavirus contains two signals for localization to the mitochondria, Virus Res. 130 (2007) 43e52.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Grouper voltage-dependent anion selective channel protein 2 is required for nervous necrosis virus infection Jui-Shin Chang, Shau-Chi Chi* Department of Life Science, National Taiwan University, Taipei 10617, Taiwan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 April 2015 Received in revised form 13 May 2015 Accepted 28 May 2015 Available online 4 June 2015
Nervous necrosis virus (NNV) is a non-enveloped virus with 2 segmented positive-sense single-stranded RNAs. NNV-induced mass mortality has occurred worldwide in many species of cultured marine fish and resulted in substantial economic losses. In our previous study, we cloned the gene of voltage-dependent anion selective channel protein 2 (GVDAC2), and the NNV RNA2 expression level decreased in GVDAC2knockdown GF-1 cells 24 h after infection. Here, we investigated the role of GVDAC2 in the NNV infection in GF-1 cells. NNV infection did not considerably affect GVDAC2 gene expression. After performing immunostaining, we detected GVDAC2 at the mitochondria and GVDAC2 was colocalized with NNV-RNAdependent RNA polymerase. However, these 2 proteins did not interact with each other in immunoprecipitation assay. The cellular ATP level in GVDAC2-downregulated cells was lower than that in control cells, and NNV-induced apoptosis was delayed in GVDAC2-siRNA-transfected cells. Therefore, we suggest that GVDAC2 is required for NNV infection for maintaining the cellular ATP level and has positive impact on virus-induced apoptosis. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Grouper Nervous necrosis virus (NNV) Grouper voltage-dependent anion selective channel protein 2 (GVDAC2) Apoptosis
1. Introduction Viral nervous necrosis (VNN) disease, induced by the nervous necrosis virus (NNV), has caused mass mortality in many species of cultured marine fish [1,2]. The NNV genome comprises 2 segments of positive single-stranded RNAs, RNA1 and RNA2. RNA1 encodes RNA-dependent RNA polymerase (RdRp), and RNA2 encodes the structural capsid protein [3]. RNA3, a subgenome of RNA1, encodes B1 and B2 proteins [4]. The B1 protein participates in antinecrotic cell death by reducing the mitochondrial membrane potential (MMP) loss, and thus sustains cell viability [5]. The B2 protein binds to newly synthesized viral double-stranded RNA to prevent host RNA-interference mediated cleavage [6], and induces mitochondria-mediated cell death at late stage [7]. Apoptosis is a process of highly controlled programmed cell death [8]. It is initiated by an extrinsic or intrinsic pathway in mammals [9]. In the extrinsic pathway, a death ligand binds to a death receptor, such as the Fas complex or tumor necrosis receptor, and triggers the caspase-8 cascade to active the apoptotic pathway [10]. The intrinsic pathway is triggered by different extracellular or
* Corresponding author. E-mail address: [email protected] (S.-C. Chi). http://dx.doi.org/10.1016/j.fsi.2015.05.040 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
intracellular signals, such as oxidative stress and viral infection, resulting in the activation of the initiator caspase-9. Subsequently, caspase-9 activates caspase-3, which is responsible for degrading cellular substrates [11]. Mitochondrial membrane permeabilization precedes the signs of apoptotic and necrotic cell death [12]. Thus, the MMP loss is necessary for a caspase activation pathway, which depends on cytochrome c release from the mitochondria to cytosol [13]. Cytochrome c release is initiated by the interaction of the mitochondria with one or more Bcl-2 family members and other downstream proteins, such as Bax and Bak [14,15]. Voltagedependent anion selective channel protein (VDAC) is mainly located on the mitochondrial outer membrane [16]. VDAC has 3 isoforms: VDAC1, VDAC2, and VDAC3. In mammals, each isoform has 65%e70% identity with other isoforms [17,18]. VDAC can bind adenine nucleotide translocase (ANT), forming a hydrophilic pore, and regulate the Ca2þ and ATP permeability of the mitochondria [19e21]. In addition, VDAC is associated with cell apoptosis [22]. Proteins of many viruses, such as influenza virus, EpsteineBarr virus (EBV), and infectious bursal disease virus (IBDV), can regulate cell apoptosis through VDAC [23e25]. In groupers, 2 VDACs have been identified: GVDAC1 and GVDAC2. GVDAC1 was reported to induce apoptosis when overexpressed in fathead minnow cells and participates in antibacterial immune response [26]. GVDAC2 was initially identified in our previous study, and downregulation of
316
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
2. Materials and methods
and actin (Gactin235_RT_F/R). cDNA was added to the real-time PCR buffer, which included 0.5 mM forward and reverse primers in 1 iQ SYBR Green Supermix (Bio-Rad). Amplification was performed on an iCycler iQ real-time PCR detection system (Bio-Rad) with a PCR program of 94 C for 3 min, followed by 40 cycles of 94 C for 20 s, 55 C for 20 s, and 72 C for 20 s, and fluorescence detection was set at 85 C for 20 s. All samples were analyzed in triplicate. PCR product specificity was confirmed by conducting melting curve analysis, and relative gene expression levels were normalized with the actin expression level. The statistical significance was analyzed with Student's t test to determine differences between groups.
