PARA 3719
No. of Pages 9, Model 5G
9 December 2014 International Journal for Parasitology xxx (2014) xxx–xxx 1
Contents lists available at ScienceDirect
International Journal for Parasitology journal homepage: www.elsevier.com/locate/ijpara 5 6
Haemonchus contortus P-glycoprotein-2: in situ localisation and characterisation of macrocyclic lactone transport
3 4 7 8 10 9 11 1 2 3 9 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28
Q1
Pablo Godoy, Jing Lian, Robin N. Beech, Roger K. Prichard ⇑ Institute of Parasitology, Macdonald Campus, McGill University, 21,111 Lakeshore Road, Ste-Anne-de-Bellevue, H9X3V9 QC, Canada
a r t i c l e
i n f o
Article history: Received 23 July 2014 Received in revised form 23 September 2014 Accepted 24 September 2014 Available online xxxx Keywords: Anthelmintic resistance Nematode P-glycoprotein Heterologous expression system Macrocyclic lactones Ivermectin Moxidectin Transport studies Protein localisation
a b s t r a c t Haemonchus contortus is a veterinary nematode that infects small ruminants, causing serious decreases in animal production worldwide. Effective control through anthelmintic treatment has been compromised by the development of resistance to these drugs, including the macrocyclic lactones. The mechanisms of resistance in H. contortus have yet to be established but may involve efflux of the macrocyclic lactones by nematode ATP-binding-cassette transporters such as P-glycoproteins. Here we report the expression and functional activity of H. contortus P-glycoprotein 2 expressed in mammalian cells and characterise its interaction with the macrocyclic lactones, ivermectin, abamectin and moxidectin. The ability of H. contortus P-glycoprotein 2 to transport different fluorophore substrates was markedly inhibited by ivermectin and abamectin in a dose-dependent and saturable way. The profile of transport inhibition by moxidectin was markedly different. H. contortus P-glycoprotein 2 was expressed in the pharynx, the first portion of the worm’s intestine and perhaps in adjacent nervous tissue, suggesting a role for this gene in regulating the uptake of avermectins and in protecting nematode tissues from the effects of macrocyclic lactone anthelmintic drugs. H. contortus P-glycoprotein 2 may thus contribute to resistance to these drugs in H. contortus. Ó 2014 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc.
30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
1. Introduction Gastrointestinal (GI) nematodes such as Haemonchus contortus represent a significant threat to animal welfare in livestock production. In the United Kingdom (UK), for example, parasitic worms cause significant losses in small ruminants estimated to be approximately GBP 84 million/annum (Nieuwhof and Bishop, 2005). Haemonchus contortus is distributed globally and found in tropical to cool temperate areas (Peter and Chandrawathani, 2005). Anthelmintic drugs such as levamisole (LEV), benzimidazoles (BZs) and the macrocyclic lactones (MLs) have been used as important broad spectrum anthelmintics to control parasitic nematodes (Kaplan and Vidyashankar, 2012). MLs are used extensively in animal and human health (Geary, 2005; Prichard et al., 2012) and represent the cornerstone of current anthelmintic drug treatment, having remarkable endectocide efficacy against GI nematodes as well as ectoparasites such as lice, ticks and scabies (Miller et al., 1994; Q2 George et al., 2004; Taylor, 2012). MLs are large hydrophobic molecules characterised by a 16-member macrocyclic ring as a shared structural component (Lespine et al., 2007). The MLs are comprised
⇑ Corresponding author. Tel.: +1 514 398 7729; fax: +1 514 398 7957. E-mail address: [email protected] (R.N. Beech).
of two sub-groups, the avermectins including ivermectin (IVM), abamectin (ABA), doramectin, eprinomectin and selamectin characterised by the presence of sugar residues attached in the C13 position of the macrocyclic ring (Shoop et al., 1995) and the milbemycins, including moxidectin (MOX) and milbemycin oxime that are protonated at the C13 position and lack sugar moieties (Mishima et al., 1983). MLs have a safety profile with a wide therapeutic index, are administered easily and have long lasting effects inside the host (Lespine et al., 2008). These anthelmintic drugs target glutamate-gated chloride channels (GluCls) present in nematodes, leading to flaccid paralysis of the worm muscles (Cully et al., 1994; McCavera et al., 2009). Despite their excellent efficacy against parasitic nematodes, resistance has arisen, initially against the avermectins, including IVM and ABA (Kaplan, 2004; Kaminsky et al., 2010), and more recently to MOX (Sargison et al., 2010; Van den Brom et al., 2013). There is consistent evidence that ATP-binding-cassette (ABC) transporters in nematodes, such as P-glycoprotein (PGP), can actively efflux the MLs and protect worms from their pharmacological action (Kerboeuf et al., 2003; Lespine et al., 2012). In H. contortus and other veterinary nematodes, an up-regulation of these PGPs has been described in resistant parasites (Xu et al., 1998; Prichard and Roulet, 2007; Dicker et al., 2011; Areskog et al., 2013; Janssen et al., 2013; Kotze et al., 2014). Among the transporters implicated in ML resistance
http://dx.doi.org/10.1016/j.ijpara.2014.09.008 0020-7519/Ó 2014 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc.
