Arch Virol DOI 10.1007/s00705-013-1955-5
ORIGINAL ARTICLE
Identification of a linear epitope on the haemagglutinin protein of pandemic A/H1N1 2009 influenza virus using monoclonal antibodies Yan Chen • Jian Zhang • Chuanling Qiao • Jingfei Wang • Huanliang Yang • Hualan Chen
Received: 25 October 2013 / Accepted: 16 November 2013 Ó Springer-Verlag Wien 2013
Abstract A novel influenza A/H1N1 virus, emerging from Mexico and the United States in the spring of 2009, caused the pandemic human infection of 2009-2010. The haemagglutinin (HA) glycoprotein is the major surface antigen of influenza A virus and plays an important role in viral infection. In this study, three hybridoma cell lines secreting specific monoclonal antibodies (Mabs) against the HA protein of pandemic influenza A/H1N1 2009 virus were generated with the recombinant plasmid pCAGGSHA as an immunogen. Using Pepscan analysis, the binding sites of these Mabs were identified in a linear region of the HA protein. Further, refined mapping was conducted using truncated peptides expressed as GST-fusion proteins in E. coli. We found that the 250VPRYA254 motif was the minimal determinant of the linear epitope that could be recognized by the Mabs. Alignment with sequences from the databases showed that the amino acid residues of this epitope were highly conserved among all pandemic A/H1N1 2009 viruses as well as the classical swine H1N1 viruses isolated to date. These results provide additional insights into the antigenic structure of the HA protein and virus-antibody interactions at the amino acid level, which
Y. Chen and J. Zhang contributed equally to this work. Y. Chen J. Zhang C. Qiao (&) J. Wang H. Yang H. Chen (&) Animal Influenza Laboratory of the Ministry of Agriculture, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, 427 Maduan Street, Harbin 150001, People’s Republic of China e-mail: [email protected] H. Chen e-mail: [email protected]
may assist in the development of specific diagnostic methods for influenza viruses.
Introduction In the spring of 2009, a novel pandemic influenza A H1N1 virus emerged in the human population in Mexico and the United States, then quickly spread worldwide [1, 2]. Eight gene segments of this novel virus were acquired through successive reassortments that involved North American classical swine lineage H1N1, avian influenza virus, a genetic lineage from Eurasian swine, and the triple reassortant viruses [3–5]. The pandemic A/H1N1 2009 viruses have been repeatedly isolated from pigs in many countries [6–8], and some reassortments between pandemic A/H1N1 2009 virus and pre-existing swine influenza viruses have occurred in the swine population in others [9, 10]. However, the antigenic structure and characterization of the pandemic A/H1N1 virus has not been clearly demonstrated until now. The major factor responsible for influenza A virus infectivity is the haemagglutinin (HA) surface protein, which mediates binding of the virus to the host-specific cell-surface receptor, 2,3-sialic acid (SA) in birds and 2,6SA in mammals [11]. Thus, HA is the prime target for the development of new diagnostic, therapeutic and preventive tools, and it is essential to gain further understanding of the antigenic characteristics of HA in order to develop specific diagnostic tools and vaccines to combat influenza viruses. Previous studies have provided evidence of the existence of both HA-subtype-specific and inter-subtype-conserved epitopes [12–14]. In this study, we generated three Mabs against the HA protein of the pandemic A/H1N1 2009 virus. A linear
123
Y. Chen et al.
epitope corresponding to the HA amino acids 250 VPRYA254 was recognized by the Mabs in Pepscan analysis. This sequence is well conserved among all of the pandemic A/H1N1 2009 viruses as well as the classical swine H1N1 viruses isolated to date.
Materials and methods Viruses and cells A/swine/Heilongjiang/44/2009 (H1N1) (SW/HLJ/44/09) [15] was isolated from pigs in China during the outbreak of the 2009 influenza pandemic. Phylogenetic analysis of this virus demonstrated that the genome was more than 99 % homologous to the 2009 A/H1N1 influenza virus that causes illness in humans around the world.The virus was propagated in 10-day-old embryonated chicken eggs and purified by centrifuging in a discontinuous 20 %, 40 %, 60 % (w/w) sucrose solution. The myeloma cell line SP2/0 and 293T cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10 % fetal bovine serum. Eukaryotic expression of HA protein A full-length cDNA fragment corresponding to the SW/ HLJ/44/09 HA gene was amplified using a pair of primers (forward primer, AGCGAATTCAAGAAGGCAATACTA GTAG; reverse primer, TGCCTCGAGAATCCTAATG TTAAATACAT) and then inserted into the eukaryotic expression vector pCAGGS (kindly provided by Prof. Zhigao Bu, Harbin Veterinary Research Institute) to express the entire HA protein. The resulting recombinant plasmid (designated as pCAGGS-HA) was introduced by transfection into 293T cells using Lipofectamine 2000 according to the manufacturer’s instructions. The in vitro expression of the HA protein was verified by immunofluorescence assay (IFA) 48 hours post-transfection using chicken polyclonal serum against SW/HLJ/44/09 as the primary antibody and FITC-conjugated goat anti-chicken IgG as the secondary antibody. Generation and characterization of Mabs against the HA protein Female BALB/c mice (aged 4-6 weeks) were immunized intramuscularly with pCAGGS-HA at 100 lg per mouse. Two booster injections of the same dose as the first immunization were given at three-week intervals. Five days after the final inoculation, spleen cells were harvested to prepare cell suspensions, followed by fusion with SP2/0 cells as
123
described previously by Kohler and Milstein [16]. The fused hybridoma cells were screened by indirect enzyme-linked immunosorbent serologic assay (ELISA) as described previously [17] using the purified SW/HLJ/44/09 virus as the coating antigen. The positive hybridoma clones were selected for subcloning by limiting dilution using the same screening methods as described above. To further evaluate the reactivity of the resultant Mabs, neutralization test (NT) and hemagglutination inhibition (HI) assay were also performed as described previously (http://www.oie.int/filead min/Home/eng/Health_standards/tahm/2.08.08_SWINE_ INFLUENZA.pdf). Ascites fluids containing the Mabs of interest were produced in pristine-primed BALB/c mice. The isotypes of the Mabs were characterized using an SBA Clonotyping System/horseradish peroxidase (HRP)-based ELISA. All animal experiments were conducted in biosafety level 2 (BSL-2) facilities and approved by the Chinese Ministry of Agriculture and the Review Board of Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences. Epitope mapping with overlapping HA protein peptide fragments For epitope mapping of pandemic A/H1N1 HA, the whole HA gene fragment was divided into 37 overlapping segments for expression (designated as HAH1-HAH37), with each peptide containing 16 amino acids, and with 8 eight amino acids overlapping with to the next peptide. To express these polypeptides, we synthesized complementary oligonucleotide pairs encoding each peptide, annealed and cloned them into the BamHI and XhoI sites of the pGEX6p-1 expression vector, and introduced them into E. coli BL21 (DE3) cells by transformation. The GST fusion proteins were subjected to 12 % SDS-PAGE and then transferred to 0.22-lm nitrocellulose membranes for western blotting. After blocking, the membranes were incubated with the Mabs of interest at 37 °C for 60 min. After washing three times with PBS containing 0.5 % Tween-20 (PBST), the membranes were inoculated with HRP-conjugated goat anti-mouse IgG at 37 °C for 60 min and visualized using diaminobenzidine (DAB) substrate. Precise localization of epitopes on the HA protein In order to determine the minimal antigenic epitopes, the reactive polypeptides identified in ‘‘Materials and methods’’ were truncated by one residue at their C-terminus and at the same time extended by one residue at their N-terminus (Table 1) until the smallest binding domain recognized by the Mabs was identified as described.