2.1. Virus, cells, and antibodies
2.4. Western blotting
The GF-1 cell line was derived from grouper (Epinephelus coioides) fin tissue [29] and cultured in Leibovitz's L-15 medium (Gibco) with 5% fetal bovine serum (FBS) (Gibco). NNV was isolated from grouper larvae with VNN disease [30]. NNV was proliferated in GF-1 cells with a multiplicity of infection (MOI) of 1, and infected cells were incubated in L-15 medium with 2% FBS at 28 C. After a complete cytopathic effect (CPE) was observed, the culture supernatant was collected through centrifugation at 12,000 g for 10 min and then titrated in GF-1 cells. The NNV RdRp and GVDAC2specific polyclonal antibodies were prepared as described in our previous studies [27,31].
We extracted total GF-1 proteins through sonication for 10 min by using a protein lysis buffer containing 50 mM TriseHCl (pH 8), 150 mM NaCl, 1 mM EDTA, 0.1% NP-40, 1 mM DTT, and 1 protease inhibitor (Roche). The total protein lysate was centrifuged at 10,000 g at 4 C for 10 min, the concentration was adjusted to 10 mg per well for 10% SDS-PAGE, and the proteins were transferred to a PVDF membrane. The membrane was blocked with 5% skim milk in a TBST buffer (50 mM TriseHCl, 150 mM NaCl, 0.1% Tween20, pH 7.5) for 1 h at room temperature and then incubated with 1:1000-diluted rabbit antiserum against GVDAC2 for 1 h at room temperature. After extensive washing, the antigen signal was developed using the ECL Select™ Western Blotting Detection Reagent (GE Healthcare) and visualized through autoradiography. Protein intensities were analyzed using ImageJ software [32].
GVDAC2 reduced NNV RNA replication [27]. However, the underlying mechanism of GVDAC2 siRNA-induced reduction of NNV RNA synthesis remains unclear. NNV infection can induce apoptosis and post-apoptotic necrotic cell death through MMP loss and cytochrome c release. A study suggested that apoptosis promotes the release of newly synthesized viral particles from host cells [28]. Here, we investigated the role of GVDAC2 in NNV replication by downregulation through siRNA, and then analyzed ATP levels and NNV-induced apoptosis during infection.
2.2. GVDAC2 RNA knockdown GVDAC2 short-interfering RNAs of GVDAC2 (GVDAC2-siRNAs) and negative control nonsilencing siRNA (NS-siRNA) were prepared in our previous study [27]. Table 1 shows the siRNA sequences. These siRNAs were transfected into GF-1 cells by using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. GF-1 cells were separately transfected with GVDAC2-siRNA or NS-siRNA for 24 h and then infected with NNV (MOI ¼ 10). After 24 or 48 h of NNV infection, total cellular RNA was extracted for realtime reverse transcription (RT)-PCR analysis of the target genes, and GVDAC2 protein levels were analyzed through Western blotting (WB). The virions extracted from both sets of NNV-infected cells at 24 or 48 h post infection (hpi) were frozen and thawed for 3 times and then titrated.
