Am. J. Hum. Genet. 47:712-720, 1990

Haplotype Analysis of the Human Apolipoprotein B Mutation Associated with Familial Defective Apolipoprotein B100 Erwin H. Ludwig and Brian J. McCarthy Gladstone Foundation Laboratories for Cardiovascular Disease, Cardiovascular Research Institute, University of California, San Francisco, CA

Summary

Haplotype analysis was conducted on the mutant allele of 14 unrelated subjects heterozygous for a mutation in the codon for amino acid 3500 of human apolipoprotein B100. This mutation is associated with defective binding of low-density lipoprotein to the low-density lipoprotein receptor and with moderate hypercholesterolemia. Ten markers were used for haplotyping: eight diallelic markers within the structural gene and two hypervariable loci flanking the gene. Seven of eight unequivocally deduced haplotypes were identical, and one revealed only a minor difference at one of the hypervariable loci. The genotypes of the six other affected subjects were consistent with this same assigned haplotype. These data are consistent with a common ancestral chromosome and provide no evidence for a recurrent mutation at this potentially hypermutable CG dinucleotide, despite the fact that this mutation is not rare.

Introduction

Apolipoprotein (apo) B is virtually the only protein constituent of low-density lipoproteins (LDL) and is essential for the assembly oftriglyceride-rich lipoproteins. As the ligand for the LDL receptor, it also plays an essential role in the clearance of LDL from the plasma by the LDL-receptor pathway (Goldstein and Brown 1977). Plasma levels of LDL and apo B are recognized as important risk factors for premature coronary artery disease (Vega and Grundy 1986). A mutation in the human gene for apo B is associated with hypercholesterolemia and the presence of LDL that are defective in their ability to bind to the LDL receptor (Innerarity et al. 1987). This defect characterizes a recently defined human disease, designated familial defective apolipoprotein B100 (Innerarity et al. 1987). It is not yet clear whether this mutation is associated with increased risk for atherosclerosis. This mutation is located in the codon for amino acid 3500 and causes an Arg- -Gln substitution in the apo B region that appears Received February 7, 1990; final revision received May 18, 1990. Address for correspondence and reprints: Brian J. McCarthy, Gladstone Foundation Laboratories, P.O. Box 40608, San Francisco, CA 94140-0608. i 1990 by The American Society of Human Genetics. All rights reserved.

0002-9297/90/4704-0017$02.00

712

to be involved in receptor binding (Soria et al. 1989). This mutation is not a rare one; a recent study of groups of predominantly Caucasian subjects drawn from populations in the United States, Canada, Austria, and Italy estimated its frequency at approximately 0.2% (Innerarity et al., in press). Estimates of its frequency in nonCaucasian populations are not yet available. The prevalence of this same mutation in different populations raises questions concerning its origin. It is relevant to this issue that the mutation occurs at a CG dinucleotide, a hypermutable sequence where the mutation rate is 10-20 times the average rate for other doublets (Youssoufian et al. 1988; Koeberl et al. 1989). In other genes, such as that for factor VIII, it is apparent that recurrent mutations at CG positions are not uncommon (Youssoufian et al. 1988). If the same mutation occurred more than once, it is quite probable that it would be found on more than one chromosomal background. These questions concerning the origin of the 3500 mutation are amenable to haplotype analysis (Botstein et al. 1980). A determination of the chromosomal background on which the mutation occurs and whether it is similar in different affected subjects can provide information concerning recent versus ancient origin of the mutation (Orkin et al. 1982) and whether the mutation occurred more than once. To obtain such infor-

713

Haplotype Analysis of Apolipoprotein B mation, we have carried out a detailed haplotype analysis of the kindred of eight probands affected by this mutation. Of the 10 haplotype markers used, eight are diallelic RFLPs or insertion/deletion markers distributed throughout the apo B gene. The other two markers are hypervariable repeat (HVR) regions (Jeffreys et al. 1985) flanking the structural gene. One of these, the 3' HVR, has been previously included as a high-resolution marker in population studies (Hegele et al. 1986; Friedl et al. 1990). The other is a d(TG)n HVR situated 3 kb 5' of the transcriptional start. Together, these 10 haplotype markers provide a high-resolution approach capable of distinguishing a large number of apo B alleles.

