Lasers in Surgery and Medicine 47:433–440 (2015)
Hair Regrowth Through Wound Healing Process After Ablative Fractional Laser Treatment in a Murine Model Jung Min Bae, MD,1 Han Mi Jung, MD,1 Boncheol Goo, MD, PhD,2 and Young Min Park, MD, PhD3 Department of Dermatology, St. Vincent’s Hospital, College of Medicine, The Catholic University of Korea, Suwon, Korea 2 Clinique L, Goyang, Korea 3 Department of Dermatology, Seoul St. Mary’s Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
1
Background and Objective: Alopecia is one of the most common dermatological problems in the elderly; however, current therapies for it are limited by low efficacy and undesirable side effects. Although clinical reports on fractional laser treatment for various alopecia types are increasing, the exact mechanism remains to be clarified. The purposes of this study were to demonstrate the effect of ablative fractional laser treatment on hair follicle regrowth in vivo and investigate the molecular mechanism after laser treatment. Materials and Methods: Ablative CO2 fractional laser was applied to the shaved dorsal skin of 7-week-old C57BL/ 6 mice whose hair was in the telogen stage. After 12 mice were treated at various energy (10–40 mJ/spot) and density (100–400 spots/cm2) settings to determine the proper dosage for maximal effect. Six mice were then treated at the decided dosage and skin specimens were sequentially obtained by excision biopsy from the dorsal aspect of each mouse. Tissue samples were used for the immunohistochemistry and reverse transcription polymerase chain reaction assays to examine hair follicle status and their related molecules. Results: The most effective dosage was the 10 mJ/spot and 300 spots/cm2 setting. The anagen conversion of hair was observed in the histopathological examination, while Wnt/ b-catenin expression was associated with hair regrowth in the immunohistochemistry and molecular studies. Conclusions: Ablative fractional lasers appear to be effective for inducing hair regrowth via activation of the Wnt/b-catenin pathway in vivo. Our findings indicate that fractional laser treatment can potentially be developed as new treatment options for stimulating hair regrowth. Lasers Surg. Med. 47:433–440, 2015. ß 2015 Wiley Periodicals, Inc. Key words: androgenic alopecia; alopecia; fractional laser; hair follicle; hair loss; laser
INTRODUCTION Androgenic alopecia is the most common hair problem, affecting 50% of men and nearly 50% of women by 50 years of ß 2015 Wiley Periodicals, Inc.
age [1]. Hair is considered an essential part of one’s overall identity, so hair loss (alopecia) creates enormous psychological and emotional distress for affected people. However, current medical treatments for androgenic alopecia including topical minoxidil and oral finasteride are limited by low efficacy and undesirable adverse effects [1]. Although hair transplantation can be considered for severe hair loss, its usefulness is limited by patient budgets and surgical burdens. Therefore, new and effective treatment modalities are needed for the treatment of hair loss. The fractional laser produces a microthermal zone and creates numerous tiny columns of thermal injury within the skin [2]. Sparing the normal surrounding the pixelated microthermal zones induces a rapid wound-healing response. Re-epithelialization usually occurred within the first 24 hours via keratinocyte migration from the surrounding normal tissue of the microthermal zones, and the persistent dermal collagen remodeling response lasted at least 3 months after fractional laser treatment [3]. Most published indications of non-ablative and ablative fractional lasers are skin laxity, acne scarring, fine wrinkles, and photoaging [2,4,5]. These treatment effects are associated with the neocollagen formation via peculiar and robust wound healing process after fractional laser treatment [6]. Interest is increasing in the potential role of laser/lightbased treatments for hair loss [7]. Fractional laser treatments for androgenic alopecia have recently been reported in succession. The 1,550 nm fractional erbium–glass laser was shown effective for male pattern [8] and female
Conflict of Interest Disclosures: All authors have completed and submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest and none were reported. Contract grant sponsor: Ministry of Science, ICT & Future Planning; Contract grant number: NRF-2014R1A1A1036218. Correspondence to: Young Min Park, MD, PhD, Department of Dermatology, Seoul St. Mary’s Hospital, College of Medicine, The Catholic University of Korea, 222 Banpodae-ro, Seocho-gu, Seoul, 137-701, Korea. E-mail: [email protected] Accepted 15 March 2015 Published online 6 May 2015 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/lsm.22358
434
BAE ET AL.
pattern hair loss [9]. In one case series of 17 patients with various hair disorders, the fractional laser was shown to be effective in ophiasis, wooly hair/hypotrichosis, secondary cicatrical alopecia, pubic hypotrichosis, frontal fibrosing alopecia, and perifolliculitis capitis abscedens et suffodiens [10]. Collectively, these studies suggest that fractional laser treatment could help induce hair regrowth. However, the effects of fractional laser on hair regrowth have not been thoroughly investigated. Among fractional lasers, the 10,600 nm ablative fractional CO2 laser is considered the most effective since it creates prominent thermal damage [11]. Therefore, we conducted a series of studies using a fractional CO2 laser to explore the exact mechanism of the fractional laser treatment for hair regrowth.
(100 and 200 spots/cm2) (group A, Fig. 1A). Next, six other mice were treated on divided areas of their shaved backs with the combination settings of three energy (10, 20, and 30 mJ/spot) and two densities (200 and 300 spots/cm2) to determine proper dosages for the maximal effect (group B, Fig. 1B). Each irradiation was a square of 1 cm2 at a constant distance (10 mm) above each mouse. Finally, six mice were treated on eight divided areas at the fixed decided dosage (10 mJ/spot, 300 spots/cm2) and skin specimens were serially obtained by excision biopsy from the dorsal aspect of each mouse (group C). Hair growth was evaluated using photography and hand-held dermoscopy. The tissue samples were subjected to immunohistochemistry and reverse-transcription polymerase chain reaction (RT-PCR) assays to determine hair follicle status and their related molecules.