Linear epitope of pandemic A/H1N1 2009 influenza virus Table 1 Oligonucleotides encoding truncated peptide sequences for epitope mapping Position
Peptide sequence
Sequence of complementary oligonucleotides
251-258
PRYAFAMM
AATTCccgagatatgcattcgcaatggaaTAGC
250-257
VPRYAFAM
249-256
VVPRYAFA
TCGAGCTAttccattgcgaatgcatatctcggG AATTCgtaccgagatatgcattcgcaatgTAGC TCGAGCTAcattgcgaatgcatatctcggtacG AATTCgtagtaccgagatatgcattcgcaTAGC TCGAGCTAtgcgaatgcatatctcggtactacG 248-255
LVVPRYAF
AATTCctagtagtaccgagatatgcattcTAGC
247-254
NLVVPRYA
AATTCaatctagtagtaccgagatatgcaTAGC
246-253
GNLVVPRY
AATTCggaaatctagtagtaccgagatatTAGC
245-252
TGNLVVPR
AATTCactggaaatctagtagtaccgagaTAGC
TCGAGCTAgaatgcatatctcggtactactagG TCGAGCTAtgcatatctcggtactactagattG TCGAGCTAatatctcggtacctactagatttccG TCGAGCTAtctcggtactactagatttccagtG
Homology analysis To investigate the conservation of the epitope among all H1N1 influenza virus subtypes of the, including classical swine H1N1, pandemic 2009 H1N1, human H1N1, and avian-like swine H1N1, sequence alignment of the epitope and amino acid sequences from the corresponding region of the influenza A HA protein was carried out using the DNASTAR Lasergene program. Factors related to the time of viral isolation and geographic regions of origin of all strains were considered. Epitope analysis in the three-dimensional (3-D) structure of HA protein To locate the identified epitope in the 3-D structure of the HA protein, an HA structure [PDB:3LZG] derived from an H1N1 influenza virus was downloaded from the Protein Data Bank (http://www.pdb.org/pdb/home/home.do), and the epitope was mapped on the structure using Discovery Studio 2.5.
Results Generation and characterization of Mabs against the HA protein of the 2009 pandemic H1N1 virus To generate Mabs against the 2009 pandemic A/H1N1 HA, the expressed recombinant HA protein expressed from pCAGGS was used as immunogen. After cell fusion, hybridomas secreting HA-specific Mabs were identified by ELISA using the purified SW/HLJ/44/09 virus as an antigen. Three Mabs, designated as 2B11, 3G3 and 3C10, were
Fig. 1 (a) Identification of Mabs by western blot analysis using a purified pandemic A/H1N1 2009 isolate as an antigen. Lane 1, SP2/0 culture supernatant; lane 2, culture supernatant of Mab 3C10; lane 3, culture supernatant of Mab 2B11; lane 4, culture supernatant of Mab 3G3; lane M, PageRulerTM Prestained Protein Ladder (170 K, 130 K, 95 K, 72 K, 55 K, 43 K, 34 K, 26 K, 17 K, and 10 K). (b) The fusion protein H21 was recognized by Mab 2B11. (c) The H21 fusion protein was recognized by Mab 3G3. (d) The H21 fusion protein was not recognized by Mab 3C10. Lane M PageRulerTM Prestained Protein Ladder
selected for their strong reactivity against the entire viral antigen using an indirect ELISA after several rounds of cloning by limiting dilution (data not shown). Western blot analysis demonstrated that all of the Mabs specifically recognized the SDS-denatured HA protein in the purified SW/HLJ/44/09 virus (Fig. 1a). Moreover, we determined the reactivity of these Mabs against the SW/HLJ/44/09 virus in NT and HI tests. These results showed that all three Mabs lacked NT and HI activity against the SW/HLJ/44/09 virus (data not shown). All three Mabs were determined to be of the IgM isotype with a R light chain. Identification of an epitope using the expressed overlapping peptide fragments of the HA protein A total of 37 overlapping HA gene fragments were expressed in E. coli BL21 (DE3) cells. All of the recombinant peptides (HAH1-HAH37) were analyzed using these three Mabs as the primary antibody in western blot analysis. The results showed that HAH21 reacted with Mabs 2B11 (Fig. 1b) and 3G3 (Fig. 1c), while it was not recognized by Mab 3C10 (Fig. 1d). No peptides other than HAH21 reacted with these two Mabs in western blot analysis (data not shown).
123
Y. Chen et al.
belonging to different gene lineages demonstrated that the epitope recognized by 2B11 and 3G3 was conserved in all of the pandemic 2009 H1N1 viruses isolated from humans and swine, and also in the classical swine H1N1 isolates except the first strain A/Swine/Iowa/15/1930, with no amino acid variation detected therein (Fig. 3). Epitope analysis on the 3-D structure of the HA protein Epitope mapping on a 3-D structure of the HA protein [PDB:3LZG] was performed. As shown in Fig. 4, the identified epitope peptide was located on the head part of HA, with two amino acid residues of the epitope (252R and 253 Y) exposed on the surface of the molecule and the others buried within. These results suggested that the amino acid residues 252R and 253Y might be significant for the antibody binding capability of the epitope. Fig. 2 Epitope mapping of the seven truncated peptides with Mabs 2B11 and 3G3 by western blot analysis. (a) The seven amino acid motifs were recognized by Mab 2B11. (b) The seven amino acid motifs were recognized by Mab 3G3. (c-d) The minimal functional motif 250VPRYA254 was recognized by Mabs 2B11 (c) and 3G3 (d)
Precise localization of the epitope The reactive polypeptide (HAH21) identified above was divided into 7 fragments. Each peptide, containing 8 amino acids, was expressed in E. coli BL21 (DE3) cells and tested for its reactivity with Mabs 2B11 and 3G3 in western blot analysis. The results showed that 250VPRYAFAM257, 249 VVPRYAFA256, 248LVVPRYAF255 and 247NLVVPRYA254 could be recognized by Mabs 2B11 and 3G3. Interestingly, 248LVVPRYAF255 and 247NLVVPRYA254 reacted more strongly with these two Mabs than 250 VPRYAFAM257and 249VVPRYAFA256 (Fig. 2a-b). However, the peptides 251PRYAFAMM258, 246GNLVVPRY253 and 245TGNLVVPR252 were not recognized by Mabs 2B11 and 3G3 (Fig. 2a-b). Comparing the sequences of these peptides, we found that all four fragments possessed the amino acid motif 250VPRYA254, which is believed to be the epitope recognized by Mabs 2B11 and 3G3. Next, we synthesized complementary oligonucleotide pairs encoding 250VPRYA254 to confirm that this peptide can be recognized by Mabs 2B11 and 3G3. The results of western blot analysis indicated that the 250VPRYA254 was the smallest binding domain that could be recognized simultaneously by Mabs 2B11 and 3G3 (Fig. 2c-d). Conservation of the epitope in H1N1 viruses We then evaluated the conservation of the 250VPRYA254 epitope among influenza A viruses of the H1N1 subtype. Analysis of HA protein sequences from 37 H1N1 strains
123