_0

- _ .,=

a"

sR I

V*

*a 1 -a S.

.D .

I

Subjects A study of Caucasian populations from Dallas, San Francisco, Montreal, Salzburg, and Milan yielded 14

probands heterozygous for the Arg3500-oGln mutation; all were moderately hypercholesterolemic (Innerarity et al., in press). In eight cases the kindreds, comprising a total of 85 subjects, were studied. The eight kindreds included 18, 17, 16, 12, 9, 6, 5, and 2 individuals. The number of first-degree relatives of the probands ranged between eight and one, for a total of 35. In the largest kindred, 4 generations were studied. (We are indebted to Drs. T. P. Bersot, A. L. Catapano, A. Corsini, W. Friedl, S. M. Grundy, R. M. Krauss, R. W. Mahley, and G. L. Vega for their cooperation in providing blood or purified DNA.) Haplotype Markers

Many hypervariable regions have been characterized in the human genome and used as highly informative markers for linkage analysis. Such loci consist of variable numbers of tandem repeats of short (2-100 bp) base sequence elements. These elements are referred to as variable number of tandem repeats (VNTRs) (Nakamura et al. 1987) or HVRs (Jeffreys et al. 1985). One of these occurs approximately 200 bp 3' of the apo B structural gene (Huang and Breslow 1987; Jenner et al. 1988) and defines at least 14 different apo B alleles (Boerwinkle et al. 1989; Ludwig et al. 1989). In assembling a set of haplotype markers for this apo B gene analysis, we chose another HVR in the 5' flanking sequence. This element, situated 3,256 bp 5' of the transcriptional start, comprises repeats of the dinucleotide TG. Similar d(TG)n elements have been described near other genes of interest (Litt and Luty 1989; Weber

AC

%3

go

_

_

.4 1 2 3

Material and Methods

C

B

A

1 2 3 45

Figure I Examples of electrophoretic methods used to assay the 5' (TG),, HincII, PvuII, and AluI polymorphisms. A, Autoradiograph of amplified DNA fragments containing the 5' (TG)n, with a sequencing reaction used as a marker on the same gel (four left lanes). Lanes 1-3 illustrate the three variants present in the individuals screened (lane 3 has a faint band slightly larger than the amplification product, which is a nonspecific PCR product). Lane 1, (TG)14/ (TG)14. Lane 2, (TG)13/(TG)14. Lane 3, (TG)14/(TG)15. B, Electrophoresis of DNA fragments containing the polymorphic HincIl and PvuII sites in intron 4 in a 2% agarose gel. Lanes 1-3 contain PCR-amplified products, digested with HincII, for -/-, +/-, and + / + individuals, respectively. Lane 4, (DX174 HaelII digest marker. Lanes 5-7 show the PCR-amplified products, digested with PvuII, for -/-, +/-, and +/+ individuals, respectively. C, a 9% polyacrylamide-gel separation of DNA fragments containing the polymorphic AluI site in exon 14. Lane 1, pBR322 MspI digest marker. Lane 2, Undigested PCR amplification product. Lanes 3-5 illustrate the PCR amplification product, digested with AluI, for -/-, + /-, and + / + individuals, respectively. The size difference between the PCR-amplified product in lane 2 and that in lane 3 results from the presence of a second, but nonpolymorphic, AluI site in the amplified fragment. Minor bands represent nonspecific PCR amplification products.

and May 1989). In the case of this apo B 5' HVR, a survey of a small group of subjects revealed seven different variants containing from d(TG)12 to d(TG)18 repeats. The three different variants present in the kindreds to be discussed below are illustrated in figure 1A, where amplified DNA fragments including this region are resolved on denaturing acrylamide gels. The markers used for haplotype analysis of apo B mutant alleles are displayed in figure 2, together with the location of the mutation at amino acid position 3500 that characterizes familial defective apo B100. The markers include both the eight conventional diallelic loci within the gene and the two flanking HVRs. Table 1 summarizes some characteristics of each of these