Please cite this article in press as: Godoy, P., et al. Haemonchus contortus P-glycoprotein-2: in situ localisation and characterisation of macrocyclic lactone transport. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.008
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90
PARA 3719
No. of Pages 9, Model 5G
9 December 2014 2
P. Godoy et al. / International Journal for Parasitology xxx (2014) xxx–xxx
(Life Technologies, ON, Canada). The RNA pellet obtained was dried and eluted in 50 ll of RNase-free water. RNA quantification was measured in a Nanodrop photometer IMPLENÒ at 260 nm wavelength. All extracted RNA was kept at 80 °C.
150
2.4. Reverse transcription PCR (RT-PCR)
154
Total RNA (1 lg) was reverse transcribed using the OmniscriptÒ reverse transcription kit following the manufacturer’s protocol (Qiagen). Synthesized cDNA was stored at 20 °C for further use.
155
2.5. Amplification of the H. contortus Hco-Pgp-2 cDNA sequence
158
Haemonchus contortus Pgp-2 sequence (Xu et al., 1998) was obtained from GenBank (Accession number: AF 003908.1). Specific primers to amplify the full-length sequence were designed using the software Gene runner, version 3.05 (http://www.generunner. net). These primers were: forward 50 GTCACAAGCTTGCCACCATGGTCGAAAAAGGCCAAGA0 3, including a Kozak sequence, underlined around the start codon, in bold (Kozak, 1987) and reverse primer 50 TCATTGTGATTCAACGAGTCGT0 3, including a stop codon, underlined as above. A PCR with these primers and cDNA template synthesized from H. contortus RNA was used to clone the full-length coding sequence.
159
117
are H. contortus P-glycoprotein-2 (Hco-PGP-2) (Blackhall et al., 1998; Xu et al., 1998) and its ortholog in Caenorhabditis elegans (Cel-PGP-2) (James and Davey, 2009). PGPs belong to the super family of ABC transporters that efflux different substrates including lipophilic drugs such as MLs (Pouliot et al., 1997; Schinkel and Jonker, 2003). Structurally, PGPs are conformed by two halves linked by a hydrophilic region (Choi, 2005). Each half has six transmembrane domains (TMD) and an intra-cytoplasmic nucleotide-binding domain (NBD), which contributes to the ATP-binding, hydrolysis and further activation of the transporter (Litman et al., 2001). There are many ABC transporters in nematodes and the roles of specific nematode ABC transporters in ML resistance are still unclear. Some of these membrane proteins could facilitate drug efflux from cells, decreasing the concentration of the drug inside the parasite and therefore the concentration of anthelmintic available to kill the parasite (Lespine et al., 2008). This role is suggested by observations that mammalian ABC transporter activity can be strongly inhibited by the avermectin MLs (Lespine et al., 2007; Brayden and Griffin, 2008). Hco-Pgp-2 was the first parasitic nematode PGP to be cloned and implicated in IVM resistance through genetic association and gene expression (Blackhall et al., 1998; Xu et al., 1998) and therefore characterisation of the expressed protein is of particular interest. The aim of this study was to characterise the effect of MLs on Hco-PGP-2 and to establish where this nematode transporter is expressed in H. contortus. This information may help to elucidate mechanisms of ML resistance in H. contortus.
2.6. Cloning of H. contortus Pgp-2
170
118
2. Materials and methods
The Hco-Pgp-2 PCR product was cloned into the pJET 2.1 vector. Transformation was carried out in Escherichia coli TOP10F’ competent cells. Colonies were screened by PCR and restriction digest analysis. Positive colonies were sequenced by Genome Quebec (McGill University, QC, Canada) to confirm the specific Hco-Pgp-2 full-length cDNA sequence. After sequencing, the Hco-Pgp-2 coding sequence was ligated into a mammalian expression vector, pcDNA 3.1(+), using restriction sites NotI and XbaI. To further improve expression in mammalian cells, the Hco-Pgp-2/pcDNA 3.1(+) construct was codon optimised by GenScript (Piscataway, NJ, USA) for the pig cell host. Finally, this construct was sequenced to confirm the codon optimised Hco-Pgp-2/pcDNA 3.1(+) and in-frame reading for expression.
171
2.7. Stable transfection in mammalian cells
185
The heterologous expression system, LLC-PK1 cells, was used. This cell line has been reported to have low drug transport activity due to low endogenous levels of PGP and multi-drug resistant protein (MRP), making it suitable for over-expression of nematode ABC transporters in drug transport studies (Goh et al., 2002; Lespine et al., 2007). Briefly, LLC-PK1 parental cells were seeded on 24 well plates (2 105 cells/ well) and grown in 199 medium supplemented with 10% FCS and penicillin/streptomycin (100 units/ml and 100 lg/ml, respectively). Cells close to 100% confluency were transfected with 18 lg of plasmid DNA using Lipofectamine 2000Ò, following the manufacturer’s instructions (Life Technologies). In parallel, as a positive control for transfection, the Chloramphenicol Acetyltransferase (CAT) gene was simultaneously transfected into these cells. Twenty-four hours after transfection, the transfection media was replaced and cells incubated with supplemented 199 medium. Forty-eight hours after transfection, the cells were washed, collected and counted in order to seed them to 25% confluency in 24 well plates under selection pressure of G418 or neomycin (Geneticin) at 400 mg/l. After several weeks of selection, stably transformed colonies were collected individually and transferred to new culture flasks.
186
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116
119
2.1. Worms
127
Haemonchus contortus PF susceptible strain (Ranjan et al., 2002) was used. Briefly, worms were collected from the abomasum of sheep and incubated in PBS for 2 h at 37 °C. Worms were originally supplied by Fort Dodge Animal Health, Princeton, NJ, USA and are maintained by our laboratory. Animals and standardised operating procedures used in this research study were approved (Protocol 3845) and subjected to the guidelines from the Animal Care Committee of McGill University, Canada.