MATERIALS AND METHODS Animals
Quantitative histomorphometry
Six-week-old female C57BL/6 mice were purchased from Daehan Biolink Co. (Chungcheongbuk-do, Korea). All mice were housed for 1 week at 258C and 60% relative humidity to adapt to the new environment. All animal procedures were approved by the Institutional Animal Care and Use Committee of St. Vincent Hospital, The Catholic University of Korea (13-12).
Hair cycle stages were evaluated and classified as described previously using quantitative histomorphometry [12,13]. Fifty hair follicles identified on each section were categorized as being in anagen, telogen, and cataten, and then the average percentage of anagen follicles among individual mice with the same condition were calculated. RT-PCR analysis
Laser treatment At 7 weeks of age, when all hair follicles were in telogen phase, the dorsal hair of the mice was carefully shaved with a hair clipper. First, six mice were irradiated with a 10,600 nm fractional CO2 laser (eCO2, Lutronic, Goyang, Korea) on their shaved backs. Each mouse was treated on six divided areas of its back with the combination settings of three energy (30, 50, and 100 mJ/spot) and two densities
RNA (total 1 mg) from each murine skin sample was prepared using Trizol reagent (Invitrogen, Carlsbad, CA) and cDNA was synthesized using QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The cDNA used for the RT-PCR assay performed using EX taq polymerase (Takara Bio Inc., Otsu, Japan) for 35 cycles of 948C for 45 seconds, 56 608C for 45 seconds, and 728C for 1 minute.
Fig. 1. Diagrams of ablative CO2 fractional laser treatment with various parameters applied to the shaved dorsal skin of mice in group A (A) and group B (B).
HAIR REGROWTH THROUGH WOUND HEALING PROCESS
The primer sequences are listed in Table 1. The PCR product was visualized on a 2% agarose gel and quantified using analysis software (Quantity one 1-D analysis; BioRad, Hercules, CA). Immunohistochemistry Skin tissues were fixed overnight in 4% paraformaldehyde and then, cut into 4 mm sections. After deparaffinization and hydration, antigen retrieval was performed and endogenous peroxidase was inactivated with peroxidase blocking solution (Dako, Glostrup, Denmark). Primary antibodies were incubated at the following dilutions: b-catenin (1:200; Cell Signaling Technology INC., Danvers, MA) and Wnt10b (1:200; Santa Cruz Biotechnology, Inc., Dallas, TX). Primary antibodies were incubated at 48C overnight. After treatment with a secondary antibody, these sections were visualized using a DAB kit (EnVisionTM Detection System, Dako) followed by observation under a light microscope. RESULTS Hair regrowth after ablative CO2 fractional laser treatment In group A, various degrees of hair regrowth were observed after ablative CO2 fractional laser treatment (Fig. 2A). The laser treatment with 200 spot/cm2 was more effective than one with 100 spot/cm2. In the density of 200 spot/cm2, more hair regrowth was observed in the 30 mJ/spot than in the 50 mJ/spot. In group B, the most effective dosage was the 10 mJ/spot and the 300 spot/cm2 setting (Fig. 2B). Excessive energy and density led to scar formation In the 300 spots/cm2, energy > 10 mJ/spot was associated with lower hair regrowth potential and scar tissue formation (group B; Fig. 2C). Telogen-to-anagen conversion after fractional laser treatment Sequential increases in hair regrowth were observed after the fractional laser treatment in the histologic examination (group C; Fig. 3A). Quantitative histomorphometry showed a gradual increase in anagen proportion immediately after the laser treatment, and a marked increase was observed 5 days post-treatment (Fig. 3B).
435
Increases in the mRNA expression of various growth factors and Wnt10b after fractional laser treatment The mRNA expressions of vascular endothelial growth factor (VEGF), transforming growth factor b1 (TGF-b1), and keratinocyte growth factor (KGF) increased immediately after fractional laser treatment (Fig. 4). The mRNA expression of Wnt10b increased insidiously after treatment and continued until 9 days post-treatment. Increases in Wnt10b and b-catenin (B) Expression After Fractional Laser Treatment The increase in Wnt10b expression in the hair follicles was observed on immunohistochemistry analysis after fractional laser treatment (Fig. 5A). The subsequent increase of b-catenin-associated development of hair follicle was observed (Fig. 5B). DISCUSSION Each hair is a repetitively regenerating mini-organ, and the hair cycle typically consists of three stages: growth (anagen), involution (catagen), and rest (telogen) [14]. Hair follicle stem cells are capable of proliferation at the onset of the anagen phase to regenerate the new hair follicle [15]. Most hair follicle stem cells reside in an area called the hair follicle bulge located in the middle portion of the hair follicle [16]. With anagen initiation, hair follicle stem cells in the bulge proliferate and generate transit-amplifying cells, which then differentiate and form the new hair shaft during the anagen phase [17]. Numerous molecular signals have been implicated in the regulation of hair cycling; among them, the Wnt/b-catenin pathway is the primary initiator of the anagen phase [18]. There are various causes of hair loss, which is frequently associated with failure to activate hair follicle stem cells during each hair cycle [19]. Androgenic alopecia in particular, which primarily results from a combination of androgen hyperactivity and genetic predispositions, shows a progressive decrease in anagen duration and a delay in the telogen-to-anagen transition. This process results in follicular miniaturization, the key feature of androgenic alopecia, and a reduced anagen-to-telogen ratio [20]. There is evidence of associations between wound healing and hair follicles. First, hair follicles contribute to a normal wound healing process [21]. Hair follicle stem cells provide progeny, which migrate to the epidermal defect and assist
TABLE 1. Primers Used for Polymerase Chain Reaction Amplification Species
Genes
Forward
Reverse
Tm (8C)
Mouse
VEGFa TGFb1 KGF Wnt10b GAPDH
TTTGACCATCTGCTTTCGTG CAATTCCTGGCGTTACCTTG GACATGGATCCTGCCAACTT CCCGGGACATCCAGGCGAGA CCCCAGCAAGGACACTGAGCAA
TCCAGCTTCCCCAATAGAAC ATTCCGTCTCCTTGGTTCAG AATTCCAACTGCCACTGTCC CTCTGGCGCTGCCCTCCAAC GGCTCCCTAGGCCCCTCCTGTTAT
56 58 56 60 60
Tm, melting temperature; VEGFa, vascular endothelial growth factor-a; TGFb1, transforming growth factor-b1; KGF, keratinocyte growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
436
BAE ET AL.