Ludwig and McCarthy

714 Pvull

iI

Alul

Apol l

L1

iIJJ

11

J ~

-32S6

162-170 421 1961

Ispi EcoRl

Xbl

7673

I1

by analysis of the products of restriction-enzyme digestion. The Arg3500-oGln mutation was detected by PCR amplification and reaction with allele-specific oligonucleotides (Soria et al. 1989). Specific conditions for PCR amplification and analysis were as follows: (1) The 5' HVR reactions contained 200-500 ng of genomic DNA, 200 ng of PCR 1, 50 ng of PCR 2 (table 2), and 1 ng of 32P-labeled PCR 2, and 200 pM of each dNTP in the buffer recommended by Saiki et al. (1988). Amplification conditions were 940C, 1-min denaturation; 55°C, 1-min annealing; and 720C, 1-min extension for 25 cycles. One-tenth of the amplification product was loaded on a 6% polyacrylamide gel in a buffer containing 7 M urea and electrophoresed for 2 h at 45°C-500C. The gel was then dried and autoradiographed. An example is shown in figure 1A. (2) The SP polymorphism was assayed using primers and PCR conditions according to a method described by Boerwinkle and Chan (1989). (3) The ApaLl RFLP was assayed according to a method described by Young and Hubl (1989). (4) The region containing the HinclI RFLP, in intron 4 (Rajput-Williams et al. 1988), was amplified using primers PCR 3 and 4 (table 2). The 5' end of PCR 3 begins. at the second base of exon 4; PCR 4 lies in intron 4. The HinclI site lies 170 bp 3' of the 3' end of exon 4. The amplified product was 493 bp; when the HincII site was present, the resulting fragment sizes were 178 and 315 bp. Restriction patterns corresponding to two homozygous subjects and to one heterozygous subject are illustrated in figure 1B. (5) The region containing the PvuII RFLP, also in intron 4 (Rajput-Williams et al. 1988), was amplified using or