128
2.2. Cells and reagents
129
146
An aliquot of adherent parental epithelial-like pig kidney cell (LLC-PK1) (Hull et al., 1976) and a transgenic cell line overexpressing the mdr1a gene (coding for mouse PGP or MDR1A) called mdr1a/LLC-PK1 were gifts from Dr. A. H. Schinckel (Netherlands Cancer Institute, Netherlands). Hank’s Balanced Salt Solution (HBSS) media, 199 media, FCS, Lipofectamine 2000Ò , G418, penicillin/streptomycin, TOP10F’competent cells, TrizolÒ , pcDNA 3.1(+) mammalian expression vector, Rhodamine 123, Calcein-AM; secondary antibodies Alexa fluor 488Ò , Alexa fluor 633 F(ab0 )2 and DAPI were purchased from Life Technologies (ON, Canada). RNeasyÒ kit, OmniscriptÒ reverse-transcription kit, SYBR Green were obtained from Qiagen (Germany). Subcloning vector pJET 2.1 was from Fermentas (ON, Canada). Moxidectin was a gift from Fort Dodge Animal Health. IVM, ABA and all the listed chemicals were from Sigma–Aldrich (ON, Canada). SDS–PAGE and Western blot reagents were from BIO-RAD (Hercules, CA, USA). The chemiluminescence kit was from GE Life Sciences (UK) and the bicinchoninic acid (BCA) protein assay kit from Pierce (Rockford, IL, USA).
147
2.3. RNA extraction
148
Worms were homogenised and lysed with the TrizolÒ reagent for RNA extraction according to the manufacturer’s instructions
120 121 122 123 124 125 126
130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145
149
Please cite this article in press as: Godoy, P., et al. Haemonchus contortus P-glycoprotein-2: in situ localisation and characterisation of macrocyclic lactone transport. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.008
151 152 153
156 157
160 161 162 163 164 165 166 167 168 169
172 173 174 175 176 177 178 179 180 181 182 183 184
187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206
PARA 3719
No. of Pages 9, Model 5G
9 December 2014 P. Godoy et al. / International Journal for Parasitology xxx (2014) xxx–xxx
208
Each individual colony was assessed for growth rate, morphological shape and survival under selection with G418.
209
2.8. Expression profile characterisation
207
210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229
230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256
2.8.1. Transcript profile: quantitative Real-Time (qRT)-PCR RNA was extracted from stably transformed cells using the RNeasy extraction kit, following the manufacturer’s instructions as above. Subsequently, a reverse transcription-PCR was done with the extracted RNA. Finally, the synthesized cDNA was used as template for a qRT-PCR with specific primers (see Table 1) for Hco-Pgp-2 and the pig mdr1 (GenBank Accession number: XM_003130205.3). Pig GAPDH was used as a housekeeping gene for normalisation (GenBank Accession number: NM_001206359.1). After serial dilution of the cDNA template, a qRT-PCR was carried out using SYBR Green in a Rotor-Gene thermal cycler (Qiagen) with the following conditions: initial hold at 95 °C for 15 min, then 40 cycles including: 94 °C for 15 s, 57 °C for 30 s for annealing and 72 °C for final extension. Subsequently a melting curve analysis was done for all of the amplified PCR products. Primers for target and housekeeping genes were run in four replicates. After every qRT-PCR run, data were analysed and the efficiency of the reaction estimated according to Livak and Schmittgen, 2001. Relative expression of Hco-Pgp-2 over the endogenous pig mdr1 was obtained based on the 2DD Ct method. 2.8.2. Protein profile: membrane extraction Hco-Pgp-2/LLC-PK1 transfected cells were grown in 75 cm2 flasks until confluent. Cells were collected with a scraper, counted and re-suspended in buffer containing protease inhibitors (1 PBS, pH 7.4; 1 mM phenylmethylsulfonyl fluoride (PMSF); 1 mM EGTA; 10 lg/ml of Leupeptin; 1 lg/ml of Pepstatin A). Cells were aliquoted at 1 106 per vial and kept at 80 °C until further use. Subsequently, cells were washed twice with a solution containing 1 PBS, 1 mM DTT and 1 mM PMSF to a volume of 50 ml. The cell suspension was divided into two tubes (25 ml volume each) and centrifuged at 1000g for 15 min at 4 °C. Each pellet was re-suspended in 25 ml of buffer containing 1 PBS, 1 mM DTT and 1 mM PMSF. Cells were then sonicated three times for 10 s with an amplitude of 40%. Subsequently, cell pellets were centrifuged at 1400g for 15 min at 4 °C. Supernatants were carefully collected and combined in a single tube. This sample was ultra-centrifuged at 135,000g for 60 min at 4 °C. The supernatant was discarded and the pellet re-suspended in 2.5 ml of a solution containing 1 PBS, 1 mM DTT and 1 mM MgCl2. Finally, the protein concentration from isolated membranes was quantified by the BCA protein assay method and kept at 80 °C. In parallel, an aliquot of whole crude membrane extract from H. contortus worms was isolated. Fifty H. contortus adult worms were homogenised in buffer containing 1 PBS, pH 7.4; 1 mM PMSF; 1 mM EGTA; 10 lg/ml of Leupeptin and 1 lg/ml of Pepstatin A. The solution was centrifuged at 45,000g for 15 min at 4 °C, the supernatant was recovered and centrifuged again at 45,000g for
Table 1 Primers used for quantitative Real-Time-PCR on Haemonchus contortus P-glycoprotein 2/epithelial-like pig (Sus scrofa) kidney cell (Hco-Pgp-2/LLC-PK1) transfected cells. Primer name
Nucleotide sequence
Hco-Pgp-2 Forward Hco-Pgp-2 Reverse Sus scrofa GAPDH Forward Sus scrofa GAPDH Reverse Sus scrofa mdr1 Forward Sus scrofa mdr1 Reverse
TCG ATA TTC AGC AGA CCG GC AAG AGT AGG CAA ACC CCA CG AAC TGC TTG GCA CCC CTG TTG GCA GCG CCG GTA GAA TGC CAC CAC GAT AGC TGA GAA CAT ATG GCG ATT CTC TGC TTC GTC CA
GAPDH, glyceraldehyde 3-phosphate dehydrogenase; mdr1, pig P-glycoprotein.