2.5. Immunoprecipitation assay GF-1 cells were infected with NNV (MOI ¼ 100) for 72 h, and total proteins were harvested using a protein lysis buffer. Proteins extracted from non-infected GF-1 cells were used as the control. Immunoprecipitation (IP) and WB assays were conducted using an ImmunoCruz IP/WB optima F system (Santa Cruz) according to the manufacturer's instructions. The possible GVDAC2 and NNV RdRp protein complex was immunoprecipitated using rabbit antiserum against GVDAC2 and then analyzed through WB by using rabbit antiserum against NNV RdRp. The rabbit pre-immune antiserum was used in as negative control. 2.6. Immunofluorescence staining
2.3. Real-time RT-PCR Total RNAs from siRNA-transfected cells at different time points of NNV infection were extracted and reverse transcribed into cDNA by using dT20 and NNVR3 primers. The expression levels of GVDAC2, NNV RNA2, and actin (internal control) were assayed using real-time PCR. Table 1 lists the sequences of the primer sets for GVDAC2 (GVDAC2_RT229_F/R), NNV RNA2 (NNVRNA2_RT_F/R),
Table 1 Primers and siRNAs used in this study. Primer name
Sequence (50 e30 )
NNVR3 GVDAC2_RT229_F GVDAC2_RT229_R Gactin235_RT_F Gactin235_RT_R NNVRNA2_RT_F NNVRNA2_RT_R GVDAC2-siRNA Non-silencing control siRNA
CGAGTCAACACGGGTGAAGA AAACTGGCGCAGAACAACTT TGTTCACTTTGGCAGACAGC GGCCGCGACCTCACAGACTACCTC CCTCTGGGCAACGGAACCTCTCAT CAGTCCGACCTCAGTACAC AACACTCCAGCGACACAG r(GAAGUGGAACACUGACAAC)dTdT r(UUCUUCGAACGUGUCACGU)dTdT
GF-1 cells, preseeded on cover glasses, were stained with MitoTracker® Mitochondrion-Selective Probes (Invitrogen) for 15 min and then fixed with 10% formalin in phosphate-buffered saline (PBS) for 10 min at room temperature. The fixed cells were treated with 0.5% Triton X-100 (Sigma) in PBS for membrane permeabilization. After 3 washes with PBS, the cells were incubated with a blocking buffer (5% BSA in PBS) for 1 h at room temperature and then reacted with 1:200-diluted rabbit anti-GVDAC2 for 1 h. After washing, the cells were incubated with fluorescein isothiocyanate (FITC)-labeled anti rabbit antiserum for 1 h. Cell nuclei were stained with Hoechst 33258 (1:500 diluted in PBS) for 30 min. Finally, the cells were observed and the images were captured using a fluorescence microscope (Olympus IX70). To investigate the colocalization of GVDAC2 with the NNV RdRp protein in GF-1 cells, the cells were infected with NNV (MOI ¼ 100) for 72 h. After 3 washes with PBS, the cells were incubated with rabbit anti-GVDAC2 antibodies. The cells were washed 3 times with PBS and separately immunostained with FITC-labeled anti-rabbit antibodies. The NNV RdRp protein was detected using a rhodamine-labeled rabbit antibody against the NNV RdRp protein.
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
317
Fig. 1. Real-time PCR analysis of (A) GVDAC2 and (B) NNV RNA2 gene expression levels during NNV infection. GF-1 cells were infected with NNV (MOI ¼ 10) and then collected at 24, 48, and 72 hpi. GVDAC2 gene expression level in non-infected cells was regarded as 1 in (A). NNV RNA2 expression level in the cells at 24 hpi was regarded as 1 in (B). Error bars indicate standard deviations.
2.7. Cellular ATP level measurement The ATP level was measured by conducting a luciferin-luciferase reaction using the ApoSENSOR™ Cell Viability Assay Kit (BioVision). Briefly, 5.5 103 GF-1 cells were seeded in an opaque 96well plate. The cells were separately transfected with GVDAC2siRNA or NS-siRNA for 24 h and then infected with NNV for another 24 h. The cells were collected and assayed according to the manufacturer's instructions. The luminescence of a 100 ml lysate was measured immediately by using a luminometer plate reader (FlexStation 3; Molecular Devices, USA). The statistical significance was analyzed with unpaired Student's t test to determine differences between groups. The statistical significance was analyzed with Student's t test to determine differences between groups.