Gln

Nincii

(TG)n SP

'HVR

%Jn

l

~~~~~~~~cDNAI

kb

10708 11041 12669

Figure 2 Haplotype markers for the human apo B gene. The upper horizontal line represents the apo B gene (Ludwig et al. 1987) and the positions of 10 polymorphic markers. The most 5' site, (TG)n, which is 3,256 bp 5' of the transcription start, and the most 3' site, which is 491 bp 3' of the translational stop site, are HVRs. SP represents a 9-bp insertion/deletion in the SP. All other sites are single-base substitutions recognized by the restriction enzymes illustrated. The lower scale indicates the position of the polymorphic sites on the cDNA. The HinclI and PvuII sites occur in intron 4. The Arg-Gln substitution at amino acid 3500 is also included.

markers, including approximate frequencies for each diallelic marker. These indicated frequencies are for an Austrian population comprising 227 individuals described elsewhere (Friedl et al. 1990). Because of the number of markers used and the fact that the two flanking HVRs are each capable of resolving a moderate number of alleles, the number of alleles that are distinguishable is theoretically very large. The haplotype markers displayed in figure 2 cover approximately 47 kb, encompassing all of the apo B gene. Two flanking markers are situated in 5' and 3' proximal regions. Eight of these are diallelic RFLP or insertion/deletion (i.e., signal peptide [SP]) markers. All 10 markers were assayed by means of the polymerase chain reaction (PCR), either by direct size analysis Table I Haplotype Markers

Haplotype Marker

Characeristics

Prevalence

1. 5' (TG)n HVR ...... 2. SP ................

Minisatellite length polymorphism Insertion/deletion of 9 bp in coding region for signal peptide RFLP associated with antibody MB19 polymorphism THR71-ILE RFLP in intron 4 RFLP in intron 4 RFLP associated with immunochemical polymorphism Ag(al/d) and H11G3 ALA591-VAL RFLP, neutral substitution THR2488 RFLP, ARG3611-GLN RFLP, GLU4154- LYS Minisatellite length polymorphism

Seven alleles + / - = 70/30

3. ApaLI ............. 4. HincIl ............. 5. PvuII .............. 6. AluI .............. 7. XbaI .............. 8. MspI .............. 9. EcoRI ............. 10. 3' HVR ..........

+ / - = 71/29 +/14/86 + / - = 7/93 + / - = 47/53

+ / - = 46/54 + / - = 89/11 + / - = 81/19

17 Alleles

Haplotype Analysis of Apolipoprotein B

715

Table 2 Oligonucleotides Used as Primers

Polymorphism and Oligonucleotide

Sequence

5' HVR: PCR 1 .........5. 'ATTTCTTTCCTGATAGTTCTC3' PCR 2 .......... S'AACTTCCAAACATTGTAGATGGAACTGTGC3' HincII RFLP: 5 'GTTGAGCTGGAGGTTCCCCAGCTC3' PCR 3 .......... 5 'GGCCACAGCAGCCAGTGCCTCTGG3' PCR 4 .......... PvuII RFLP: 5 'GTCTTTGGGACTCTAGCCCATGAA3' PCR 5 .......... 5 'GCTTCCCTTCTGGAATGGCCAGCT3' PCR 6 .......... AluI RFLP: 5 'TGATTGGAAATCCATATTTACTTG3' PCR 7 .......... 5 'GTGAGGGTAGTTTTCAGCATGCTT3' PCR 8 .......... EcoRI RFLP: 5 'AACAACAGTAGACTTATTTAA3' PCR 9 .......... PCR 10 ........5. 'ATCTCTTTCAGCTGTTTAATG3'

primers PCR S in intron 4 and PCR 6 beginning 35 bp into exon 5 (table 2). The amplified product was approximately 1,060 bp. The presence of the PvuII site yielded fragments of approximately 580 and 480 bp. An example of the resolution of fragments corresponding to the alleles of homozygous and heterozygous subjects is displayed in figure 1B. (6) The AluI RFLP occurs at base 1981 of the apo B cDNA sequence (Wang et al. 1988). The region containing this RFLP was amplified using primers PCR 7 in intron 13 and PCR 8 in exon 14 and yielded a fragment of 292 bp. Because another nonpolymorphic AluI site resides in this fragment, digestion yielded fragments of 49, 62, and 181 bp when the polymorphic AluI site was present and fragments of 62 and 230 bp when it was absent. Examples of DNA from subjects homozygous or heterozygous for this polymorphic site are illustrated in figure 1C. The regions containing (7) XbaI and (8) MspI RFLPs were amplified according to a method described elsewhere (Soria et al. 1989) (9) The EcoRI RFLP occurs at position 12669 of the cDNA, resulting in an amino acid change from Glu to Lys. The PCR product using primer PCR 9 in intron 28 and PCR 10 was 1,055 bp. Digestion with EcoRI resulted in fragment sizes of 418 and 637 bp (data not shown). (10) For the 3' HVR, primers, amplification, and denaturing acrylamide-gel conditions were as described elsewhere (Ludwig et al. 1989) Reaction conditions for the HincIl, PvuII, and AluI and EcoRI RFLPs contained 200-500 ng of genomic DNA, 200 ng of each primer, and 200 gM

Location

-3319 bp 3152 bp

-

Exon 4 Intron 4 Intron 4 Exon S Intron 13 Exon 14 Intron 28 Exon 29