3
15 min at 4 °C. The supernatant was carefully recovered and sonicated three times for 10 s with an amplitude of 40%. Finally, the sample was ultra-centrifuged at 135,000g for 60 min at 4 °C, the pellet was recovered and re-suspended in PBS, 1 mM DTT, 1 mM MgCl2, 0.5% Triton X-100 for further protein quantitation by the BCA protein assay method. Samples were kept at 80 °C until required for separation on SDS–PAGE.
257
2.8.3. Specific antibody preparation and Western blot Specific polypeptides (Supplementary Data S1) were synthesized from the H. contortus PGP-2 amino acid sequence, following analysis for Hco-PGP-2 specificity and suitability for antibody generation by 21st Century Biotech. Inc., (Marlborough, MA, USA), and used to immunise rabbits. The purified antibody was tested using purified Hco-PGP-2 polypeptide epitopes for specificity by ELISA and dot blot. Membrane protein fractions previously obtained from Hco-Pgp-2/LLC-PK1, CAT/LLCPK1 control cells and H. contortus worms were separated in a 4.5%-10% polyacrylamide gradient gel. Proteins were transferred by the semi-dry system to a polyvinylidene fluoride (PVDF) membrane at 25 V for 25 min. The membrane was blocked overnight at 4 °C in 5% skim milk blocking solution with 0.05% Tween-20Ò. Then the membrane was washed thoroughly in Tris-buffered saline (TBS) with 0.05% Tween-20Ò. The membrane was then incubated with anti-Hco-PGP-2 antibody, at 1/500 dilution, overnight at 4 °C. After several washes, the membrane was incubated with antirabbit secondary antibody conjugated to horseradish peroxidase in a 1/5000 dilution at room temperature for 1 h. After washing, the membrane was developed using a chemiluminescence kit and X-Omat films.
264
2.8.4. Immunofluorescence assay (IFA) on Hco-Pgp-2/LLC-PK1 transfectants Hco-Pgp-2/LLC-PK1 transfectants were grown on coverslips to 70% confluency. Cells were then fixed with 4% paraformaldehyde (PAFOH). The fixed cells were washed and blocked with 3% BSA for 1 h at room temperature. The cells were subsequently washed and incubated with the anti-Hco-PGP-2 antibody at 1/50 dilution overnight at 4 °C in the dark. The cells were then incubated with Alexa FluorÒ 488 secondary antibody in 1/3000 dilution for 45 min at room temperature in the dark. The cells were washed and incubated with nucleic DAPI medium for 4 min at room temperature in the dark. Following this, the cells were washed and mounted on a slide with mounting media and sealed with nail polish. After overnight incubation, stained cells were examined under an ECLIPSE Ti inverted epifluorescence microscope (Nikon, Melville, NY, USA) at 488 nm excitation and 519 nm emission. Images obtained with different dyes were merged using ImageJ software (http://imagej.nih.gov/ij/).
286
2.9. Transport assays in transgenic cells expressing Hco-PGP-2s
304
In order to measure PGP transport activity, Hco-Pgp-2/LLC-PK1 transfected cells were tested with either Rhodamine 123 (Rho123) (Lespine et al., 2007) or Calcein-AM (acetomethoxy derivative) (Feller et al., 1995) as substrates for efflux assessment. Cells were plated in 24 well plates in G418-free medium until confluent. Cells were then incubated in HBSS media, 1% BSA containing 10 lM Rho123 or 1 lM Calcein-AM with or without increasing concentrations of the endectocides: IVM, ABA or MOX (0.00625– 20 lM). Additionally, the cyclosporin A analogue, valspodar (VSP or PSC833) (kindly provided by Novartis Animal Health, Switzerland) was used as a maximum reference inhibitor of Hco-PGP-2 transport function since this compound is a slow transport substrate for MDR1 (Smith et al., 1998).