2.8. Apoptosis analysis The percentage of cells undergoing apoptosis was determined through flow cytometry by using the FITC Annexin V Apoptosis Detection Kit I (BD Pharmingen™) according to the manufacturer's instructions. GF-1 cells were infected with NNV (MOI ¼ 10) for 24, 48, or 72 h. Approximately 1 105 GF-1 cells were harvested and resuspended in a binding buffer and were mixed with annexin VFITC and propidium iodide (PI). After incubation for 15 min in the dark, a flow cytometer (FACSCanto II; BD, USA) was used to analyze
cellular apoptosis. For detecting apoptosis in GVDAC2-knockdown cells, GF-1 cells were transfected with GVDAC2-siRNA or NS-siRNA for 24 h and then infected with NNV (MOI ¼ 10) for an additional 24 or 48 h. The cells were collected for cellular apoptosis analysis. 3. Results 3.1. NNV infection did not considerably affect GVDAC2 gene expression To analyze the effect of NNV infection on GVDAC2 gene expression, NNV-infected GF-1 cells were collected at 24, 48, and 72 hpi, and the GVDAC2 gene expression level was detected through real time RT-PCR. Compared with non-infected cells, the GVDAC2 gene expression level in NNV-infected cells did not vary considerably over 72 h (Fig. 1A). The NNV RNA2 expression level was detected at the same time points as those for the experimental control and considerably increased at 72 hpi (Fig. 1B). 3.2. GVDAC2-knockdown reduced NNV RNA2 levels and titers in GF-1 cells In our previous study, we knocked down 70% of the GVDAC2 gene expression level at 24 h post transfection (hpt) by using a
Fig. 2. The siRNA downregulation of GVDAC2 protein expression. GF-1 cells were transfected with GVDAC2-specific siRNA for downregulation, and nonsilencing siRNA (NS-siRNA) was used as a negative control. (A) GVDAC2 protein expression levels were determined through WB at 24 and 48 h post transfection. (B) The intensity of the GVDAC2 protein was analyzed using ImageJ software and normalized with the loading control (actin). The GVDAC2 protein level in theNS-siRNA knockdown (negative control) was considered 1.
318
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
Fig. 3. NNV RNA expression levels and titers in GVDAC2-knockdown GF-1 cells. After GVDAC2-siRNA transfection, GF-1 cells were infected with NNV (MOI ¼ 10), and NNV RNA2 expression levels at 24 hpi (A) and viral titers at 24 and 48 hpi (B) were examined. The level in the negative control was regarded as 1. Error bars indicate standard deviations. **, P < 0.01 (n ¼ 3).
specific siRNA [27]. In the present study, the GVDAC2 protein level after GVDAC2-siRNA transfection was examined. Compared with NS-siRNA-transfected cells, the GVDAC2 protein expression level in GVDAC2-siRNA-transfected cells decreased to 92% and 74% at 24 hpt and 48 hpt, respectively (Fig. 2). The cells at 24 hpt were further infected with NNV for an additional 24 h, and the relative NNV RNA2 gene expression level decreased by 40% in GVDAC2-knockdown cells (Fig. 3A). NNV titers in GVDAC2-knockdown cells were 1.3 103 tissue culture infective dose (TCID50) ml1 and 1.5 105 TCID50 ml1 at 24 hpi and 48 hpi,
respectively (Fig. 3B). Both titers were lower than those of NSsiRNA-knockdown cells, particularly at 48 hpi. 3.3. GVDAC2 located at mitochondria and colocalized with NNV RdRp VDAC is reported to locate on mitochondrial outer membrane [16,33]. To confirm the location of the GVDAC2 protein, we labeled the mitochondria with MitoTracker® and then immunostained the mitochondria with GVDAC2-specific antibodies. A colocalizing
Fig. 4. Localization of GVDAC2, mitochondria and NNV according to immunofluorescence staining. (A) GF-1 cells were infected with NNV (MOI ¼ 10) for 72 h (bottom panel). Noninfectied GF-1 cells (top) were used as control cells. The cells were stained with MitoTracker® and anti-GVDAC2 antibodies. (B) NNV-infected GF-1 cells were immunostained with anti-GVDAC2 and anti-NNV RdRp antibodies. Cell nuclei were stained with Hoechst 33258. Samples were observed under a fluorescence microscope.
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
319
Fig. 5. Immunoprecipitation of GVDAC2 with NNV RdRp. (A) The cell lysates from NNV-infected at 72 hpi and non-infected GF-1 cells were used as input for an IP assay. (B) WB of proteins immunoprecipitated by a rabbit antibody against GVDAC2. (C) WB of proteins immunoprecipitated by a pre-immune rabbit antiserum as negative control.