of each dNTP in the buffer recommended by Saiki et al. (1988). Amplification conditions for all four polymorphisms were 940C, 1-min denaturation, 55°C, 1min annealing; and 72°C, 1-min extension for 35 cycles. For restriction-enzyme digestion, 17 gl of the amplification product was added to 2 pl of the appropriate digestion buffer and to 1 1 of the restriction enzyme (5-10 U/gl) and digested for 2-3 h at 370C. Digests were then loaded on a 6% or 9% polyacrylamide gel or on a 2% agarose gel, stained with ethidium bromide, visualized with UV light, and photographed. Haplotypes were expressed in terms of a binary code in which the eight diallelic markers are scored as 0 or 1. This series of binary digits was then converted to a decimal number. This system facilitates the assignment of a number between 0 and 255 for each of the 256 haplotypes possible. Results

Haplotyping Apolipoprotein B Mutant Alleles

In the eight kindreds, a total of 170 chromosomes yielded 22 independent haplotypes (table 3). Instances of the same haplotype inherited by other members of the kindred are not included in the column entitled "No. of Chromosomes." Table 3 not only lists the occurrence or absence of each restriction-enzyme-site (or the insertion/deletion of 9 bp in the case of the SP) marker, but each different haplotype is also assigned a number in the left-hand column. Each number represents a par-

Ludwig and McCarthy

716 Table 3 Apo B Haplotypes Found in Eight Kindreds

HAPLOTYPE MARKER

HAPLOTYPE

NO. OF SP ApaLI HincII PvuII AluI XbaI MspI EcoRI CHROMOSOMES

2 ................... 11 ................... 13 ................... 14 ...................

-

15....................

-

45 . .................. 65 ................... 75 . .................. 130 ................... 131 ................... 192 ................... 194 ................... 195 ................... 199 ................... 202 ................... 207 ................... 217 ................... 219 ................... 224 ................... 226 ................... 234 ................... 251 ...................

-

-

-

+

-

+

-

+ + + + + + + + +

-

-

-

-

-

+ + + + +

-

-

-

-

+

+

-

+ + +

+ -

-

-

+ + + + +

-

-

-

-

-

-

-

+

-

-

-

+ + + +

-

-

-

-

-

-

+ + +

+ + + + + + + + + + + +

+ + + +

Total Binary number ...... 27

26

25

+ +

+ +

-

-

-

-

-

-

-

-

-

-

+ +

+ + + +

-

+ +

-

+ + -

-

+ + -

+ +

+

+ + -

-

-

-

+

+ + +

-

-

-

-

-

-

-

-

-

-

-

+

+ +

-

+ + +

24

23

22

21

20

-

+

1 1 2 1 9 1 1 2 1 1 1 12a 8 2 2 7 1 1 1 5 1 6

HVR MARKER

(15-38) (14-34) (14-32) and (15-36) (15-36) (14-36)7, (15-34), and (15-35) (15-36) (14-32)

(13-40) and (14-34) (15-44) (14-34) (14-48) (14-46), (14-48)8, (15-48)2, and (14-38) (14-30), (14-32), (14-34)5, and (14-36) (14-36)

(14-48)2 (14-30), (14-36)4, (15-36), and (15-38) (14-30) (14-30) (15-48) (15-46)3 and (15-48)2 (14-44) (15-30)

67

NOTE. - Table lists the 22 different haplotypes deduced using the eight diallelic markers in the eight families studied, as well as the number of times each haplotype was independently observed. The haplotype number in the leftmost column was determined by using the binary system for eight markers, where a minus sign ( - ) denotes 0 and where a plus sign ( + ) denotes 1. Thus, - for all markers would be haplotype 0, and + for all markers would be haplotype 255. The bottom line illustrates how each marker is assigned to a particular binary number. The column entitled "HVR MARKER" represents the 5' (TG). and the 3' HVR: the first number within the parentheses is the number of times the dinucleotide TG is repeated, and the second number is the number of times the 15-bp 3' HVR is repeated. The subscript represents the number of times the haplotype was observed linked to a particular pair of 5' and 3' HVR variants, whereas no subscript indicates one observation. a Of these 12 alleles, eight are the mutant 194 haplotypes of the probands of the eight kindreds, and the remaining four are 194 nonmutant haplotypes.

ticular combination of the eight diallelic markers. To accommodate additional haplotypes in the future, this number is based on a binary code in which haplotype 0 (zero) represents the absence of all restriction sites and in which 255 means that all eight diallelic sites are plus (+); that is, all seven restriction sites are present together with the 9-bp insertion for SP. All other combinations of markers are assigned binary numbers where the first digit 0 or 1, corresponding to - or + in the table, represents the SP site, the next number 0 or 1 represents the ApaLl site, and so on. One advantage of this convention is that any new combination of these eight markers may be added in a logical se-