305
Please cite this article in press as: Godoy, P., et al. Haemonchus contortus P-glycoprotein-2: in situ localisation and characterisation of macrocyclic lactone transport. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.008
258 259 260 261 262 263
265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285
287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303
306 307 308 309 310 311 312 313 314 315 316 317
PARA 3719
No. of Pages 9, Model 5G
9 December 2014 4 318 319 320 321 322 323 324 325
326 327 328 329 330 331 332
P. Godoy et al. / International Journal for Parasitology xxx (2014) xxx–xxx
All of the drugs were dissolved in DMSO and diluted in HBSS transport media with a final DMSO concentration of 90%) and avermectin B1b (
No. of Pages 9, Model 5G
9 December 2014 International Journal for Parasitology xxx (2014) xxx–xxx 1
Contents lists available at ScienceDirect
International Journal for Parasitology journal homepage: www.elsevier.com/locate/ijpara 5 6
Haemonchus contortus P-glycoprotein-2: in situ localisation and characterisation of macrocyclic lactone transport
3 4 7 8 10 9 11 1 2 3 9 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28
Q1
Pablo Godoy, Jing Lian, Robin N. Beech, Roger K. Prichard ⇑ Institute of Parasitology, Macdonald Campus, McGill University, 21,111 Lakeshore Road, Ste-Anne-de-Bellevue, H9X3V9 QC, Canada
a r t i c l e
i n f o
Article history: Received 23 July 2014 Received in revised form 23 September 2014 Accepted 24 September 2014 Available online xxxx Keywords: Anthelmintic resistance Nematode P-glycoprotein Heterologous expression system Macrocyclic lactones Ivermectin Moxidectin Transport studies Protein localisation
a b s t r a c t Haemonchus contortus is a veterinary nematode that infects small ruminants, causing serious decreases in animal production worldwide. Effective control through anthelmintic treatment has been compromised by the development of resistance to these drugs, including the macrocyclic lactones. The mechanisms of resistance in H. contortus have yet to be established but may involve efflux of the macrocyclic lactones by nematode ATP-binding-cassette transporters such as P-glycoproteins. Here we report the expression and functional activity of H. contortus P-glycoprotein 2 expressed in mammalian cells and characterise its interaction with the macrocyclic lactones, ivermectin, abamectin and moxidectin. The ability of H. contortus P-glycoprotein 2 to transport different fluorophore substrates was markedly inhibited by ivermectin and abamectin in a dose-dependent and saturable way. The profile of transport inhibition by moxidectin was markedly different. H. contortus P-glycoprotein 2 was expressed in the pharynx, the first portion of the worm’s intestine and perhaps in adjacent nervous tissue, suggesting a role for this gene in regulating the uptake of avermectins and in protecting nematode tissues from the effects of macrocyclic lactone anthelmintic drugs. H. contortus P-glycoprotein 2 may thus contribute to resistance to these drugs in H. contortus. Ó 2014 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc.
30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
1. Introduction Gastrointestinal (GI) nematodes such as Haemonchus contortus represent a significant threat to animal welfare in livestock production. In the United Kingdom (UK), for example, parasitic worms cause significant losses in small ruminants estimated to be approximately GBP 84 million/annum (Nieuwhof and Bishop, 2005). Haemonchus contortus is distributed globally and found in tropical to cool temperate areas (Peter and Chandrawathani, 2005). Anthelmintic drugs such as levamisole (LEV), benzimidazoles (BZs) and the macrocyclic lactones (MLs) have been used as important broad spectrum anthelmintics to control parasitic nematodes (Kaplan and Vidyashankar, 2012). MLs are used extensively in animal and human health (Geary, 2005; Prichard et al., 2012) and represent the cornerstone of current anthelmintic drug treatment, having remarkable endectocide efficacy against GI nematodes as well as ectoparasites such as lice, ticks and scabies (Miller et al., 1994; Q2 George et al., 2004; Taylor, 2012). MLs are large hydrophobic molecules characterised by a 16-member macrocyclic ring as a shared structural component (Lespine et al., 2007). The MLs are comprised
⇑ Corresponding author. Tel.: +1 514 398 7729; fax: +1 514 398 7957. E-mail address: [email protected] (R.N. Beech).
of two sub-groups, the avermectins including ivermectin (IVM), abamectin (ABA), doramectin, eprinomectin and selamectin characterised by the presence of sugar residues attached in the C13 position of the macrocyclic ring (Shoop et al., 1995) and the milbemycins, including moxidectin (MOX) and milbemycin oxime that are protonated at the C13 position and lack sugar moieties (Mishima et al., 1983). MLs have a safety profile with a wide therapeutic index, are administered easily and have long lasting effects inside the host (Lespine et al., 2008). These anthelmintic drugs target glutamate-gated chloride channels (GluCls) present in nematodes, leading to flaccid paralysis of the worm muscles (Cully et al., 1994; McCavera et al., 2009). Despite their excellent efficacy against parasitic nematodes, resistance has arisen, initially against the avermectins, including IVM and ABA (Kaplan, 2004; Kaminsky et al., 2010), and more recently to MOX (Sargison et al., 2010; Van den Brom et al., 2013). There is consistent evidence that ATP-binding-cassette (ABC) transporters in nematodes, such as P-glycoprotein (PGP), can actively efflux the MLs and protect worms from their pharmacological action (Kerboeuf et al., 2003; Lespine et al., 2012). In H. contortus and other veterinary nematodes, an up-regulation of these PGPs has been described in resistant parasites (Xu et al., 1998; Prichard and Roulet, 2007; Dicker et al., 2011; Areskog et al., 2013; Janssen et al., 2013; Kotze et al., 2014). Among the transporters implicated in ML resistance
http://dx.doi.org/10.1016/j.ijpara.2014.09.008 0020-7519/Ó 2014 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc.