Fig. 2. Hair regrowth after ablative CO2 fractional laser treatment. (A) Group A showed that the laser treatment with the 200 spot/cm2 was more effective than that with 100 spot/cm2. (B) & (C) In group B, the most effective dosage was 10 mJ/spot at 300 spot/cm2. In the 300 spots/cm2, energy > 10 mJ/spot was associated with lower hair regrowth potential and scar tissue formation.
HAIR REGROWTH THROUGH WOUND HEALING PROCESS
437
Fig. 3. Telogen-to-anagen conversion of the hair follicle after the fractional laser treatment. (A) Sequential increases of hair regrowth were observed ( 200 original magnification, hematoxylin and eosin). (B) Quantitative histomorphometry showing constant increases in anagen proportion after treatment.
with re-epithelialization [22]. Recent studies have shown that cutaneous wound healing is substantially accelerated during the anagen stage of the hair cycle [22]. Conversely, some hair follicles would develop anew after wounding. There have been early observations that hair follicles developed following wounding in rabbits, mice, and even humans [23,24]. It was recently discovered that hair follicles formed de novo in rodents after wounding via activation of Wnt-mediated signaling pathway [25]. The
association of paracrine TGF-b1 signaling and hair follicle stem cell activation was also discovered [26]; however, the “hair growth–wound healing connection” has yet to be thoroughly revealed [22]. In the present study, we showed that anagen hair induction after fractional laser treatment was associated with the Wnt/b-catenin pathway on the murine model. These results were consistent with those of a previous study [8]. We further demonstrated the sequentially
438
BAE ET AL.
Fig. 4. Early increases in growth factors associated with wound healing including vascular
endothelial growth factor (VEGF), transforming growth factor b1 (TGF-b1) and keratinocyte growth factor (KGF), and subsequently increased Wnt10b were observed by reverse-transcription polymerase chain reaction analyses.
increasing mRNA expression of Wnt10b following the mRNA expression of VEGF, TGF-b1, and KGF. The increased mRNA expression of Wnt10b continued until 9 days after the fractional laser treatment. In the sequential histological examination, the proportion of anagen insidiously increased immediately after the fractional laser treatment, and a marked increase was observed 5 days post-treatment. Continuous increases in Wnt10b/b-catenin expression in hair follicles were also observed for 13 days after treatment, and their increased expression was associated with the development of new hair follicles. In the present study, the most effective dosage was 10 mJ/spot and 300 spot/cm2 setting, and the treatment with increased energy and higher density hindered the hair’s regrowth potential due to excessive scar formation. The wound healing process induced by the fractional laser treatment could lead to both hair follicle regrowth and scar formation in a dose-dependent manner, but further research on the associated molecular changes would be needed. Recently, a variety of treatment modalities for promoting wound healing such as low-level laser therapy (LLLT) and platelet-rich plasma (PRP) have been shown to be effective for promoting hair growth as well. Although the exact action mechanism of LLLT in hair growth is not known, it is assumed to stimulate re-entry of telogen to anagen hair follicles and prolong duration of anagen
phase [27,28]. PRP which is rich in various growth factors has also been reported to promote hair growth [29], and it was demonstrated that PRP increases the expression of b-catenin, FGF-7, and Bcl-2 expression in vitro [30]. In the present study, marked hair regrowth was observed via activation of Wnt/b-catenin pathway just after one session of ablative fractional laser treatment in murine model. Ablative fractional laser could be a potential, convenient treatment option for hair regrowth, and further studies for long-term implication of this treatment and direct comparison with PRP are needed. The efficacy and safety profiles including discomfort associated with laser treatment should also be evaluated in clinical trials in humans. This study had several limitations. First, C57BL/6 mice do not represent the murine model of androgenic alopecia, and the results obtained with mice may not reflect the identical effects with human skin. However, there are no proper models for androgenic alopecia, and the anagen induction after laser treatment would be intriguing in the treatment of hair loss. Second, we did not check signaling pathways in addition to the canonical Wnt10b/b-catenin pathway. Third, the number of mice was insufficient for detecting statistical power. Despite these limitations, the present study provides the findings of anagen hair induction through the fractional laser treatment in a mouse model. Anagen hair induction was demonstrated in association with the Wnt/b-catenin signaling pathway induced by the wound healing process.
HAIR REGROWTH THROUGH WOUND HEALING PROCESS
Fig. 5. Sequential increases in Wnt10b (A) and a^-catenin (B) expression seen on immunohistochemistry analysis after fractional laser treatment (200 original magnification).
439
440
BAE ET AL.