quence. Furthermore, the arrangement of markers characteristic of any given haplotype, e.g., 194, may be deduced by converting the decimal number to its binary number counterpart, i.e., 11000010, without resorting to a reference table that lists the properties of each haplotype. Also listed in table 3 are the number of times each haplotype was present among 67 chromosomes examined and (in parentheses) the associations between each haplotype and the two HVR loci. In some cases, a given haplotype always occurred in association with one combination of HVRs, e.g., 251 with (15-30). In other cases, e.g., haplotype 15, the HVR markers served to

717

Haplotype Analysis of Apolipoprotein B x

6A

I

1.

6

n

I

sP

./+

Apal/

.1-

4.

Hinill PvjLA

*1

A/oI

+t+

Xbal

-t-

*1

Msp

+/+

EcoRI

-/+

m 2192 194 15

2

19 195 195 194 195 1

2

1

1

1 219

Haplotype

211 20

5'(TG),

14/14 14/14 14/14 14/14 14/14 14115 141l5 15/14 14/14 14114 15/14 15/14 14/14 14/14 14/15 14/14

3' HVR

30/36 30/36 30/48 30/36 34/48 34/48 34/30 48/32 34/36 34/48 30/48 46/48 48/34 30/48 30/38 30/38

15

15

194 194 251

65

199 194 194 194 131 194

14

199

Haplotype analysis of one of the kindreds with the Figure 3 Arg3500-Gln mutation (the arrow indicates the proband). The halffilled squares and circles represent heterozygotes for the Arg300-Gln mutation. Seven of the eight diallelic markers were scored + or (cut or noncut) on the basis of restriction digestion with the appropriate enzyme that recognizes the polymorphic site. The SP insertion/deletion was scored as + for the 9 bp present and as - for the 9 bp absent. The symbols on the left side of the forward slash (+/ or -/) represent the maternal haplotype (n), and the symbols on the right side (/+ or /-) represent the paternal haplotype (n), except for the first generation, where all the family members' haplotypes were unequivocally deduced by scoring the eight diallelic markers and assuming Mendelian inheritance in the absence of recombination. The 5' (TG)n and 3' HVR are also presented, according to the same convention, in terms of the number of TG dinucleotide or 15bp repeats, respectively.

subdivide it into several classes. The degree of resolution provided by the use of all 10 DNA markers is emphasized by the fact that all 85 subjects examined proved to be heterozygous for at least one marker and all but two subjects were heterozygous for two or more markers.

The inheritance of these haplotypes and the cosegregation of one of them with the Arg3500--'Gln mutation in one of the families studied is illustrated in figure 3. In this kindred and all others studied, each haplotype remained associated with a given arrangement of the two HVR markers. For eight probands and their relatives, the haplotype of the mutant allele could be unambiguously deduced. With one exception, all eight haplotypes proved to be identical. While seven of the eight haplotypes included a 3' HVR element designated as hypervariable element (HVE) 48, i.e., 48 occurrences of the basic repeat (Ludwig et al. 1989), the other displayed HVE 46. Thus, in this one kindred a minor change in the number of repeats has occurred. Six other probands heterozygous for the same mutation were genotyped. Although the lack of DNA from family members precluded unambiguous resolution of each of their two haplotypes, their genotypes (table 4) were consistent with the mutant allele being identical to that of the eight probands referred to above. Discussion

The clearance of LDL depends on high-affinity interaction of LDL with the LDL receptor. Disruption of this interaction can result from mutations in the LDL receptor gene and lead to hypercholesterolemia. Such genetic deficiencies define the disease familial hypercholesterolemia. In principle, mutations in the gene for apo B, which is virtually the sole protein constituent of LDL and the ligand for binding to the LDL receptor, might lead to a similar phenotype. In fact, one such mutation has been characterized and defines familial defective apo B100, a disorder associated with moder-

Table 4 Genotypes of Probands for the Arg3500-Gln Mutation without Unequivocal Haplotypesa HAPLOTYPE MARKER

5'

Proband number: 9 ............. 10 ............ 11 ............ 12 ............ 13 ............ 14 ............

Haplotype 194

....

(TG), SP ApaLI HincII

14/14 14/15 14/14 14/14 14/15 14/14 14

+ /+/+ +/+ + /+ /+ /+

PvuII

AluI

XbaI MspI EcoRI 3' HVR

+- -/- -I- -/- -+ / + -/ - -/ + -- -+ / + -/- -/- -- -+/- -/- -I- -+ - +- -- -- -+ -/ + +- -/- -/- -/- -+

+/+ +/+ +/+ +/+ +/+ /+

-/ + -/-/ + -/ + -/ + -/ + -

48/44 48/48 48/34 48/34 48/38 48/34 48