signal (yellow) of the mitochondria and GVDAC2 was observed, and GVDAC2 remained on the mitochondria after NNV infection (Fig. 4A). To determine whether GVDAC2 could colocalize with NNV RdRp, GF-1 cells were infected with NNV (MOI ¼ 100) for 72 h and then immunostained with specific antibodies separately against NNV RdRp and GVDAC2. The specific colocalizing signal (yellow) of NNV RdRp and GVDAC2 was observed (Fig. 4B). 3.4. GVDAC2 did not immunoprecipitate with NNV RdRp Because NNV RdRp colocalized with GVDAC2 during NNV infection, we further analyzed the interaction between these 2 proteins by performing an IP assay. The result revealed that GVDAC2 did not interact with NNV RdRp (Fig. 5B). 3.5. Cellular ATP level decreased in GVDAC2-knockdown GF-1 cells We demonstrated that the NNV RNA2 expression significantly decreased at 24 hpi in the GVDAC2-knockdown cells (Fig. 3A). Because NNV RNA synthesis requires ATP and nucleic acids from host cells, and VDAC participates in ATP transportation through the mitochondria [21]. Therefore, we examined ATP levels in GVDAC2knockdown cells and NNV-infected cells. The results are shown in Fig. 6. The ATP level in the cells without GVDAC2-knockdown was considered 1, and the ATP level significantly decreased to 0.6 in GVDAC2-knockdown cells. At 24 h after NNV infection, the ATP
level in the cells without GVADAC2 knockdown significantly decreased to 0.49, and that in GVDAC2-knockdown cells decreased to 0.54. 3.6. GVDAC2-knockdown delayed NNV-induced apoptosis in GF-1 cells NNV induces apoptosis in host cells [34], and VDAC protein has been reported to mediate apoptosis in mammalian cells [35,36]. We thus examined the apoptosis by using FITC-annexin V and PI staining. Propidium iodide (PI) is a membrane impermeant dye that is generally excluded from viable cells, and FITC-annexin V is used to detect apoptotic cells. The early apoptotic cells were PI negative and FITC-annexin V positive. The cells at late apoptosis were both PI and FITC-annexin V positive. Necrotic cells were PI positive and FITC-annexin V negative. The annexin V-positive signal was evident at 24 hpi, and the PI-positive signal was highly expressed by the cells from 48 to 72 hpi (Fig. 7A). The percentage of apoptotic and necrotic cells was analyzed through flow cytometry. The ratio of early apoptosis (Q4) increased from 24 to 72 hpi, and late apoptotic (Q2) and necrotic (Q1) cells mainly appeared at 72 hpi (Fig. 7B). Because early apoptosis began occurring 24 h after NNV infection and the ratios of early apoptotic could be clearly differentiated between 24 and 48 hpi, we thus analyzed the early apoptosis in GVDAC2-knockdown GF-1 cells at 24 and 48 h after NNV infection. To evaluate the effect of GVDAC2 on NNV-induced cellular apoptosis, we examined the ratio of apoptotic cells in GVDAC2knockdown GF-1 cells. The ratio of early apoptotic cells (Q4) was 8.7% at 24 hpi and increased to 11.8% at 48 hpi in NS-siRNAtransfected cells (Fig. 8). However, the ratios of apoptotic cells in GVDAC2-knockdown cells were 4.9% at 24 hpi and 6.5% at 48 hpi, respectively; these ratios were much lower than those in the NSsiRNA-transfected cells at the same time periods. Moreover, the ratio of early apoptotic GVDAC2-knockdown cells at 48 hpi (6.5%) was much lower than that of early apoptotic NS-siRNA-transfected cells at 24 hpi (8.7%), indicating that the NNV-induced progression of apoptosis was delayed in GVDAC2-knockdown cells. 4. Discussion
Fig. 6. Cellular ATP levels in GVDAC2-knockdown cells and NNV-infected cells. GF-1 cells were transfected with GVDAC2-siRNA for 24 h and then infected with NNV (MOI ¼ 10) for additional 24 h. Mock-infected cells were analyzed at 48 hpt. The ATP level in the NS-siRNA transfected cells was considered 1. Error bars indicate standard deviations. *, P < 0.05 (n ¼ 3).
In our previous study, we cloned and identified GVDAC2 from GF-1 cells. NNV RNA2 expression significantly decreased after 24 h of NNV infection in GVDAC2-knockdown cells; however, the IP assay results revealed that GVDAC2 did not interact with the NNV capsid protein [27]. In the present study, we further investigated the role of GVDAC2 during NNV infection. Grass carp reovirus (GCRV), white spot syndrome virus (WSSV), EBV, and mud crab reovirus (MCRV) are reported to enhance the expression of VDAC gene in certain cell lines or organisms [24,37e39]. However, the GVDAC2 gene expression level did not significantly increase after NNV infection. We transfected GF-1 cells
320
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
Fig. 7. Progression of NNV-induced apoptosis in GF-1 cells. GF-1 cells were infected with NNV (MOI ¼ 10) and collected at 24, 48, and 72 hpi. The apoptotic cells were stained with FITC-annexin V and PI. Fluorescence signals were observed through (A) fluorescence microscopy and (B) flow cytometry. Annexin V (X-axes) and PI (Y-axes) signals were measured from 10,000 cells. The percentage of cells at Q1Q4 in the subpopulations is shown. Q1, necrotic cells (annexin V/PIþ); Q2, late apoptotic cells (annexin Vþ/PIþ); Q3, viable cells (annexin V/PI); and Q4, early apoptotic cells (annexin Vþ/PI).