These molecular changes could be postulated to be responsible for the hair regrowth seen after fractional laser treatment. Here we identified that ablative fractional laser treatment seems to be effective for inducing hair regrowth via activation of the Wnt/b-catenin pathway in vivo. People are born with a limited number of hair follicles and no technology will result in the formation of new follicles where none existed previously. However, wound healing process driven by the ablative fractional laser resulted in anagen hair induction in murine model. Our results suggest that ablative fractional laser treatment can potentially be developed as a new treatment modality to stimulate hair regrowth. REFERENCES 1. Rogers NE, Avram MR. Medical treatments for male and female pattern hair loss. J Am Acad Dermatol 2008;59:547–566. 2. Tierney EP, Kouba DJ, Hanke CW. Review of fractional photothermolysis: Treatment indications and efficacy. Dermatol Surg 2009;35:1445–1461. 3. Hantash BM, Bedi VP, Kapadia B, Rahman Z, Jiang K, Tanner H, Chan KF, Zachary CB. In vivo histological evaluation of a novel ablative fractional resurfacing device. Lasers Surg Med 2007;39:96–107. 4. Sherling M, Friedman PM, Adrian R, Burns AJ, Conn H, Fitzpatrick R, Gregory R, Kilmer S, Lask G, Narurkar V, Katz TM, Avram M. Consensus recommendations on the use of an erbium-doped 1,550-nm fractionated laser and its applications in dermatologic laser surgery. Dermatol Surg 2010; 36:461–469. 5. Bogdan Allemann I, Kaufman J. Fractional photothermolysis-an update. Lasers Med Sci 2010;25:137–144. 6. Trelles MA, Shohat M, Urdiales F. Safe and effective onesession fractional skin resurfacing using a carbon dioxide laser device in super-pulse mode: A clinical and histologic study. Aesthetic Plast Surg 2011;35:31–42. 7. Avram MR, Leonard RT, Jr., Epstein ES, Williams JL, Bauman AJ. The current role of laser/light sources in the treatment of male and female pattern hair loss. J Cosmet Laser Ther 2007;9:27–28. 8. Kim WS, Lee HI, Lee JW, Lim YY, Lee SJ, Kim BJ, Kim MN, Song KY, Park WS. Fractional photothermolysis laser treatment of male pattern hair loss. Dermatol Surg 2011; 37:41–51. 9. Lee GY, Lee SJ, Kim WS. The effect of a 1550nm fractional erbium-glass laser in female pattern hair loss. J Eur Acad Dermatol Venereol 2011;25:1450–1454. 10. Cho S, Choi MJ, Zheng Z, Goo B, Kim DY, Cho SB. Clinical effects of non-ablative and ablative fractional lasers on various hair disorders: A case series of 17 patients. J Cosmet Laser Ther 2013;15:74–79. 11. Beylot C. Ablative and fractional lasers. Ann Dermatol Venereol 2008;135:S189–S194.
12. Kwack MH, Kang BM, Kim MK, Kim JC, Sung YK. Minoxidil activates beta-catenin pathway in human dermal papilla cells: A possible explanation for its anagen prolongation effect. J Dermatol Sci 2011;62:154–159. 13. Muller-Rover S, Handjiski B, van der Veen C, Eichmuller S, Foitzik K, McKay IA, Stenn KS, Paus R. A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages. J Invest Dermatol 2001;117:3–15. 14. Paus R, Cotsarelis G. The biology of hair follicles. N Engl J Med 1999;341:491–497. 15. Al-Refu K. Stem cells and alopecia: A review of pathogenesis. Br J Dermatol 2012;167:479–484. 16. Cotsarelis G. Epithelial stem cells: A folliculocentric view. J Invest Dermatol 2006;126:1459–1468. 17. Baker RE, Murray PJ. Understanding hair follicle cycling: A systems approach. Curr Opin Genet Dev 2012;22:607–612. 18. Millar SE. Molecular mechanisms regulating hair follicle development. J Invest Dermatol 2002;118:216–225. 19. Chueh SC, Lin SJ, Chen CC, Lei M, Wang LM, Widelitz R, Hughes MW, Jiang TX, Chuong CM. Therapeutic strategy for hair regeneration: Hair cycle activation, niche environment modulation, wound-induced follicle neogenesis, and stem cell engineering. Expert Opin Biol Ther 2013;13:377–391. 20. Banka N, Bunagan MJ, Shapiro J. Pattern hair loss in men: Diagnosis and medical treatment. Dermatol Clin 2013;31: 129–140. 21. Levy V, Lindon C, Zheng Y, Harfe BD, Morgan BA. Epidermal stem cells arise from the hair follicle after wounding. Faseb J 2007;21:1358–1366. 22. Ansell DM, Kloepper JE, Thomason HA, Paus R, Hardman MJ. Exploring the “hair growth-wound healing connection”: Anagen phase promotes wound re-epithelialization. J Invest Dermatol 2011;131:518–528. 23. Breedis C. Regeneration of hair follicles and sebaceous glands from the epithelium of scars in the rabbit. Cancer Res 1954;14:575–579. 24. Chuong CM. Regenerative biology: New hair from healing wounds. Nature 2007;447:265–266. 25. Ito M, Yang Z, Andl T, Cui C, Kim N, Millar SE, Cotsarelis G. Wnt-dependent de novo hair follicle regeneration in adult mouse skin after wounding. Nature 2007;447:316–320. 26. Oshimori N, Fuchs E. Paracrine TGF-beta signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell Stem Cell 2012;10:63–75. 27. Wikramanayake TC, Rodriguez R, Choudhary S, Mauro LM, Nouri K, Schachner LA, Jimenez JJ. Effects of the Lexington LaserComb on hair regrowth in the C3H/HeJ mouse model of alopecia areata. Lasers Med Sci 2012;27:431–436. 28. Avci P, Gupta GK, Clark J, Wikonkal N, Hamblin MR. Lowlevel laser (light) therapy (LLLT) for treatment of hair loss. Lasers Surg Med 2014;46:144–151. 29. Uebel CO, da Silva JB, Cantarelli D, Martins P. The role of platelet plasma growth factors in male pattern baldness surgery. Plast Reconstr Surg 2006;118:1458–1466. discussion 1467. 30. Li ZJ, Choi HI, Choi DK, Sohn KC, Im M, Seo YJ, Lee YH, Lee JH, Lee Y. Autologous platelet-rich plasma: A potential therapeutic tool for promoting hair growth. Dermatol Surg 2012; 38 1040–1046.