Discussion The influenza A HA glycoprotein is essential for the process of viral infection and is also the major surface antigen and inducer of neutralizing antibodies among all of the structural proteins [18]. An early identification of the H1 epitopes was carried out by antibody mapping of the A/PR/ 8/1934 (H1) HA with an additional study of laboratory mutations [19]. In this study, three Mabs against the HA protein of the pandemic A/H1N1 virus were generated using the recombinant plasmid pCAGGS-HA as an immunogen. All three Mabs recognized the viral HA protein in the purified virion in western blot analysis, but they failed to react with the viral antigen in HI and NT tests. The function of these antibodies against the virus infection requires further investigation. Mabs against HA are potentially useful tools for probing the antigenic structures and functional regions of HA using antigen-antibody interactions, and will therefore play a vital role in early diagnoses and pathological studies of influenza viruses. Epitope mapping with mono- or polyclonal antibodies has traditionally been done by dissecting the antigen into overlapping polypeptides in the form of recombinantly expressed fusion proteins or by synthesizing overlapping oligopeptides and probing for reactivity with the antibody whose epitope was to be delineated [20–22]. Peptide scanning and phage display represent two important approaches for the identification of epitope peptides of antigenic proteins [23]. Unlike phage display, Pepscan analysis can identify linear, but not conformational, epitopes [24]. In this study, to map the epitope of the pandemic A/H1N1 virus HA protein, we artificially synthesized overlapping peptides covering the entire HA
Linear epitope of pandemic A/H1N1 2009 influenza virus
Fig. 3 Amino acid sequence alignment of the epitope 250VPRYA254 and influenza A (H1N1) HA proteins, including pandemic A/H1N1 2009 viruses isolated from humans (indicated by a triangle) and pigs (indicated by a circle), classical swine H1N1, human H1N1, and
avian-like swine influenza viruses, using the DNASTAR Lasergene program. The green rectangle indicates the 248L residue. The red rectangle indicates the residues at sites 250 to 254
protein and then probed them with three Mabs. Among 37 peptides, only one fragment (HA21) was identified by two of the Mabs, indicating that this region contained an immune-dominant domain. Refined mapping of this epitope peptide was carried out by sequentially truncating individual residues from the C-terminus. The epitope corresponding to the amino acids 250VPRYA254 was recognized by the Mabs, suggesting that this was the core determinant of the binding site. Virological surveillance results for swine influenza conducted in China have revealed that the classical swine H1N1 and avian-like swine H1N1 influenza viruses have continued to be widely prevalent in the swine population [25, 26]. In addition, human-like H1N1 influenza viruses were also recently isolated from pigs [27]. The co-circulation of multiple genetic lineages of H1-subtype swine influenza viruses in pigs has made it more difficult to diagnose and prevent diseases caused by these viruses. By comparing the amino acid sequences of this identified epitope, we found that the antibody-binding region was highly conserved in the pandemic A/H1N1 2009 viruses isolated from humans (A/California/04/2009) and pigs (A/swine/Heilongjiang/44/2009) to date, and almost all classical swine H1N1 viruses isolated from 1930 to 2010. The linear epitope 250VPRYA254 was found to be well
conserved, as no amino acid substitutions were found. These results were consistent with phylogenetic analysis, which showed that the HA gene of the pandemic A/H1N1 2009 virus was derived from the classical swine H1N1 viruses and likely shared a common ancestor with it [3]. Accordingly, it was also reported that the first strain of the classical swine H1N1 virus, A/Swine/Iowa/ 15/1930, was antigenically similar to the prototype strain of 1918 H1N1, A/South Carolina/1/1918 (SC1918), which was detected in a few victims of the 1918 pandemic [28, 29]. All of these observations are closely correlated with the conclusion that antigenic changes occur more slowly in swine viruses than in the human virus population [30]. Amino acid sequence alignments showed that all of the investigated influenza viruses possessed 248L within the HA protein. Moreover, results of the precise localization of this epitope revealed that the GST-fusion proteins 248 LVVPRYAF255 and 247NLVVPRYA254 bound more strongly to Mabs 2B11 and 3G3 when compared to the GST-fusion proteins 250VPRYAFAM257 and 249 VVPRYAFA256 (Fig. 3a-b). We hypothesized that this difference may have been due to the addition of one extra amino acid, 248L. The specific function of the 248L amino acid remains to be investigated.
123
Y. Chen et al. Fig. 4 Location of the epitope 250 VPRYA254 on the HA protein. (a) The protein structure of HA [PDB:3LZG] is shown in cyan, the amino acids of the epitope are shown as sticks. (b) Surface view of the epitope. The HA surface is rendered at 30 % transparency and colored according to atom charge. The surface of the epitope is rendered in green. (c) Possible antigen site indicated by the epitope. Amino ˚ of the acids within 6 A outermost atoms of Arg 252 and Tyr 253 might have direct contact with the monoclonal antibody during the binding of the antibody to HA. The maps were generated using Discovery Studio 2.5
Previous studies on H1 HA antigenic sites have shown that 252R and 253Y are active within antigenic site A, the antibody-binding site [31]. Residues 70 at site E, 145 at Ca2, 118 and 120 at site A, and 113 and 117 at site D were also identified in these reports [19, 31]. In this study, we located this linear epitope in the 3-D structure of the HA protein (Fig. 4a). Two amino acid residues (252R and 253Y) exposed on the surface of HA and others buried within the molecule (Fig. 4b), indicated that these two amino acid residues may be significant for antibody binding. A continuous epitope is identified only by the binding activity of a peptide and not by showing that all the residues in this peptide interact with anti-protein antibodies. Usually, only some of the residues of a continuous epitope are present at the surface of the cognate native protein that is able to make contact with antibody molecules [32]. Other possible antigen-site-specific amino acid residues occurred at positions 70, 145, 113, 115, 118, 119 and 120, as determined by analysis using Discovery Studio 2.5
123
(Fig. 4c). It has been found that in most continuous epitopes some residues cannot be replaced because they play a scaffolding role, while others can be replaced because they are recognized through backbone atoms that are common to all residues [33]. In this study, we generated three Mabs against the HA protein of the pandemic A/H1N1 2009 viruses. A linear epitope corresponding to the HA amino acids 250 VPRYA254 was recognized by two of the Mabs. The sequences of the epitope were well conserved among all of the pandemic A/H1N1 2009 viruses as well as the classical swine H1N1 viruses isolated to date. These results should provide additional insights into the virusmab interactions at the amino acid level and may help in the development of specific diagnostic methods for influenza viruses. Acknowledgements This study was supported by the European Union Scientific and Technical Cooperation Project (1112) and the National Natural Science Foundation of China (31302108).