with a specific siRNA to downregulate the cellular GVDAC2 and observed that the NNV RNA2 expression level significantly decreased at 24 hpi, and the viral titer was significantly downregulated at 48 hpi, indicating that GVDAC2 is essential for NNV replication. NNV RdRp is located on the mitochondrial outer membrane during viral genome replication [40]. Through immunostaining, we
confirmed that GVDAC2 is also located at the mitochondria and colocalized with NNV RdRp. We assumed that if GVDAC2 is beneficial to the enzyme function of NNV RdRp function, both proteins might interact with each other. However, the IP assay result rejected our assumption. On the other hand, NNV RNA synthesis requires host resources, including energy (ATP) and nucleic acids, and VDAC is essential in ATP transportation between the
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
321
Fig. 8. Progression of NNV-induced apoptosis in GVDAC2-knockdown GF-1 cells. GF-1 cells were transfected with GVDAC2-siRNA for 24 h and then infected with NNV (MOI ¼ 10). The cells were collected at 24 and 48 hpi, and the PI/FITC-annexin V dual-staining fluorescence signal was measured from 10,000 cells. The percentage in Q1, Q2 and Q4 indicates the ratio of cells at necrotic, late apoptotic, and early apoptotic stages, respectively. The percentage in Q3 represented the ratio of cells neither apoptosis nor necrosis.
mitochondria and cytosol [21]. Thus, the decrease in the NNV RNA2 level in GVDAC2-knockdown cells might result from the defect of ATP transportation. We demonstrated that the ATP level in GVDAC2-siRNA-transfected cells was only 60% of that in NS-siRNAtransfected cells, indicating that GVDAC2 downregulation significantly reduced the ATP level in host cells. In addition, the ATP level in NNV-infected cells at 24 hpi was significantly lower than that in non-infected cells, confirming that the early stage of NNV replication rapidly depleted host ATP. Therefore, the low expression level of NNV RNA2 detected at 24 hpi in GVDAC2-knowdown cells was possibly caused by the low level of ATP attributable to GVDAC2siRNA transfection. Another major function of VDAC is the regulation of cellular apoptosis [35]. Because NNV induces apoptosis during infection, we examined whether GVDAC2 participates in the NNV-induced apoptosis. During NNV infection, the ratio of early apoptotic cells (Q4) constantly increased from 24 to 48 hpi in NS-siRNA- and GVDAC2-siRNA-transfected cells (Fig. 8). However, the ratio of early apoptotic cells (Q4) in GVDAC2-knockdown cells (4.9% at 24 hpi and 6.5% at 48 hpi) was much lower than that in NS-siRNA-transfected cells (8.7% at 24 hpi and 11.8% at 48 hpi), indicating that GVDAC2 downregulation reduced the percentage of early apoptotic cells from 24 to 48 hpi; in other words, it delayed apoptosis progression. Because apoptosis and the following necrosis are associated with the release of progeny virions, delayed progression of early apoptosis may result in a lower NNV titer observed at 48 hpi in GVDAC2-siRNA-transfected cells than that in NS-siRNA-transfected cells. In summary, this is the first study to identify the roles of the grouper VDAC2 protein during NNV infection, including
maintaining the transport of sufficient ATP for NNV RNA synthesis and the progression of NNV-induced apoptosis in host cells. Acknowledgment We appreciate the technical assistance and support provided by the Technology Commons, College of Life Science, National Taiwan University, with regard to luminometer plate reader, flow cytometry, and real-time PCR. The work was partially supported by the Ministry of Science and Technology Taiwan under contract no. MOST 103-2313-B-002-046. References [1] S. Chi, J. Shieh, S. Lin, Genetic and antigenic analysis of betanodaviruses isolated from aquatic organisms in Taiwan, Dis. Aquat. Org. 55 (2003) 221e228. [2] B. Munday, J. Kwang, N. Moody, Betanodavirus infections of teleost fish: a review, J. Fish. Dis. 25 (2002) 127e142. [3] K. Mori, T. Nakai, K. Muroga, M. Arimoto, K. Mushiake, I. Furusawa, Properties of a new virus belonging to nodaviridae found in larval striped jack (Pseudocaranx dentex) with nervous necrosis, Virology 187 (1992) 368e371. [4] I. Sommerset, A.H. Nerland, Complete sequence of RNA1 and subgenomic RNA3 of Atlantic halibut nodavirus (AHNV), Dis. Aquat. Org. 58 (2004) 117e125. [5] L.