Hair Regrowth Through Wound Healing Process After Ablative Fractional Laser Treatment in a Murine Model Jung Min Bae, MD,1 Han Mi Jung, MD,1 Boncheol Goo, MD, PhD,2 and Young Min Park, MD, PhD3 Department of Dermatology, St. Vincent’s Hospital, College of Medicine, The Catholic University of Korea, Suwon, Korea 2 Clinique L, Goyang, Korea 3 Department of Dermatology, Seoul St. Mary’s Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
1
Background and Objective: Alopecia is one of the most common dermatological problems in the elderly; however, current therapies for it are limited by low efficacy and undesirable side effects. Although clinical reports on fractional laser treatment for various alopecia types are increasing, the exact mechanism remains to be clarified. The purposes of this study were to demonstrate the effect of ablative fractional laser treatment on hair follicle regrowth in vivo and investigate the molecular mechanism after laser treatment. Materials and Methods: Ablative CO2 fractional laser was applied to the shaved dorsal skin of 7-week-old C57BL/ 6 mice whose hair was in the telogen stage. After 12 mice were treated at various energy (10–40 mJ/spot) and density (100–400 spots/cm2) settings to determine the proper dosage for maximal effect. Six mice were then treated at the decided dosage and skin specimens were sequentially obtained by excision biopsy from the dorsal aspect of each mouse. Tissue samples were used for the immunohistochemistry and reverse transcription polymerase chain reaction assays to examine hair follicle status and their related molecules. Results: The most effective dosage was the 10 mJ/spot and 300 spots/cm2 setting. The anagen conversion of hair was observed in the histopathological examination, while Wnt/ b-catenin expression was associated with hair regrowth in the immunohistochemistry and molecular studies. Conclusions: Ablative fractional lasers appear to be effective for inducing hair regrowth via activation of the Wnt/b-catenin pathway in vivo. Our findings indicate that fractional laser treatment can potentially be developed as new treatment options for stimulating hair regrowth. Lasers Surg. Med. 47:433–440, 2015. ß 2015 Wiley Periodicals, Inc. Key words: androgenic alopecia; alopecia; fractional laser; hair follicle; hair loss; laser
INTRODUCTION Androgenic alopecia is the most common hair problem, affecting 50% of men and nearly 50% of women by 50 years of ß 2015 Wiley Periodicals, Inc.
age [1]. Hair is considered an essential part of one’s overall identity, so hair loss (alopecia) creates enormous psychological and emotional distress for affected people. However, current medical treatments for androgenic alopecia including topical minoxidil and oral finasteride are limited by low efficacy and undesirable adverse effects [1]. Although hair transplantation can be considered for severe hair loss, its usefulness is limited by patient budgets and surgical burdens. Therefore, new and effective treatment modalities are needed for the treatment of hair loss. The fractional laser produces a microthermal zone and creates numerous tiny columns of thermal injury within the skin [2]. Sparing the normal surrounding the pixelated microthermal zones induces a rapid wound-healing response. Re-epithelialization usually occurred within the first 24 hours via keratinocyte migration from the surrounding normal tissue of the microthermal zones, and the persistent dermal collagen remodeling response lasted at least 3 months after fractional laser treatment [3]. Most published indications of non-ablative and ablative fractional lasers are skin laxity, acne scarring, fine wrinkles, and photoaging [2,4,5]. These treatment effects are associated with the neocollagen formation via peculiar and robust wound healing process after fractional laser treatment [6]. Interest is increasing in the potential role of laser/lightbased treatments for hair loss [7]. Fractional laser treatments for androgenic alopecia have recently been reported in succession. The 1,550 nm fractional erbium–glass laser was shown effective for male pattern [8] and female
Conflict of Interest Disclosures: All authors have completed and submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest and none were reported. Contract grant sponsor: Ministry of Science, ICT & Future Planning; Contract grant number: NRF-2014R1A1A1036218. Correspondence to: Young Min Park, MD, PhD, Department of Dermatology, Seoul St. Mary’s Hospital, College of Medicine, The Catholic University of Korea, 222 Banpodae-ro, Seocho-gu, Seoul, 137-701, Korea. E-mail: [email protected] Accepted 15 March 2015 Published online 6 May 2015 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/lsm.22358
434
BAE ET AL.
pattern hair loss [9]. In one case series of 17 patients with various hair disorders, the fractional laser was shown to be effective in ophiasis, wooly hair/hypotrichosis, secondary cicatrical alopecia, pubic hypotrichosis, frontal fibrosing alopecia, and perifolliculitis capitis abscedens et suffodiens [10]. Collectively, these studies suggest that fractional laser treatment could help induce hair regrowth. However, the effects of fractional laser on hair regrowth have not been thoroughly investigated. Among fractional lasers, the 10,600 nm ablative fractional CO2 laser is considered the most effective since it creates prominent thermal damage [11]. Therefore, we conducted a series of studies using a fractional CO2 laser to explore the exact mechanism of the fractional laser treatment for hair regrowth.
(100 and 200 spots/cm2) (group A, Fig. 1A). Next, six other mice were treated on divided areas of their shaved backs with the combination settings of three energy (10, 20, and 30 mJ/spot) and two densities (200 and 300 spots/cm2) to determine proper dosages for the maximal effect (group B, Fig. 1B). Each irradiation was a square of 1 cm2 at a constant distance (10 mm) above each mouse. Finally, six mice were treated on eight divided areas at the fixed decided dosage (10 mJ/spot, 300 spots/cm2) and skin specimens were serially obtained by excision biopsy from the dorsal aspect of each mouse (group C). Hair growth was evaluated using photography and hand-held dermoscopy. The tissue samples were subjected to immunohistochemistry and reverse-transcription polymerase chain reaction (RT-PCR) assays to determine hair follicle status and their related molecules.