Please cite this article in press as: Godoy, P., et al. Haemonchus contortus P-glycoprotein-2: in situ localisation and characterisation of macrocyclic lactone transport. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.008
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90
PARA 3719
No. of Pages 9, Model 5G
9 December 2014 2
P. Godoy et al. / International Journal for Parasitology xxx (2014) xxx–xxx
(Life Technologies, ON, Canada). The RNA pellet obtained was dried and eluted in 50 ll of RNase-free water. RNA quantification was measured in a Nanodrop photometer IMPLENÒ at 260 nm wavelength. All extracted RNA was kept at 80 °C.
150
2.4. Reverse transcription PCR (RT-PCR)
154
Total RNA (1 lg) was reverse transcribed using the OmniscriptÒ reverse transcription kit following the manufacturer’s protocol (Qiagen). Synthesized cDNA was stored at 20 °C for further use.
155
2.5. Amplification of the H. contortus Hco-Pgp-2 cDNA sequence
158
Haemonchus contortus Pgp-2 sequence (Xu et al., 1998) was obtained from GenBank (Accession number: AF 003908.1). Specific primers to amplify the full-length sequence were designed using the software Gene runner, version 3.05 (http://www.generunner. net). These primers were: forward 50 GTCACAAGCTTGCCACCATGGTCGAAAAAGGCCAAGA0 3, including a Kozak sequence, underlined around the start codon, in bold (Kozak, 1987) and reverse primer 50 TCATTGTGATTCAACGAGTCGT0 3, including a stop codon, underlined as above. A PCR with these primers and cDNA template synthesized from H. contortus RNA was used to clone the full-length coding sequence.
159
117
are H. contortus P-glycoprotein-2 (Hco-PGP-2) (Blackhall et al., 1998; Xu et al., 1998) and its ortholog in Caenorhabditis elegans (Cel-PGP-2) (James and Davey, 2009). PGPs belong to the super family of ABC transporters that efflux different substrates including lipophilic drugs such as MLs (Pouliot et al., 1997; Schinkel and Jonker, 2003). Structurally, PGPs are conformed by two halves linked by a hydrophilic region (Choi, 2005). Each half has six transmembrane domains (TMD) and an intra-cytoplasmic nucleotide-binding domain (NBD), which contributes to the ATP-binding, hydrolysis and further activation of the transporter (Litman et al., 2001). There are many ABC transporters in nematodes and the roles of specific nematode ABC transporters in ML resistance are still unclear. Some of these membrane proteins could facilitate drug efflux from cells, decreasing the concentration of the drug inside the parasite and therefore the concentration of anthelmintic available to kill the parasite (Lespine et al., 2008). This role is suggested by observations that mammalian ABC transporter activity can be strongly inhibited by the avermectin MLs (Lespine et al., 2007; Brayden and Griffin, 2008). Hco-Pgp-2 was the first parasitic nematode PGP to be cloned and implicated in IVM resistance through genetic association and gene expression (Blackhall et al., 1998; Xu et al., 1998) and therefore characterisation of the expressed protein is of particular interest. The aim of this study was to characterise the effect of MLs on Hco-PGP-2 and to establish where this nematode transporter is expressed in H. contortus. This information may help to elucidate mechanisms of ML resistance in H. contortus.
2.6. Cloning of H. contortus Pgp-2
170
118
2. Materials and methods
The Hco-Pgp-2 PCR product was cloned into the pJET 2.1 vector. Transformation was carried out in Escherichia coli TOP10F’ competent cells. Colonies were screened by PCR and restriction digest analysis. Positive colonies were sequenced by Genome Quebec (McGill University, QC, Canada) to confirm the specific Hco-Pgp-2 full-length cDNA sequence. After sequencing, the Hco-Pgp-2 coding sequence was ligated into a mammalian expression vector, pcDNA 3.1(+), using restriction sites NotI and XbaI. To further improve expression in mammalian cells, the Hco-Pgp-2/pcDNA 3.1(+) construct was codon optimised by GenScript (Piscataway, NJ, USA) for the pig cell host. Finally, this construct was sequenced to confirm the codon optimised Hco-Pgp-2/pcDNA 3.1(+) and in-frame reading for expression.
171
2.7. Stable transfection in mammalian cells
185
The heterologous expression system, LLC-PK1 cells, was used. This cell line has been reported to have low drug transport activity due to low endogenous levels of PGP and multi-drug resistant protein (MRP), making it suitable for over-expression of nematode ABC transporters in drug transport studies (Goh et al., 2002; Lespine et al., 2007). Briefly, LLC-PK1 parental cells were seeded on 24 well plates (2 105 cells/ well) and grown in 199 medium supplemented with 10% FCS and penicillin/streptomycin (100 units/ml and 100 lg/ml, respectively). Cells close to 100% confluency were transfected with 18 lg of plasmid DNA using Lipofectamine 2000Ò, following the manufacturer’s instructions (Life Technologies). In parallel, as a positive control for transfection, the Chloramphenicol Acetyltransferase (CAT) gene was simultaneously transfected into these cells. Twenty-four hours after transfection, the transfection media was replaced and cells incubated with supplemented 199 medium. Forty-eight hours after transfection, the cells were washed, collected and counted in order to seed them to 25% confluency in 24 well plates under selection pressure of G418 or neomycin (Geneticin) at 400 mg/l. After several weeks of selection, stably transformed colonies were collected individually and transferred to new culture flasks.
186
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116
119
2.1. Worms
127
Haemonchus contortus PF susceptible strain (Ranjan et al., 2002) was used. Briefly, worms were collected from the abomasum of sheep and incubated in PBS for 2 h at 37 °C. Worms were originally supplied by Fort Dodge Animal Health, Princeton, NJ, USA and are maintained by our laboratory. Animals and standardised operating procedures used in this research study were approved (Protocol 3845) and subjected to the guidelines from the Animal Care Committee of McGill University, Canada.