Linear epitope of pandemic A/H1N1 2009 influenza virus
References 1. Cameron MJ, Rowe T, Kelvin DJ (2009) Possible link between the severe respiratory illness outbreak in Mexico and swine influenza in southwestern United States? J Infect Dev Ctries 3:157–158 2. Perez-Padilla R, de la Rosa-Zamboni D D, Ponce de Leon S S, Hernandez M, Quin˜ones-Falconi F, Bautista E, Ramirez-Venegas A, Rojas-Serrano J, Ormsby CE, Corrales A, Higuera A, Mondragon E, Cordova-Villalobos JA, INER Working Group on Influenza (2009) Pneumonia and respiratory failure from swineorigin influenza A (H1N1) in Mexico. N Engl J Med 361:680–689 3. Garten RJ, Davis CT, Russell CA, Shu B, Lindstrom S, Balish A, Sessions WM, Xu X, Skepner E, Deyde V, Okomo-Adhiambo M, Gubareva L, Barnes J, Smith CB, Emery SL, Hillman MJ, Rivailler P, Smagala J, de Graaf M, Burke DF, Fouchier RA, Pappas C, Alpuche-Aranda CM, Lo´pez-Gatell H, Olivera H, Lo´pez I, Myers CA, Faix D, Blair PJ, Yu C, Keene KM, Dotson PD Jr, Boxrud D, Sambol AR, Abid SH, St George K, Bannerman T, Moore AL, Stringer DJ, Blevins P, Demmler-Harrison GJ, Ginsberg M, Kriner P, Waterman S, Smole S, Guevara HF, Belongia EA, Clark PA, Beatrice ST, Donis R, Katz J, Finelli L, Bridges CB, Shaw M, Jernigan DB, Uyeki TM, Smith DJ, Klimov AI, Cox NJ (2009) Antigenic and genetic characteristics of swine-origin 2009 A (H1N1) influenza viruses circulating in humans. Science 325:197–201 4. Smith GJ, Vijaykrishna D, Bahl J, Lycett SJ, Worobey M, Pybus OG, Ma SK, Cheung CL, Raghwani J, Bhatt S, Peiris JS, Guan Y, Rambaut A (2009) Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic. Nature 459:1122–1125 5. Trifonov V, Khiabanian H, Rabadan R (2009) Geographic dependence, surveillance, and origins of the 2009 influenza A (H1N1) virus. N Engl J Med 361:115–119 6. Howden KJ, Brockhoff EJ, Caya FD, McLeod LJ, Lavoie M, Ing JD, Bystrom JM, Alexandersen S, Pasick JM, Berhane Y, Morrison ME, Keenliside JM, Laurendeau S, Rohonczy EB (2009) An investigation into human pandemic influenza virus (H1N1) 2009 on an Alberta swine farm. Can Vet J 50:1153–1161 7. Song MS, Lee JH, Pascua PN, Baek YH, Kwon HI, Park KJ, Choi HW, Shin YK, Song JY, Kim CJ, Choi YK (2010) Evidence of human-to-swine transmission of the pandemic (H1N1) 2009 influenza virus in South Korea. J Clin Microbiol 48:3204–3211 8. Welsh MD, Baird PM, Guelbenzu-Gonzalo MP, Hanna A, Reid SM, Essen S, Russell C, Thomas S, Barrass L, McNeilly F, McKillen J, Todd D, Harkin V, McDowell S, Choudhury B, Irvine RM, Borobia J, Grant J, Brown IH (2010) Initial incursion of pandemic (H1N1) 2009 influenza A virus into European pigs. Vet Rec 166:642–645 9. Vijaykrishna D, Poon LL, Zhu HC, Ma SK, Li OT, Cheung CL, Smith GJ, Peiris JS, Guan Y (2010) Reassortment of pandemic H1N1/2009 influenza A virus in swine. Science 328:1529 10. Moreno A, Di Trani L, Faccini S, Vaccari G, Nigrelli D, Boniotti MB, Falcone E, Boni A, Chiapponi C, Sozzi E, Cordioli P (2011) Novel H1N2 swine influenza reassortant strain in pigs derived from the pandemic H1N1/2009 virus. Vet Microbiol 149:472–477 11. Suzuki Y (2005) Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses. Biol Pharm Bull 28:399–408 12. Okuno Y, Isegawa Y, Sasao F, Ueda S (1993) A common neutralizing epitope conserved between the hemagglutinins of influenza A virus H1 and H2 strains. J Virol 67:2552–2558 13. Smirnov YA, Lipatov AS, Gitelman AK, Okuno Y, Van Beek R, Osterhaus AD, Claas EC (1999) An epitope shared by the hemagglutinins of H1, H2, H5, and H6 subtypes of influenza A virus. Acta Virol 43:237–244
14. Kaverin NV, Rudneva IA, Govorkova EA, Timofeeva TA, Shilov AA, Kochergin-Nikitsky KS, Krylov PS, Webster RG (2007) Epitope mapping of the Hemagglutinin molecule of a highly pathogenic H5N1 influenza virus by using monoclonal antibodies. J Virol 81:12911–12917 15. Chen Y, Zhang J, Qiao CL, Yang HL, Xin XG, Chen HL (2013) Co-circulation of pandemic 2009 H1N1, classical swine H1N1 and avian-like swine H1N1 influenza viruses in pigs in China. Infect Genet Evol 13:331–338 16. Kohler G, Milstein C (1975) Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256:495–497 17. Chen Y, Xin XG, Yang HL, Li T, Li HY, Qiao CL, Chen HL (2007) Establishment of an indirect ELISA for detection antibodies against swine influenza virus. Chin J Prev Vet Med 4:308–311 Chinese 18. Webster RG (2002) The importance of animal influenza for human disease. Vaccine 20:S16–S20 19. Caton AJ, Brownlee GG, Yewdell JW, Gerhard W (1982) The antigenic structure of the influenza virus A/PR/8/34 hemagglutinin (H1 subtype). Cell 31:417–427 20. Stanley KK, Herz J (1987) Topological mapping of complement component C9 by recombinant DNA techniques suggests a novel mechanism for its insertion into target membranes. EMBO J 6:1951–1957 21. Van Regenmortel MHV (1989) Structural and functional approaches to the study of protein antigenicity. Immunol Today 10:266–272 22. Lenstra JA, Kusters JG, van der Zeijst BA (1990) Mapping of viral epitopes with prokaryotic expression products. Arch Virol 110:1–24 23. Rowley MJ, O’Connor K, Wijeyewickrema L (2004) Phage display for epitope determination: a paradigm for identifying receptor-ligand interactions. Biotechnol Annu Rev 10:151–188 24. Zhou YJ, Yu H, Tian ZJ, Liu JX, An TQ, Peng JM, Li GX, Jiang YF, Cai XH, Xue Q, Wang M, Wang YF, Tong GZ (2009) Monoclonal antibodies and conserved antigenic epitopes in the C terminus of GP5 protein of the North American type porcine reproductive and respiratory syndrome virus. Vet Microbiol 138:1–10 25. Guan Y, Shortridge KF, Krauss S, Li PH, Kawaoka Y, Webster RG (1996) Emergence of avian H1N1 influenza viruses in pigs in China. J Virol 70:8041–8046 26. Liu JH, Bi YH, Qin K, Fu GH, Yang J, Peng JS, Ma GP, Liu QF, Pu J, Tian FL (2009) Emergence of European avian influenza virus-like H1N1 swine influenza A viruses in China. J Clin Microbiol 47:2643–2646 27. Yu H, Zhang GH, Hua RH, Zhang Q, Liu TQ, Liao M, Tong GZ (2007) Isolation and genetic analysis of human origin H1N1 and H3N2 influenza viruses from pigs in China. Biochem Biophys Res Commun 356:91–96 28. Reid AH, Fanning TG, Hultin JV, Taubenberger JK (1999) Origin and evolution of the 1918 ‘‘Spanish’’ influenza virus hemagglutinin gene. Proc Natl Acad Sci USA 96:1651–1656 29. Vincent AL, Lager KM, Ma W, Lekcharoensuk P, Gramer MR, Loiacono C, Richt AJ (2006) Evaluation of hemagglutinin subtype 1 swine influenza viruses from the United States. Vet Microbiol 118:212–222 30. Sugita S, Yoshioka Y, Itamura S, Kanegae Y, Oguchi K, Gojobori T, Nerome K, Oya A (1991) Molecular evolution of hemagglutinin genes of H1N1 swine and human influenza A viruses. J Mol Evol 32:16–23 31. Deem MW, Pan K (2009) The epitope regions of H1-subtype influenza A, with application to vaccine efficacy. Protein Eng Des Sel 22:543–546 32. Van Regenmortel MHV (2009) What is a B cell epitope? In: Reinicke, Schutkowski (eds) Epitope Mapping Protocols. Humana Press, New York, pp 3–20 (Methods Mol Biol 524:3–20) 33. Van Regenmortel MHV (2009) Synthetic peptide vaccines and the search for neutralization epitopes. Open Vaccine J 2:33–44
123
ORIGINAL ARTICLE
Identification of a linear epitope on the haemagglutinin protein of pandemic A/H1N1 2009 influenza virus using monoclonal antibodies Yan Chen • Jian Zhang • Chuanling Qiao • Jingfei Wang • Huanliang Yang • Hualan Chen
Received: 25 October 2013 / Accepted: 16 November 2013 Ó Springer-Verlag Wien 2013
Abstract A novel influenza A/H1N1 virus, emerging from Mexico and the United States in the spring of 2009, caused the pandemic human infection of 2009-2010. The haemagglutinin (HA) glycoprotein is the major surface antigen of influenza A virus and plays an important role in viral infection. In this study, three hybridoma cell lines secreting specific monoclonal antibodies (Mabs) against the HA protein of pandemic influenza A/H1N1 2009 virus were generated with the recombinant plasmid pCAGGSHA as an immunogen. Using Pepscan analysis, the binding sites of these Mabs were identified in a linear region of the HA protein. Further, refined mapping was conducted using truncated peptides expressed as GST-fusion proteins in E. coli. We found that the 250VPRYA254 motif was the minimal determinant of the linear epitope that could be recognized by the Mabs. Alignment with sequences from the databases showed that the amino acid residues of this epitope were highly conserved among all pandemic A/H1N1 2009 viruses as well as the classical swine H1N1 viruses isolated to date. These results provide additional insights into the antigenic structure of the HA protein and virus-antibody interactions at the amino acid level, which
Y. Chen and J. Zhang contributed equally to this work. Y. Chen J. Zhang C. Qiao (&) J. Wang H. Yang H. Chen (&) Animal Influenza Laboratory of the Ministry of Agriculture, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, 427 Maduan Street, Harbin 150001, People’s Republic of China e-mail: [email protected] H. Chen e-mail: [email protected]
may assist in the development of specific diagnostic methods for influenza viruses.