MATERIALS AND METHODS Animals
Quantitative histomorphometry
Six-week-old female C57BL/6 mice were purchased from Daehan Biolink Co. (Chungcheongbuk-do, Korea). All mice were housed for 1 week at 258C and 60% relative humidity to adapt to the new environment. All animal procedures were approved by the Institutional Animal Care and Use Committee of St. Vincent Hospital, The Catholic University of Korea (13-12).
Hair cycle stages were evaluated and classified as described previously using quantitative histomorphometry [12,13]. Fifty hair follicles identified on each section were categorized as being in anagen, telogen, and cataten, and then the average percentage of anagen follicles among individual mice with the same condition were calculated. RT-PCR analysis
Laser treatment At 7 weeks of age, when all hair follicles were in telogen phase, the dorsal hair of the mice was carefully shaved with a hair clipper. First, six mice were irradiated with a 10,600 nm fractional CO2 laser (eCO2, Lutronic, Goyang, Korea) on their shaved backs. Each mouse was treated on six divided areas of its back with the combination settings of three energy (30, 50, and 100 mJ/spot) and two densities
RNA (total 1 mg) from each murine skin sample was prepared using Trizol reagent (Invitrogen, Carlsbad, CA) and cDNA was synthesized using QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The cDNA used for the RT-PCR assay performed using EX taq polymerase (Takara Bio Inc., Otsu, Japan) for 35 cycles of 948C for 45 seconds, 56 608C for 45 seconds, and 728C for 1 minute.
Fig. 1. Diagrams of ablative CO2 fractional laser treatment with various parameters applied to the shaved dorsal skin of mice in group A (A) and group B (B).
HAIR REGROWTH THROUGH WOUND HEALING PROCESS
The primer sequences are listed in Table 1. The PCR product was visualized on a 2% agarose gel and quantified using analysis software (Quantity one 1-D analysis; BioRad, Hercules, CA). Immunohistochemistry Skin tissues were fixed overnight in 4% paraformaldehyde and then, cut into 4 mm sections. After deparaffinization and hydration, antigen retrieval was performed and endogenous peroxidase was inactivated with peroxidase blocking solution (Dako, Glostrup, Denmark). Primary antibodies were incubated at the following dilutions: b-catenin (1:200; Cell Signaling Technology INC., Danvers, MA) and Wnt10b (1:200; Santa Cruz Biotechnology, Inc., Dallas, TX). Primary antibodies were incubated at 48C overnight. After treatment with a secondary antibody, these sections were visualized using a DAB kit (EnVisionTM Detection System, Dako) followed by observation under a light microscope. RESULTS Hair regrowth after ablative CO2 fractional laser treatment In group A, various degrees of hair regrowth were observed after ablative CO2 fractional laser treatment (Fig. 2A). The laser treatment with 200 spot/cm2 was more effective than one with 100 spot/cm2. In the density of 200 spot/cm2, more hair regrowth was observed in the 30 mJ/spot than in the 50 mJ/spot. In group B, the most effective dosage was the 10 mJ/spot and the 300 spot/cm2 setting (Fig. 2B). Excessive energy and density led to scar formation In the 300 spots/cm2, energy > 10 mJ/spot was associated with lower hair regrowth potential and scar tissue formation (group B; Fig. 2C). Telogen-to-anagen conversion after fractional laser treatment Sequential increases in hair regrowth were observed after the fractional laser treatment in the histologic examination (group C; Fig. 3A). Quantitative histomorphometry showed a gradual increase in anagen proportion immediately after the laser treatment, and a marked increase was observed 5 days post-treatment (Fig. 3B).
435
Increases in the mRNA expression of various growth factors and Wnt10b after fractional laser treatment The mRNA expressions of vascular endothelial growth factor (VEGF), transforming growth factor b1 (TGF-b1), and keratinocyte growth factor (KGF) increased immediately after fractional laser treatment (Fig. 4). The mRNA expression of Wnt10b increased insidiously after treatment and continued until 9 days post-treatment. Increases in Wnt10b and b-catenin (B) Expression After Fractional Laser Treatment The increase in Wnt10b expression in the hair follicles was observed on immunohistochemistry analysis after fractional laser treatment (Fig. 5A). The subsequent increase of b-catenin-associated development of hair follicle was observed (Fig. 5B). DISCUSSION Each hair is a repetitively regenerating mini-organ, and the hair cycle typically consists of three stages: growth (anagen), involution (catagen), and rest (telogen) [14]. Hair follicle stem cells are capable of proliferation at the onset of the anagen phase to regenerate the new hair follicle [15]. Most hair follicle stem cells reside in an area called the hair follicle bulge located in the middle portion of the hair follicle [16]. With anagen initiation, hair follicle stem cells in the bulge proliferate and generate transit-amplifying cells, which then differentiate and form the new hair shaft during the anagen phase [17]. Numerous molecular signals have been implicated in the regulation of hair cycling; among them, the Wnt/b-catenin pathway is the primary initiator of the anagen phase [18]. There are various causes of hair loss, which is frequently associated with failure to activate hair follicle stem cells during each hair cycle [19]. Androgenic alopecia in particular, which primarily results from a combination of androgen hyperactivity and genetic predispositions, shows a progressive decrease in anagen duration and a delay in the telogen-to-anagen transition. This process results in follicular miniaturization, the key feature of androgenic alopecia, and a reduced anagen-to-telogen ratio [20]. There is evidence of associations between wound healing and hair follicles. First, hair follicles contribute to a normal wound healing process [21]. Hair follicle stem cells provide progeny, which migrate to the epidermal defect and assist
TABLE 1. Primers Used for Polymerase Chain Reaction Amplification Species
Genes
Forward
Reverse
Tm (8C)
Mouse
VEGFa TGFb1 KGF Wnt10b GAPDH
TTTGACCATCTGCTTTCGTG CAATTCCTGGCGTTACCTTG GACATGGATCCTGCCAACTT CCCGGGACATCCAGGCGAGA CCCCAGCAAGGACACTGAGCAA
TCCAGCTTCCCCAATAGAAC ATTCCGTCTCCTTGGTTCAG AATTCCAACTGCCACTGTCC CTCTGGCGCTGCCCTCCAAC GGCTCCCTAGGCCCCTCCTGTTAT
56 58 56 60 60
Tm, melting temperature; VEGFa, vascular endothelial growth factor-a; TGFb1, transforming growth factor-b1; KGF, keratinocyte growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
436
BAE ET AL.