128
2.2. Cells and reagents
129
146
An aliquot of adherent parental epithelial-like pig kidney cell (LLC-PK1) (Hull et al., 1976) and a transgenic cell line overexpressing the mdr1a gene (coding for mouse PGP or MDR1A) called mdr1a/LLC-PK1 were gifts from Dr. A. H. Schinckel (Netherlands Cancer Institute, Netherlands). Hank’s Balanced Salt Solution (HBSS) media, 199 media, FCS, Lipofectamine 2000Ò , G418, penicillin/streptomycin, TOP10F’competent cells, TrizolÒ , pcDNA 3.1(+) mammalian expression vector, Rhodamine 123, Calcein-AM; secondary antibodies Alexa fluor 488Ò , Alexa fluor 633 F(ab0 )2 and DAPI were purchased from Life Technologies (ON, Canada). RNeasyÒ kit, OmniscriptÒ reverse-transcription kit, SYBR Green were obtained from Qiagen (Germany). Subcloning vector pJET 2.1 was from Fermentas (ON, Canada). Moxidectin was a gift from Fort Dodge Animal Health. IVM, ABA and all the listed chemicals were from Sigma–Aldrich (ON, Canada). SDS–PAGE and Western blot reagents were from BIO-RAD (Hercules, CA, USA). The chemiluminescence kit was from GE Life Sciences (UK) and the bicinchoninic acid (BCA) protein assay kit from Pierce (Rockford, IL, USA).
147
2.3. RNA extraction
148
Worms were homogenised and lysed with the TrizolÒ reagent for RNA extraction according to the manufacturer’s instructions
120 121 122 123 124 125 126
130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145
149
Please cite this article in press as: Godoy, P., et al. Haemonchus contortus P-glycoprotein-2: in situ localisation and characterisation of macrocyclic lactone transport. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.008
151 152 153
156 157
160 161 162 163 164 165 166 167 168 169
172 173 174 175 176 177 178 179 180 181 182 183 184
187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206
PARA 3719
No. of Pages 9, Model 5G
9 December 2014 P. Godoy et al. / International Journal for Parasitology xxx (2014) xxx–xxx
208
Each individual colony was assessed for growth rate, morphological shape and survival under selection with G418.
209
2.8. Expression profile characterisation
207
210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229
230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256
2.8.1. Transcript profile: quantitative Real-Time (qRT)-PCR RNA was extracted from stably transformed cells using the RNeasy extraction kit, following the manufacturer’s instructions as above. Subsequently, a reverse transcription-PCR was done with the extracted RNA. Finally, the synthesized cDNA was used as template for a qRT-PCR with specific primers (see Table 1) for Hco-Pgp-2 and the pig mdr1 (GenBank Accession number: XM_003130205.3). Pig GAPDH was used as a housekeeping gene for normalisation (GenBank Accession number: NM_001206359.1). After serial dilution of the cDNA template, a qRT-PCR was carried out using SYBR Green in a Rotor-Gene thermal cycler (Qiagen) with the following conditions: initial hold at 95 °C for 15 min, then 40 cycles including: 94 °C for 15 s, 57 °C for 30 s for annealing and 72 °C for final extension. Subsequently a melting curve analysis was done for all of the amplified PCR products. Primers for target and housekeeping genes were run in four replicates. After every qRT-PCR run, data were analysed and the efficiency of the reaction estimated according to Livak and Schmittgen, 2001. Relative expression of Hco-Pgp-2 over the endogenous pig mdr1 was obtained based on the 2DD Ct method. 2.8.2. Protein profile: membrane extraction Hco-Pgp-2/LLC-PK1 transfected cells were grown in 75 cm2 flasks until confluent. Cells were collected with a scraper, counted and re-suspended in buffer containing protease inhibitors (1 PBS, pH 7.4; 1 mM phenylmethylsulfonyl fluoride (PMSF); 1 mM EGTA; 10 lg/ml of Leupeptin; 1 lg/ml of Pepstatin A). Cells were aliquoted at 1 106 per vial and kept at 80 °C until further use. Subsequently, cells were washed twice with a solution containing 1 PBS, 1 mM DTT and 1 mM PMSF to a volume of 50 ml. The cell suspension was divided into two tubes (25 ml volume each) and centrifuged at 1000g for 15 min at 4 °C. Each pellet was re-suspended in 25 ml of buffer containing 1 PBS, 1 mM DTT and 1 mM PMSF. Cells were then sonicated three times for 10 s with an amplitude of 40%. Subsequently, cell pellets were centrifuged at 1400g for 15 min at 4 °C. Supernatants were carefully collected and combined in a single tube. This sample was ultra-centrifuged at 135,000g for 60 min at 4 °C. The supernatant was discarded and the pellet re-suspended in 2.5 ml of a solution containing 1 PBS, 1 mM DTT and 1 mM MgCl2. Finally, the protein concentration from isolated membranes was quantified by the BCA protein assay method and kept at 80 °C. In parallel, an aliquot of whole crude membrane extract from H. contortus worms was isolated. Fifty H. contortus adult worms were homogenised in buffer containing 1 PBS, pH 7.4; 1 mM PMSF; 1 mM EGTA; 10 lg/ml of Leupeptin and 1 lg/ml of Pepstatin A. The solution was centrifuged at 45,000g for 15 min at 4 °C, the supernatant was recovered and centrifuged again at 45,000g for
Table 1 Primers used for quantitative Real-Time-PCR on Haemonchus contortus P-glycoprotein 2/epithelial-like pig (Sus scrofa) kidney cell (Hco-Pgp-2/LLC-PK1) transfected cells. Primer name
Nucleotide sequence
Hco-Pgp-2 Forward Hco-Pgp-2 Reverse Sus scrofa GAPDH Forward Sus scrofa GAPDH Reverse Sus scrofa mdr1 Forward Sus scrofa mdr1 Reverse
TCG ATA TTC AGC AGA CCG GC AAG AGT AGG CAA ACC CCA CG AAC TGC TTG GCA CCC CTG TTG GCA GCG CCG GTA GAA TGC CAC CAC GAT AGC TGA GAA CAT ATG GCG ATT CTC TGC TTC GTC CA
GAPDH, glyceraldehyde 3-phosphate dehydrogenase; mdr1, pig P-glycoprotein.