Introduction In the spring of 2009, a novel pandemic influenza A H1N1 virus emerged in the human population in Mexico and the United States, then quickly spread worldwide [1, 2]. Eight gene segments of this novel virus were acquired through successive reassortments that involved North American classical swine lineage H1N1, avian influenza virus, a genetic lineage from Eurasian swine, and the triple reassortant viruses [3–5]. The pandemic A/H1N1 2009 viruses have been repeatedly isolated from pigs in many countries [6–8], and some reassortments between pandemic A/H1N1 2009 virus and pre-existing swine influenza viruses have occurred in the swine population in others [9, 10]. However, the antigenic structure and characterization of the pandemic A/H1N1 virus has not been clearly demonstrated until now. The major factor responsible for influenza A virus infectivity is the haemagglutinin (HA) surface protein, which mediates binding of the virus to the host-specific cell-surface receptor, 2,3-sialic acid (SA) in birds and 2,6SA in mammals [11]. Thus, HA is the prime target for the development of new diagnostic, therapeutic and preventive tools, and it is essential to gain further understanding of the antigenic characteristics of HA in order to develop specific diagnostic tools and vaccines to combat influenza viruses. Previous studies have provided evidence of the existence of both HA-subtype-specific and inter-subtype-conserved epitopes [12–14]. In this study, we generated three Mabs against the HA protein of the pandemic A/H1N1 2009 virus. A linear
123
Y. Chen et al.
epitope corresponding to the HA amino acids 250 VPRYA254 was recognized by the Mabs in Pepscan analysis. This sequence is well conserved among all of the pandemic A/H1N1 2009 viruses as well as the classical swine H1N1 viruses isolated to date.
Materials and methods Viruses and cells A/swine/Heilongjiang/44/2009 (H1N1) (SW/HLJ/44/09) [15] was isolated from pigs in China during the outbreak of the 2009 influenza pandemic. Phylogenetic analysis of this virus demonstrated that the genome was more than 99 % homologous to the 2009 A/H1N1 influenza virus that causes illness in humans around the world.The virus was propagated in 10-day-old embryonated chicken eggs and purified by centrifuging in a discontinuous 20 %, 40 %, 60 % (w/w) sucrose solution. The myeloma cell line SP2/0 and 293T cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10 % fetal bovine serum. Eukaryotic expression of HA protein A full-length cDNA fragment corresponding to the SW/ HLJ/44/09 HA gene was amplified using a pair of primers (forward primer, AGCGAATTCAAGAAGGCAATACTA GTAG; reverse primer, TGCCTCGAGAATCCTAATG TTAAATACAT) and then inserted into the eukaryotic expression vector pCAGGS (kindly provided by Prof. Zhigao Bu, Harbin Veterinary Research Institute) to express the entire HA protein. The resulting recombinant plasmid (designated as pCAGGS-HA) was introduced by transfection into 293T cells using Lipofectamine 2000 according to the manufacturer’s instructions. The in vitro expression of the HA protein was verified by immunofluorescence assay (IFA) 48 hours post-transfection using chicken polyclonal serum against SW/HLJ/44/09 as the primary antibody and FITC-conjugated goat anti-chicken IgG as the secondary antibody. Generation and characterization of Mabs against the HA protein Female BALB/c mice (aged 4-6 weeks) were immunized intramuscularly with pCAGGS-HA at 100 lg per mouse. Two booster injections of the same dose as the first immunization were given at three-week intervals. Five days after the final inoculation, spleen cells were harvested to prepare cell suspensions, followed by fusion with SP2/0 cells as
123
described previously by Kohler and Milstein [16]. The fused hybridoma cells were screened by indirect enzyme-linked immunosorbent serologic assay (ELISA) as described previously [17] using the purified SW/HLJ/44/09 virus as the coating antigen. The positive hybridoma clones were selected for subcloning by limiting dilution using the same screening methods as described above. To further evaluate the reactivity of the resultant Mabs, neutralization test (NT) and hemagglutination inhibition (HI) assay were also performed as described previously (http://www.oie.int/filead min/Home/eng/Health_standards/tahm/2.08.08_SWINE_ INFLUENZA.pdf). Ascites fluids containing the Mabs of interest were produced in pristine-primed BALB/c mice. The isotypes of the Mabs were characterized using an SBA Clonotyping System/horseradish peroxidase (HRP)-based ELISA. All animal experiments were conducted in biosafety level 2 (BSL-2) facilities and approved by the Chinese Ministry of Agriculture and the Review Board of Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences. Epitope mapping with overlapping HA protein peptide fragments For epitope mapping of pandemic A/H1N1 HA, the whole HA gene fragment was divided into 37 overlapping segments for expression (designated as HAH1-HAH37), with each peptide containing 16 amino acids, and with 8 eight amino acids overlapping with to the next peptide. To express these polypeptides, we synthesized complementary oligonucleotide pairs encoding each peptide, annealed and cloned them into the BamHI and XhoI sites of the pGEX6p-1 expression vector, and introduced them into E. coli BL21 (DE3) cells by transformation. The GST fusion proteins were subjected to 12 % SDS-PAGE and then transferred to 0.22-lm nitrocellulose membranes for western blotting. After blocking, the membranes were incubated with the Mabs of interest at 37 °C for 60 min. After washing three times with PBS containing 0.5 % Tween-20 (PBST), the membranes were inoculated with HRP-conjugated goat anti-mouse IgG at 37 °C for 60 min and visualized using diaminobenzidine (DAB) substrate. Precise localization of epitopes on the HA protein In order to determine the minimal antigenic epitopes, the reactive polypeptides identified in ‘‘Materials and methods’’ were truncated by one residue at their C-terminus and at the same time extended by one residue at their N-terminus (Table 1) until the smallest binding domain recognized by the Mabs was identified as described.