Fig. 2. Hair regrowth after ablative CO2 fractional laser treatment. (A) Group A showed that the laser treatment with the 200 spot/cm2 was more effective than that with 100 spot/cm2. (B) & (C) In group B, the most effective dosage was 10 mJ/spot at 300 spot/cm2. In the 300 spots/cm2, energy > 10 mJ/spot was associated with lower hair regrowth potential and scar tissue formation.
HAIR REGROWTH THROUGH WOUND HEALING PROCESS
437
Fig. 3. Telogen-to-anagen conversion of the hair follicle after the fractional laser treatment. (A) Sequential increases of hair regrowth were observed ( 200 original magnification, hematoxylin and eosin). (B) Quantitative histomorphometry showing constant increases in anagen proportion after treatment.
with re-epithelialization [22]. Recent studies have shown that cutaneous wound healing is substantially accelerated during the anagen stage of the hair cycle [22]. Conversely, some hair follicles would develop anew after wounding. There have been early observations that hair follicles developed following wounding in rabbits, mice, and even humans [23,24]. It was recently discovered that hair follicles formed de novo in rodents after wounding via activation of Wnt-mediated signaling pathway [25]. The
association of paracrine TGF-b1 signaling and hair follicle stem cell activation was also discovered [26]; however, the “hair growth–wound healing connection” has yet to be thoroughly revealed [22]. In the present study, we showed that anagen hair induction after fractional laser treatment was associated with the Wnt/b-catenin pathway on the murine model. These results were consistent with those of a previous study [8]. We further demonstrated the sequentially
438
BAE ET AL.
Fig. 4. Early increases in growth factors associated with wound healing including vascular
endothelial growth factor (VEGF), transforming growth factor b1 (TGF-b1) and keratinocyte growth factor (KGF), and subsequently increased Wnt10b were observed by reverse-transcription polymerase chain reaction analyses.
increasing mRNA expression of Wnt10b following the mRNA expression of VEGF, TGF-b1, and KGF. The increased mRNA expression of Wnt10b continued until 9 days after the fractional laser treatment. In the sequential histological examination, the proportion of anagen insidiously increased immediately after the fractional laser treatment, and a marked increase was observed 5 days post-treatment. Continuous increases in Wnt10b/b-catenin expression in hair follicles were also observed for 13 days after treatment, and their increased expression was associated with the development of new hair follicles. In the present study, the most effective dosage was 10 mJ/spot and 300 spot/cm2 setting, and the treatment with increased energy and higher density hindered the hair’s regrowth potential due to excessive scar formation. The wound healing process induced by the fractional laser treatment could lead to both hair follicle regrowth and scar formation in a dose-dependent manner, but further research on the associated molecular changes would be needed. Recently, a variety of treatment modalities for promoting wound healing such as low-level laser therapy (LLLT) and platelet-rich plasma (PRP) have been shown to be effective for promoting hair growth as well. Although the exact action mechanism of LLLT in hair growth is not known, it is assumed to stimulate re-entry of telogen to anagen hair follicles and prolong duration of anagen
phase [27,28]. PRP which is rich in various growth factors has also been reported to promote hair growth [29], and it was demonstrated that PRP increases the expression of b-catenin, FGF-7, and Bcl-2 expression in vitro [30]. In the present study, marked hair regrowth was observed via activation of Wnt/b-catenin pathway just after one session of ablative fractional laser treatment in murine model. Ablative fractional laser could be a potential, convenient treatment option for hair regrowth, and further studies for long-term implication of this treatment and direct comparison with PRP are needed. The efficacy and safety profiles including discomfort associated with laser treatment should also be evaluated in clinical trials in humans. This study had several limitations. First, C57BL/6 mice do not represent the murine model of androgenic alopecia, and the results obtained with mice may not reflect the identical effects with human skin. However, there are no proper models for androgenic alopecia, and the anagen induction after laser treatment would be intriguing in the treatment of hair loss. Second, we did not check signaling pathways in addition to the canonical Wnt10b/b-catenin pathway. Third, the number of mice was insufficient for detecting statistical power. Despite these limitations, the present study provides the findings of anagen hair induction through the fractional laser treatment in a mouse model. Anagen hair induction was demonstrated in association with the Wnt/b-catenin signaling pathway induced by the wound healing process.
HAIR REGROWTH THROUGH WOUND HEALING PROCESS
Fig. 5. Sequential increases in Wnt10b (A) and a^-catenin (B) expression seen on immunohistochemistry analysis after fractional laser treatment (200 original magnification).
439
440
BAE ET AL.