3
15 min at 4 °C. The supernatant was carefully recovered and sonicated three times for 10 s with an amplitude of 40%. Finally, the sample was ultra-centrifuged at 135,000g for 60 min at 4 °C, the pellet was recovered and re-suspended in PBS, 1 mM DTT, 1 mM MgCl2, 0.5% Triton X-100 for further protein quantitation by the BCA protein assay method. Samples were kept at 80 °C until required for separation on SDS–PAGE.
257
2.8.3. Specific antibody preparation and Western blot Specific polypeptides (Supplementary Data S1) were synthesized from the H. contortus PGP-2 amino acid sequence, following analysis for Hco-PGP-2 specificity and suitability for antibody generation by 21st Century Biotech. Inc., (Marlborough, MA, USA), and used to immunise rabbits. The purified antibody was tested using purified Hco-PGP-2 polypeptide epitopes for specificity by ELISA and dot blot. Membrane protein fractions previously obtained from Hco-Pgp-2/LLC-PK1, CAT/LLCPK1 control cells and H. contortus worms were separated in a 4.5%-10% polyacrylamide gradient gel. Proteins were transferred by the semi-dry system to a polyvinylidene fluoride (PVDF) membrane at 25 V for 25 min. The membrane was blocked overnight at 4 °C in 5% skim milk blocking solution with 0.05% Tween-20Ò. Then the membrane was washed thoroughly in Tris-buffered saline (TBS) with 0.05% Tween-20Ò. The membrane was then incubated with anti-Hco-PGP-2 antibody, at 1/500 dilution, overnight at 4 °C. After several washes, the membrane was incubated with antirabbit secondary antibody conjugated to horseradish peroxidase in a 1/5000 dilution at room temperature for 1 h. After washing, the membrane was developed using a chemiluminescence kit and X-Omat films.
264
2.8.4. Immunofluorescence assay (IFA) on Hco-Pgp-2/LLC-PK1 transfectants Hco-Pgp-2/LLC-PK1 transfectants were grown on coverslips to 70% confluency. Cells were then fixed with 4% paraformaldehyde (PAFOH). The fixed cells were washed and blocked with 3% BSA for 1 h at room temperature. The cells were subsequently washed and incubated with the anti-Hco-PGP-2 antibody at 1/50 dilution overnight at 4 °C in the dark. The cells were then incubated with Alexa FluorÒ 488 secondary antibody in 1/3000 dilution for 45 min at room temperature in the dark. The cells were washed and incubated with nucleic DAPI medium for 4 min at room temperature in the dark. Following this, the cells were washed and mounted on a slide with mounting media and sealed with nail polish. After overnight incubation, stained cells were examined under an ECLIPSE Ti inverted epifluorescence microscope (Nikon, Melville, NY, USA) at 488 nm excitation and 519 nm emission. Images obtained with different dyes were merged using ImageJ software (http://imagej.nih.gov/ij/).
286
2.9. Transport assays in transgenic cells expressing Hco-PGP-2s
304
In order to measure PGP transport activity, Hco-Pgp-2/LLC-PK1 transfected cells were tested with either Rhodamine 123 (Rho123) (Lespine et al., 2007) or Calcein-AM (acetomethoxy derivative) (Feller et al., 1995) as substrates for efflux assessment. Cells were plated in 24 well plates in G418-free medium until confluent. Cells were then incubated in HBSS media, 1% BSA containing 10 lM Rho123 or 1 lM Calcein-AM with or without increasing concentrations of the endectocides: IVM, ABA or MOX (0.00625– 20 lM). Additionally, the cyclosporin A analogue, valspodar (VSP or PSC833) (kindly provided by Novartis Animal Health, Switzerland) was used as a maximum reference inhibitor of Hco-PGP-2 transport function since this compound is a slow transport substrate for MDR1 (Smith et al., 1998).
305
Please cite this article in press as: Godoy, P., et al. Haemonchus contortus P-glycoprotein-2: in situ localisation and characterisation of macrocyclic lactone transport. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.008
258 259 260 261 262 263
265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285
287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303
306 307 308 309 310 311 312 313 314 315 316 317
PARA 3719
No. of Pages 9, Model 5G
9 December 2014 4 318 319 320 321 322 323 324 325
326 327 328 329 330 331 332
P. Godoy et al. / International Journal for Parasitology xxx (2014) xxx–xxx
All of the drugs were dissolved in DMSO and diluted in HBSS transport media with a final DMSO concentration of 90%) and avermectin B1b (