Linear epitope of pandemic A/H1N1 2009 influenza virus Table 1 Oligonucleotides encoding truncated peptide sequences for epitope mapping Position
Peptide sequence
Sequence of complementary oligonucleotides
251-258
PRYAFAMM
AATTCccgagatatgcattcgcaatggaaTAGC
250-257
VPRYAFAM
249-256
VVPRYAFA
TCGAGCTAttccattgcgaatgcatatctcggG AATTCgtaccgagatatgcattcgcaatgTAGC TCGAGCTAcattgcgaatgcatatctcggtacG AATTCgtagtaccgagatatgcattcgcaTAGC TCGAGCTAtgcgaatgcatatctcggtactacG 248-255
LVVPRYAF
AATTCctagtagtaccgagatatgcattcTAGC
247-254
NLVVPRYA
AATTCaatctagtagtaccgagatatgcaTAGC
246-253
GNLVVPRY
AATTCggaaatctagtagtaccgagatatTAGC
245-252
TGNLVVPR
AATTCactggaaatctagtagtaccgagaTAGC
TCGAGCTAgaatgcatatctcggtactactagG TCGAGCTAtgcatatctcggtactactagattG TCGAGCTAatatctcggtacctactagatttccG TCGAGCTAtctcggtactactagatttccagtG
Homology analysis To investigate the conservation of the epitope among all H1N1 influenza virus subtypes of the, including classical swine H1N1, pandemic 2009 H1N1, human H1N1, and avian-like swine H1N1, sequence alignment of the epitope and amino acid sequences from the corresponding region of the influenza A HA protein was carried out using the DNASTAR Lasergene program. Factors related to the time of viral isolation and geographic regions of origin of all strains were considered. Epitope analysis in the three-dimensional (3-D) structure of HA protein To locate the identified epitope in the 3-D structure of the HA protein, an HA structure [PDB:3LZG] derived from an H1N1 influenza virus was downloaded from the Protein Data Bank (http://www.pdb.org/pdb/home/home.do), and the epitope was mapped on the structure using Discovery Studio 2.5.
Results Generation and characterization of Mabs against the HA protein of the 2009 pandemic H1N1 virus To generate Mabs against the 2009 pandemic A/H1N1 HA, the expressed recombinant HA protein expressed from pCAGGS was used as immunogen. After cell fusion, hybridomas secreting HA-specific Mabs were identified by ELISA using the purified SW/HLJ/44/09 virus as an antigen. Three Mabs, designated as 2B11, 3G3 and 3C10, were
Fig. 1 (a) Identification of Mabs by western blot analysis using a purified pandemic A/H1N1 2009 isolate as an antigen. Lane 1, SP2/0 culture supernatant; lane 2, culture supernatant of Mab 3C10; lane 3, culture supernatant of Mab 2B11; lane 4, culture supernatant of Mab 3G3; lane M, PageRulerTM Prestained Protein Ladder (170 K, 130 K, 95 K, 72 K, 55 K, 43 K, 34 K, 26 K, 17 K, and 10 K). (b) The fusion protein H21 was recognized by Mab 2B11. (c) The H21 fusion protein was recognized by Mab 3G3. (d) The H21 fusion protein was not recognized by Mab 3C10. Lane M PageRulerTM Prestained Protein Ladder
selected for their strong reactivity against the entire viral antigen using an indirect ELISA after several rounds of cloning by limiting dilution (data not shown). Western blot analysis demonstrated that all of the Mabs specifically recognized the SDS-denatured HA protein in the purified SW/HLJ/44/09 virus (Fig. 1a). Moreover, we determined the reactivity of these Mabs against the SW/HLJ/44/09 virus in NT and HI tests. These results showed that all three Mabs lacked NT and HI activity against the SW/HLJ/44/09 virus (data not shown). All three Mabs were determined to be of the IgM isotype with a R light chain. Identification of an epitope using the expressed overlapping peptide fragments of the HA protein A total of 37 overlapping HA gene fragments were expressed in E. coli BL21 (DE3) cells. All of the recombinant peptides (HAH1-HAH37) were analyzed using these three Mabs as the primary antibody in western blot analysis. The results showed that HAH21 reacted with Mabs 2B11 (Fig. 1b) and 3G3 (Fig. 1c), while it was not recognized by Mab 3C10 (Fig. 1d). No peptides other than HAH21 reacted with these two Mabs in western blot analysis (data not shown).
123
Y. Chen et al.
belonging to different gene lineages demonstrated that the epitope recognized by 2B11 and 3G3 was conserved in all of the pandemic 2009 H1N1 viruses isolated from humans and swine, and also in the classical swine H1N1 isolates except the first strain A/Swine/Iowa/15/1930, with no amino acid variation detected therein (Fig. 3). Epitope analysis on the 3-D structure of the HA protein Epitope mapping on a 3-D structure of the HA protein [PDB:3LZG] was performed. As shown in Fig. 4, the identified epitope peptide was located on the head part of HA, with two amino acid residues of the epitope (252R and 253 Y) exposed on the surface of the molecule and the others buried within. These results suggested that the amino acid residues 252R and 253Y might be significant for the antibody binding capability of the epitope. Fig. 2 Epitope mapping of the seven truncated peptides with Mabs 2B11 and 3G3 by western blot analysis. (a) The seven amino acid motifs were recognized by Mab 2B11. (b) The seven amino acid motifs were recognized by Mab 3G3. (c-d) The minimal functional motif 250VPRYA254 was recognized by Mabs 2B11 (c) and 3G3 (d)
Precise localization of the epitope The reactive polypeptide (HAH21) identified above was divided into 7 fragments. Each peptide, containing 8 amino acids, was expressed in E. coli BL21 (DE3) cells and tested for its reactivity with Mabs 2B11 and 3G3 in western blot analysis. The results showed that 250VPRYAFAM257, 249 VVPRYAFA256, 248LVVPRYAF255 and 247NLVVPRYA254 could be recognized by Mabs 2B11 and 3G3. Interestingly, 248LVVPRYAF255 and 247NLVVPRYA254 reacted more strongly with these two Mabs than 250 VPRYAFAM257and 249VVPRYAFA256 (Fig. 2a-b). However, the peptides 251PRYAFAMM258, 246GNLVVPRY253 and 245TGNLVVPR252 were not recognized by Mabs 2B11 and 3G3 (Fig. 2a-b). Comparing the sequences of these peptides, we found that all four fragments possessed the amino acid motif 250VPRYA254, which is believed to be the epitope recognized by Mabs 2B11 and 3G3. Next, we synthesized complementary oligonucleotide pairs encoding 250VPRYA254 to confirm that this peptide can be recognized by Mabs 2B11 and 3G3. The results of western blot analysis indicated that the 250VPRYA254 was the smallest binding domain that could be recognized simultaneously by Mabs 2B11 and 3G3 (Fig. 2c-d). Conservation of the epitope in H1N1 viruses We then evaluated the conservation of the 250VPRYA254 epitope among influenza A viruses of the H1N1 subtype. Analysis of HA protein sequences from 37 H1N1 strains
123