These molecular changes could be postulated to be responsible for the hair regrowth seen after fractional laser treatment. Here we identified that ablative fractional laser treatment seems to be effective for inducing hair regrowth via activation of the Wnt/b-catenin pathway in vivo. People are born with a limited number of hair follicles and no technology will result in the formation of new follicles where none existed previously. However, wound healing process driven by the ablative fractional laser resulted in anagen hair induction in murine model. Our results suggest that ablative fractional laser treatment can potentially be developed as a new treatment modality to stimulate hair regrowth. REFERENCES 1. Rogers NE, Avram MR. Medical treatments for male and female pattern hair loss. J Am Acad Dermatol 2008;59:547–566. 2. Tierney EP, Kouba DJ, Hanke CW. Review of fractional photothermolysis: Treatment indications and efficacy. Dermatol Surg 2009;35:1445–1461. 3. Hantash BM, Bedi VP, Kapadia B, Rahman Z, Jiang K, Tanner H, Chan KF, Zachary CB. In vivo histological evaluation of a novel ablative fractional resurfacing device. Lasers Surg Med 2007;39:96–107. 4. Sherling M, Friedman PM, Adrian R, Burns AJ, Conn H, Fitzpatrick R, Gregory R, Kilmer S, Lask G, Narurkar V, Katz TM, Avram M. Consensus recommendations on the use of an erbium-doped 1,550-nm fractionated laser and its applications in dermatologic laser surgery. Dermatol Surg 2010; 36:461–469. 5. Bogdan Allemann I, Kaufman J. Fractional photothermolysis-an update. Lasers Med Sci 2010;25:137–144. 6. Trelles MA, Shohat M, Urdiales F. Safe and effective onesession fractional skin resurfacing using a carbon dioxide laser device in super-pulse mode: A clinical and histologic study. Aesthetic Plast Surg 2011;35:31–42. 7. Avram MR, Leonard RT, Jr., Epstein ES, Williams JL, Bauman AJ. The current role of laser/light sources in the treatment of male and female pattern hair loss. J Cosmet Laser Ther 2007;9:27–28. 8. Kim WS, Lee HI, Lee JW, Lim YY, Lee SJ, Kim BJ, Kim MN, Song KY, Park WS. Fractional photothermolysis laser treatment of male pattern hair loss. Dermatol Surg 2011; 37:41–51. 9. Lee GY, Lee SJ, Kim WS. The effect of a 1550nm fractional erbium-glass laser in female pattern hair loss. J Eur Acad Dermatol Venereol 2011;25:1450–1454. 10. Cho S, Choi MJ, Zheng Z, Goo B, Kim DY, Cho SB. Clinical effects of non-ablative and ablative fractional lasers on various hair disorders: A case series of 17 patients. J Cosmet Laser Ther 2013;15:74–79. 11. Beylot C. Ablative and fractional lasers. Ann Dermatol Venereol 2008;135:S189–S194.
12. Kwack MH, Kang BM, Kim MK, Kim JC, Sung YK. Minoxidil activates beta-catenin pathway in human dermal papilla cells: A possible explanation for its anagen prolongation effect. J Dermatol Sci 2011;62:154–159. 13. Muller-Rover S, Handjiski B, van der Veen C, Eichmuller S, Foitzik K, McKay IA, Stenn KS, Paus R. A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages. J Invest Dermatol 2001;117:3–15. 14. Paus R, Cotsarelis G. The biology of hair follicles. N Engl J Med 1999;341:491–497. 15. Al-Refu K. Stem cells and alopecia: A review of pathogenesis. Br J Dermatol 2012;167:479–484. 16. Cotsarelis G. Epithelial stem cells: A folliculocentric view. J Invest Dermatol 2006;126:1459–1468. 17. Baker RE, Murray PJ. Understanding hair follicle cycling: A systems approach. Curr Opin Genet Dev 2012;22:607–612. 18. Millar SE. Molecular mechanisms regulating hair follicle development. J Invest Dermatol 2002;118:216–225. 19. Chueh SC, Lin SJ, Chen CC, Lei M, Wang LM, Widelitz R, Hughes MW, Jiang TX, Chuong CM. Therapeutic strategy for hair regeneration: Hair cycle activation, niche environment modulation, wound-induced follicle neogenesis, and stem cell engineering. Expert Opin Biol Ther 2013;13:377–391. 20. Banka N, Bunagan MJ, Shapiro J. Pattern hair loss in men: Diagnosis and medical treatment. Dermatol Clin 2013;31: 129–140. 21. Levy V, Lindon C, Zheng Y, Harfe BD, Morgan BA. Epidermal stem cells arise from the hair follicle after wounding. Faseb J 2007;21:1358–1366. 22. Ansell DM, Kloepper JE, Thomason HA, Paus R, Hardman MJ. Exploring the “hair growth-wound healing connection”: Anagen phase promotes wound re-epithelialization. J Invest Dermatol 2011;131:518–528. 23. Breedis C. Regeneration of hair follicles and sebaceous glands from the epithelium of scars in the rabbit. Cancer Res 1954;14:575–579. 24. Chuong CM. Regenerative biology: New hair from healing wounds. Nature 2007;447:265–266. 25. Ito M, Yang Z, Andl T, Cui C, Kim N, Millar SE, Cotsarelis G. Wnt-dependent de novo hair follicle regeneration in adult mouse skin after wounding. Nature 2007;447:316–320. 26. Oshimori N, Fuchs E. Paracrine TGF-beta signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell Stem Cell 2012;10:63–75. 27. Wikramanayake TC, Rodriguez R, Choudhary S, Mauro LM, Nouri K, Schachner LA, Jimenez JJ. Effects of the Lexington LaserComb on hair regrowth in the C3H/HeJ mouse model of alopecia areata. Lasers Med Sci 2012;27:431–436. 28. Avci P, Gupta GK, Clark J, Wikonkal N, Hamblin MR. Lowlevel laser (light) therapy (LLLT) for treatment of hair loss. Lasers Surg Med 2014;46:144–151. 29. Uebel CO, da Silva JB, Cantarelli D, Martins P. The role of platelet plasma growth factors in male pattern baldness surgery. Plast Reconstr Surg 2006;118:1458–1466. discussion 1467. 30. Li ZJ, Choi HI, Choi DK, Sohn KC, Im M, Seo YJ, Lee YH, Lee JH, Lee Y. Autologous platelet-rich plasma: A potential therapeutic tool for promoting hair growth. Dermatol Surg 2012; 38 1040–1046.