-J. Chen, Y.-C. Su, J.-R. Hong, Betanodavirus non-structural protein B1: A novel anti-necrotic death factor that modulates cell death in early replication cycle in fish cells, Virology 385 (2009) 444e454. [6] B.J. Fenner, R. Thiagarajan, H.K. Chua, J. Kwang, Betanodavirus B2 is an RNA interference antagonist that facilitates intracellular viral RNA accumulation, J. Virol. 80 (2006) 85e94. [7] Y.C. Su, H.W. Chiu, J.C. Hung, J.R. Hong, Beta-nodavirus B2 protein induces hydrogen peroxide production, leading to Drp1-recruited mitochondrial fragmentation and cell death via mitochondrial targeting, Apoptosis 19 (2014)
322
J.-S. Chang, S.-C. Chi / Fish & Shellfish Immunology 46 (2015) 315e322
1457e1470. [8] M. Chawla-Sarkar, D.J. Lindner, Y.F. Liu, B. Williams, G.C. Sen, R.H. Silverman, et al., Apoptosis and interferons: role of interferon-stimulated genes as mediators of apoptosis, Apoptosis 8 (2003) 237e249. [9] N.N. Danial, S.J. Korsmeyer, Cell death: critical control points, Cell 116 (2004) 205e219. [10] H. Wajant, The fas signaling pathway: more than a paradigm, Science 296 (2002) 1635e1636. [11] D.L. Allen, J.K. Linderman, R.R. Roy, A.J. Bigbee, R.E. Grindeland, V. Mukku, et al., Apoptosis: a mechanism contributing to remodeling of skeletal muscle in response to hindlimb unweighting, Am. J. Physiol. 273 (1997) C579eC587. czky, Rapid [12] M. Madesh, B. Antonsson, S.M. Srinivasula, E.S. Alnemri, G. Hajno kinetics of tBid-induced cytochrome c and Smac/DIABLO release and mitochondrial depolarization, J. Biol. Chem. 277 (2002) 5651e5659. [13] K.F. Ferri, G. Kroemer, Organelle-specific initiation of cell death pathways, Nat. Cell. Biol. 3 (2001) 255e263. [14] S.N. Farrow, R. Brown, New members of the Bcl-2 family and their protein partners, Curr. Opin. Genet. Dev. 6 (1996) 45e49. [15] S. Ma, C. Hockings, K. Anwari, T. Kratina, S. Fennell, M. Lazarou, et al., Assembly of the Bak Apoptotic Pore: a critical role for the bak protein 6 helix in the multimerization of homodimers during apoptosis, J. Biol. Chem. 288 (2013) 26027e26038. [16] B.W. Hoogenboom, K. Suda, A. Engel, D. Fotiadis, The supramolecular assemblies of voltage-dependent anion channels in the native membrane, J. Mol. Biol. 370 (2007) 246e255. [17] Mde C. Cesar, J.E. Wilson, All three isoforms of the voltage-dependent anion channel (VDAC1, VDAC2, and VDAC3) are present in mitochondria from bovine, rabbit, and rat brain, Arch. Biochem. Biophys. 422 (2004) 191e196. [18] A. Messina, S. Reina, F. Guarino, V. De Pinto, VDAC isoforms in mammals, Biochim. Biophys. Acta 2012 (1818) 1466e1476. [19] D. Gincel, H. Zaid, V. Shoshan-Barmatz, Calcium binding and translocation by the voltage-dependent anion channel: a possible regulatory mechanism in mitochondrial function, Biochem. J. 358 (2001) 147e155. [20] W.T. Regenold, M. Pratt, S. Nekkalapu, P.S. Shapiro, T. Kristian, G. Fiskum, Mitochondrial detachment of hexokinase 1 in mood and psychotic disorders: implications for brain energy metabolism and neurotrophic signaling, J. Psychiatr. Res. 46 (2012) 95e104. [21] T.K. Rostovtseva, S.M. Bezrukov, ATP transport through a single mitochondrial channel, VDAC, studied by current fluctuation analysis, Biophys. J. 74 (1998) 2365e2373. [22] T.K. Rostovtseva, W. Tan, M. Colombini, On the role of VDAC in apoptosis: fact and fiction, J. Bioenerg. Biomembr. 37 (2005) 129e142. [23] D. Zamarin, A. García-Sastre, X. Xiao, R. Wang, P. Palese, Influenza virus PB1F2 protein induces cell death through mitochondrial ANT3 and VDAC1, PLoS Pathog. 1 (2005) e4. [24] X. Feng, C.B. Ching, W.N. Chen, EBV up-regulates cytochrome c through VDAC1 regulations and decreases the release of cytoplasmic Ca2þ in the NPC cell line, Cell. Biol. Int. 36 (2012) 733e738.