Discussion The influenza A HA glycoprotein is essential for the process of viral infection and is also the major surface antigen and inducer of neutralizing antibodies among all of the structural proteins [18]. An early identification of the H1 epitopes was carried out by antibody mapping of the A/PR/ 8/1934 (H1) HA with an additional study of laboratory mutations [19]. In this study, three Mabs against the HA protein of the pandemic A/H1N1 virus were generated using the recombinant plasmid pCAGGS-HA as an immunogen. All three Mabs recognized the viral HA protein in the purified virion in western blot analysis, but they failed to react with the viral antigen in HI and NT tests. The function of these antibodies against the virus infection requires further investigation. Mabs against HA are potentially useful tools for probing the antigenic structures and functional regions of HA using antigen-antibody interactions, and will therefore play a vital role in early diagnoses and pathological studies of influenza viruses. Epitope mapping with mono- or polyclonal antibodies has traditionally been done by dissecting the antigen into overlapping polypeptides in the form of recombinantly expressed fusion proteins or by synthesizing overlapping oligopeptides and probing for reactivity with the antibody whose epitope was to be delineated [20–22]. Peptide scanning and phage display represent two important approaches for the identification of epitope peptides of antigenic proteins [23]. Unlike phage display, Pepscan analysis can identify linear, but not conformational, epitopes [24]. In this study, to map the epitope of the pandemic A/H1N1 virus HA protein, we artificially synthesized overlapping peptides covering the entire HA
Linear epitope of pandemic A/H1N1 2009 influenza virus
Fig. 3 Amino acid sequence alignment of the epitope 250VPRYA254 and influenza A (H1N1) HA proteins, including pandemic A/H1N1 2009 viruses isolated from humans (indicated by a triangle) and pigs (indicated by a circle), classical swine H1N1, human H1N1, and
avian-like swine influenza viruses, using the DNASTAR Lasergene program. The green rectangle indicates the 248L residue. The red rectangle indicates the residues at sites 250 to 254
protein and then probed them with three Mabs. Among 37 peptides, only one fragment (HA21) was identified by two of the Mabs, indicating that this region contained an immune-dominant domain. Refined mapping of this epitope peptide was carried out by sequentially truncating individual residues from the C-terminus. The epitope corresponding to the amino acids 250VPRYA254 was recognized by the Mabs, suggesting that this was the core determinant of the binding site. Virological surveillance results for swine influenza conducted in China have revealed that the classical swine H1N1 and avian-like swine H1N1 influenza viruses have continued to be widely prevalent in the swine population [25, 26]. In addition, human-like H1N1 influenza viruses were also recently isolated from pigs [27]. The co-circulation of multiple genetic lineages of H1-subtype swine influenza viruses in pigs has made it more difficult to diagnose and prevent diseases caused by these viruses. By comparing the amino acid sequences of this identified epitope, we found that the antibody-binding region was highly conserved in the pandemic A/H1N1 2009 viruses isolated from humans (A/California/04/2009) and pigs (A/swine/Heilongjiang/44/2009) to date, and almost all classical swine H1N1 viruses isolated from 1930 to 2010. The linear epitope 250VPRYA254 was found to be well
conserved, as no amino acid substitutions were found. These results were consistent with phylogenetic analysis, which showed that the HA gene of the pandemic A/H1N1 2009 virus was derived from the classical swine H1N1 viruses and likely shared a common ancestor with it [3]. Accordingly, it was also reported that the first strain of the classical swine H1N1 virus, A/Swine/Iowa/ 15/1930, was antigenically similar to the prototype strain of 1918 H1N1, A/South Carolina/1/1918 (SC1918), which was detected in a few victims of the 1918 pandemic [28, 29]. All of these observations are closely correlated with the conclusion that antigenic changes occur more slowly in swine viruses than in the human virus population [30]. Amino acid sequence alignments showed that all of the investigated influenza viruses possessed 248L within the HA protein. Moreover, results of the precise localization of this epitope revealed that the GST-fusion proteins 248 LVVPRYAF255 and 247NLVVPRYA254 bound more strongly to Mabs 2B11 and 3G3 when compared to the GST-fusion proteins 250VPRYAFAM257 and 249 VVPRYAFA256 (Fig. 3a-b). We hypothesized that this difference may have been due to the addition of one extra amino acid, 248L. The specific function of the 248L amino acid remains to be investigated.
123
Y. Chen et al. Fig. 4 Location of the epitope 250 VPRYA254 on the HA protein. (a) The protein structure of HA [PDB:3LZG] is shown in cyan, the amino acids of the epitope are shown as sticks. (b) Surface view of the epitope. The HA surface is rendered at 30 % transparency and colored according to atom charge. The surface of the epitope is rendered in green. (c) Possible antigen site indicated by the epitope. Amino ˚ of the acids within 6 A outermost atoms of Arg 252 and Tyr 253 might have direct contact with the monoclonal antibody during the binding of the antibody to HA. The maps were generated using Discovery Studio 2.5
Previous studies on H1 HA antigenic sites have shown that 252R and 253Y are active within antigenic site A, the antibody-binding site [31]. Residues 70 at site E, 145 at Ca2, 118 and 120 at site A, and 113 and 117 at site D were also identified in these reports [19, 31]. In this study, we located this linear epitope in the 3-D structure of the HA protein (Fig. 4a). Two amino acid residues (252R and 253Y) exposed on the surface of HA and others buried within the molecule (Fig. 4b), indicated that these two amino acid residues may be significant for antibody binding. A continuous epitope is identified only by the binding activity of a peptide and not by showing that all the residues in this peptide interact with anti-protein antibodies. Usually, only some of the residues of a continuous epitope are present at the surface of the cognate native protein that is able to make contact with antibody molecules [32]. Other possible antigen-site-specific amino acid residues occurred at positions 70, 145, 113, 115, 118, 119 and 120, as determined by analysis using Discovery Studio 2.5
123
(Fig. 4c). It has been found that in most continuous epitopes some residues cannot be replaced because they play a scaffolding role, while others can be replaced because they are recognized through backbone atoms that are common to all residues [33]. In this study, we generated three Mabs against the HA protein of the pandemic A/H1N1 2009 viruses. A linear epitope corresponding to the HA amino acids 250 VPRYA254 was recognized by two of the Mabs. The sequences of the epitope were well conserved among all of the pandemic A/H1N1 2009 viruses as well as the classical swine H1N1 viruses isolated to date. These results should provide additional insights into the virusmab interactions at the amino acid level and may help in the development of specific diagnostic methods for influenza viruses. Acknowledgements This study was supported by the European Union Scientific and Technical Cooperation Project (1112) and the National Natural Science Foundation of China (31302108).
Linear epitope of pandemic A/H1N1 2009 influenza virus
References 1. Cameron MJ, Rowe T, Kelvin DJ (2009) Possible link between the severe respiratory illness outbreak in Mexico and swine influenza in southwestern United States? J Infect Dev Ctries 3:157–158 2. Perez-Padilla R, de la Rosa-Zamboni D D, Ponce de Leon S S, Hernandez M, Quin˜ones-Falconi F, Bautista E, Ramirez-Venegas A, Rojas-Serrano J, Ormsby CE, Corrales A, Higuera A, Mondragon E, Cordova-Villalobos JA, INER Working Group on Influenza (2009) Pneumonia and respiratory failure from swineorigin influenza A (H1N1) in Mexico. N Engl J Med 361:680–689 3. Garten RJ, Davis CT, Russell CA, Shu B, Lindstrom S, Balish A, Sessions WM, Xu X, Skepner E, Deyde V, Okomo-Adhiambo M, Gubareva L, Barnes J, Smith CB, Emery SL, Hillman MJ, Rivailler P, Smagala J, de Graaf M, Burke DF, Fouchier RA, Pappas C, Alpuche-Aranda CM, Lo´pez-Gatell H, Olivera H, Lo´pez I, Myers CA, Faix D, Blair PJ, Yu C, Keene KM, Dotson PD Jr, Boxrud D, Sambol AR, Abid SH, St George K, Bannerman T, Moore AL, Stringer DJ, Blevins P, Demmler-Harrison GJ, Ginsberg M, Kriner P, Waterman S, Smole S, Guevara HF, Belongia EA, Clark PA, Beatrice ST, Donis R, Katz J, Finelli L, Bridges CB, Shaw M, Jernigan DB, Uyeki TM, Smith DJ, Klimov AI, Cox NJ (2009) Antigenic and genetic characteristics of swine-origin 2009 A (H1N1) influenza viruses circulating in humans. Science 325:197–201 4. Smith GJ, Vijaykrishna D, Bahl J, Lycett SJ, Worobey M, Pybus OG, Ma SK, Cheung CL, Raghwani J, Bhatt S, Peiris JS, Guan Y, Rambaut A (2009) Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic. Nature 459:1122–1125 5. Trifonov V, Khiabanian H, Rabadan R (2009) Geographic dependence, surveillance, and origins of the 2009 influenza A (H1N1) virus. N Engl J Med 361:115–119 6. Howden KJ, Brockhoff EJ, Caya FD, McLeod LJ, Lavoie M, Ing JD, Bystrom JM, Alexandersen S, Pasick JM, Berhane Y, Morrison ME, Keenliside JM, Laurendeau S, Rohonczy EB (2009) An investigation into human pandemic influenza virus (H1N1) 2009 on an Alberta swine farm. Can Vet J 50:1153–1161 7. Song MS, Lee JH, Pascua PN, Baek YH, Kwon HI, Park KJ, Choi HW, Shin YK, Song JY, Kim CJ, Choi YK (2010) Evidence of human-to-swine transmission of the pandemic (H1N1) 2009 influenza virus in South Korea. J Clin Microbiol 48:3204–3211 8. Welsh MD, Baird PM, Guelbenzu-Gonzalo MP, Hanna A, Reid SM, Essen S, Russell C, Thomas S, Barrass L, McNeilly F, McKillen J, Todd D, Harkin V, McDowell S, Choudhury B, Irvine RM, Borobia J, Grant J, Brown IH (2010) Initial incursion of pandemic (H1N1) 2009 influenza A virus into European pigs. Vet Rec 166:642–645 9. Vijaykrishna D, Poon LL, Zhu HC, Ma SK, Li OT, Cheung CL, Smith GJ, Peiris JS, Guan Y (2010) Reassortment of pandemic H1N1/2009 influenza A virus in swine. Science 328:1529 10. Moreno A, Di Trani L, Faccini S, Vaccari G, Nigrelli D, Boniotti MB, Falcone E, Boni A, Chiapponi C, Sozzi E, Cordioli P (2011) Novel H1N2 swine influenza reassortant strain in pigs derived from the pandemic H1N1/2009 virus. Vet Microbiol 149:472–477 11. Suzuki Y (2005) Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses. Biol Pharm Bull 28:399–408 12. Okuno Y, Isegawa Y, Sasao F, Ueda S (1993) A common neutralizing epitope conserved between the hemagglutinins of influenza A virus H1 and H2 strains. J Virol 67:2552–2558 13. Smirnov YA, Lipatov AS, Gitelman AK, Okuno Y, Van Beek R, Osterhaus AD, Claas EC (1999) An epitope shared by the hemagglutinins of H1, H2, H5, and H6 subtypes of influenza A virus. Acta Virol 43:237–244
14. Kaverin NV, Rudneva IA, Govorkova EA, Timofeeva TA, Shilov AA, Kochergin-Nikitsky KS, Krylov PS, Webster RG (2007) Epitope mapping of the Hemagglutinin molecule of a highly pathogenic H5N1 influenza virus by using monoclonal antibodies. J Virol 81:12911–12917 15. Chen Y, Zhang J, Qiao CL, Yang HL, Xin XG, Chen HL (2013) Co-circulation of pandemic 2009 H1N1, classical swine H1N1 and avian-like swine H1N1 influenza viruses in pigs in China. Infect Genet Evol 13:331–338 16. Kohler G, Milstein C (1975) Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256:495–497 17. Chen Y, Xin XG, Yang HL, Li T, Li HY, Qiao CL, Chen HL (2007) Establishment of an indirect ELISA for detection antibodies against swine influenza virus. Chin J Prev Vet Med 4:308–311 Chinese 18. Webster RG (2002) The importance of animal influenza for human disease. Vaccine 20:S16–S20 19. Caton AJ, Brownlee GG, Yewdell JW, Gerhard W (1982) The antigenic structure of the influenza virus A/PR/8/34 hemagglutinin (H1 subtype). Cell 31:417–427 20. Stanley KK, Herz J (1987) Topological mapping of complement component C9 by recombinant DNA techniques suggests a novel mechanism for its insertion into target membranes. EMBO J 6:1951–1957 21. Van Regenmortel MHV (1989) Structural and functional approaches to the study of protein antigenicity. Immunol Today 10:266–272 22. Lenstra JA, Kusters JG, van der Zeijst BA (1990) Mapping of viral epitopes with prokaryotic expression products. Arch Virol 110:1–24 23. Rowley MJ, O’Connor K, Wijeyewickrema L (2004) Phage display for epitope determination: a paradigm for identifying receptor-ligand interactions. Biotechnol Annu Rev 10:151–188 24. Zhou YJ, Yu H, Tian ZJ, Liu JX, An TQ, Peng JM, Li GX, Jiang YF, Cai XH, Xue Q, Wang M, Wang YF, Tong GZ (2009) Monoclonal antibodies and conserved antigenic epitopes in the C terminus of GP5 protein of the North American type porcine reproductive and respiratory syndrome virus. Vet Microbiol 138:1–10 25. Guan Y, Shortridge KF, Krauss S, Li PH, Kawaoka Y, Webster RG (1996) Emergence of avian H1N1 influenza viruses in pigs in China. J Virol 70:8041–8046 26. Liu JH, Bi YH, Qin K, Fu GH, Yang J, Peng JS, Ma GP, Liu QF, Pu J, Tian FL (2009) Emergence of European avian influenza virus-like H1N1 swine influenza A viruses in China. J Clin Microbiol 47:2643–2646 27. Yu H, Zhang GH, Hua RH, Zhang Q, Liu TQ, Liao M, Tong GZ (2007) Isolation and genetic analysis of human origin H1N1 and H3N2 influenza viruses from pigs in China. Biochem Biophys Res Commun 356:91–96 28. Reid AH, Fanning TG, Hultin JV, Taubenberger JK (1999) Origin and evolution of the 1918 ‘‘Spanish’’ influenza virus hemagglutinin gene. Proc Natl Acad Sci USA 96:1651–1656 29. Vincent AL, Lager KM, Ma W, Lekcharoensuk P, Gramer MR, Loiacono C, Richt AJ (2006) Evaluation of hemagglutinin subtype 1 swine influenza viruses from the United States. Vet Microbiol 118:212–222 30. Sugita S, Yoshioka Y, Itamura S, Kanegae Y, Oguchi K, Gojobori T, Nerome K, Oya A (1991) Molecular evolution of hemagglutinin genes of H1N1 swine and human influenza A viruses. J Mol Evol 32:16–23 31. Deem MW, Pan K (2009) The epitope regions of H1-subtype influenza A, with application to vaccine efficacy. Protein Eng Des Sel 22:543–546 32. Van Regenmortel MHV (2009) What is a B cell epitope? In: Reinicke, Schutkowski (eds) Epitope Mapping Protocols. Humana Press, New York, pp 3–20 (Methods Mol Biol 524:3–20) 33. Van Regenmortel MHV (2009) Synthetic peptide vaccines and the search for neutralization epitopes. Open Vaccine J 2:33–44
123