[25] Z. Li, Y. Wang, Y. Xue, X. Li, H. Cao, S.J. Zheng, Critical role for voltagedependent anion channel 2 in infectious bursal disease virus-induced apoptosis in host cells via interaction with VP5, J. Virol. 86 (2012) 1328e1338. [26] Y. Shi, Z. Zhao, X. Hong, K. Chen, X. Zhu, Characterization and functional analysis of voltage-dependent anion channel 1 (VDAC1) from orange-spotted grouper (Epinephelus coioides), J. Biochem. Mol. Toxicol. 28 (2014) 292e301. [27] J.-S. Chang, S.-C. Chi, GHSC70 is involved in the cellular entry of nervous necrosis virus, J. Virol. 89 (2015) 61e70. [28] S.-P. Chen, H.-L. Yang, G.M. Her, H.-Y. Lin, M.-F. Jeng, J.-L. Wu, et al., Betanodavirus induces phosphatidylserine exposure and loss of mitochondrial membrane potential in secondary necrotic cells, both of which are blocked by bongkrekic acid, Virology 347 (2006) 379e391. [29] S. Chi, W. Hu, B. Lo, Establishment and characterization of a continuous cell line (GF-1) derived from grouper, Epinephelus coioides (Hamilton): a cell line susceptible to grouper nervous necrosis virus (GNNV), J. Fish. Dis. 22 (1999) 173e182. [30] S. Chi, B. Lo, S. Lin, Characterization of grouper nervous necrosis virus (GNNV), J. Fish. Dis. 24 (2001) 3e13. [31] Y.-C. Wu, Y.-F. Lu, S.-C. Chi, Anti-viral mechanism of barramundi Mx against betanodavirus involves the inhibition of viral RNA synthesis through the interference of RdRp, Fish. Shellfish Immun. 28 (2010) 467e475. [32] C.A. Schneider, W.S. Rasband, K.W. Eliceiri, NIH Image to ImageJ: 25 years of image analysis, Nat. Methods 9 (2012) 671e675. [33] M. Colombini, VDAC: the channel at the interface between mitochondria and the cytosol, Mol. Cell. Biochem. 256 (2004) 107e115. [34] H.-C. Wu, J.-L. Wu, H.-L. Chu, Y.-C. Su, J.-R. Hong, RGNNV induces mitochondria-mediated cell death via newly synthesized protein dependent pathway in fish cells, Fish. Shellfish Immun. 29 (2010) 451e463. €tz, B. Gillissen, A.M. Hossini, P.T. Daniel, J. Eberle, Disruption of the [35] M. Plo VDAC2-Bak interaction by Bcl-x(S) mediates efficient induction of apoptosis in melanoma cells, Cell. Death Differ. 19 (2012) 1928e1938. [36] E. Cheng, T.V. Sheiko, J.K. Fisher, W.J. Craigen, S.J. Korsmeyer, VDAC2 inhibits BAK activation and mitochondrial apoptosis, Science 301 (2003) 513e517. [37] X. Shen, T. Wang, D. Xu, L. Lu, Proteomic identification, characterization and expression analysis of Ctenopharyngodon idella VDAC1 upregulated by grass carp reovirus infection, Fish. Shellfish Immun. 37 (2014) 96e107. [38] K.C.H.-C. Wang, H. Kondo, I. Hirono, T. Aoki, The Marsupenaeus japonicus voltage-dependent anion channel (MjVDAC) protein is involved in white spot syndrome virus (WSSV) pathogenesis, Fish. Shellfish Immun. 29 (2010) 94e103. [39] H.-D. Xu, H.-J. Su, W.-B. Zou, S.-S. Liu, W.-R. Yan, Q.-Q. Wang, et al., Identification of mud crab reovirus VP12 and its interaction with the voltagedependent anion-selective channel protein of mud crab Scylla paramamosain, Fish. Shellfish Immun. 44 (2015) 224e231. zeth, S. Nylund, H. Henriksen, S. Patel, A.H. Nerland, A.M. Szilvay, RNA[40] K.B. Me dependent RNA polymerase from Atlantic halibut nodavirus contains two signals for localization to the mitochondria, Virus Res. 130 (2007) 43e52.