a In each case, one of the two alleles could be haplotype 194 (boldface symbols), as is the case where an unequivocal haplotype was deduced.

718

ate hypercholesterolemia (Innerarity et al. 1987, and in press). To date, this mutation in the codon for amino acid 3500 appears to be the only apo B mutation associated with defective binding of LDL to its receptor. This conclusion is based on the observation that all subjects shown to have defective LDL in a receptor binding assay have proved to be heterozygous for this mutation. Its apparent high frequency in the populations studied so far prompted the present analysis of haplotypes associated with this mutation. As haplotype markers we chose seven RFLPs and one insertion/deletion polymorphism, all of which occur within the structural gene and have been described earlier. In addition, we used a 3' HVR that has been the subject of several recent publications (Huang and Breslow 1987; Jenner et al. 1988; Boerwinkle et al. 1989; Ludwig et al. 1989). In population studies, Boerwinkle et al. (1989) reported 12 different alleles, and Ludwig et al. (1989) were able to distinguish 14. More recent work in our laboratory has increased the number of distinguishable alleles to 17. A second HVR marker, comprising a d(TG). element, was also used. While in the kindreds examined during the course of the present study three alleles were distinguishable, a more general population study in our laboratory revealed seven alleles (data not shown). Together, these 10 markers provide for the apo B gene a high-resolution haplotyping system that is reminiscent of those available for the human a- and O-globin gene clusters (Antonarakis et al. 1985). In addition to the multiple RFLPs, the a-globin gene cluster is flanked by 5' and 3' HVRs (Higgs et al. 1986), and the 3-globin gene cluster contains five different HVR elements (Jarman and Higgs 1988). Despite the large number of alleles that could be distinguished among the 85 individuals in the eight kindreds studied (table 4), all of the mutant alleles proved to be identical when only the eight diallelic markers were considered. Even when the two flanking multiallelic HVR markers are included, all but one of the probands carried and transmitted identical mutant haplotypes. This one exception was in the 3' HVR: seven subjects carried the hypervariable element HVE 48, while the eighth carried HVE 46 (table 4). Although this discrepancy could be explained by recombination between the 3500 mutation and the HVR, it is more likely to be attributable to unequal crossover or slippage during DNA replication within the HVR itself. In a study of spontaneous change to new-length (i.e., nonparental) alleles within pedigrees for a variety of hypervariable loci, Jeffreys et al. (1988) reported that, on average, such events lead to approximately a 5%

Ludwig and McCarthy gain or loss in allele copy repeat number. The postulated change from 48 to 46 copies of the apo B 3' flanking repeat copy number is consistent with this view. It should also be noted that these same authors reported substantial rates of spontaneous mutation to new-length alleles only for those HVRs displaying a very high (i.e., >95%) degree of heterozygosity. The 3' HVR near the apo B gene, with a heterozygosity index of about .78 (Ludwig et al. 1989), falls outside this category. In contrast, in none of the kindreds studied by various workers have new-length alleles appeared that are inconsistent with normal Mendelian segregation (Huang and Breslow 1987; Jenner et al. 1988). Thus, at least for the limited number of mutant subjects studied, the haplotypes underlying the 3500 mutation are essentially identical. Given the high degree of resolution (theoretically more than 30,000 possible haplotypes in the absence of linkage disequilibrium), this result suggests the existence of a common ancestral chromosome and provides no evidence for recurrent mutations at this potential CG mutational hot spot. The similarity of these mutant haplotypes is entirely consistent with a founder effect, although this interpretation cannot be validated with the data presently available. It is, of course, possible that other haplotypes may appear as more subjects are examined. Furthermore, the present data offer no evidence for recombination other than the one instance within the 3' HVR. Therefore, this mutation is unlikely to be an ancient one. (As a general rule, it has been observed that, while haplotypes are ancient markers that predate human racial divergence, many mutations of clinical interest are of relatively recent origin [Orkin and Kazazian 1984].) This conclusion may be contrasted with the most common mutation leading to a defect in adenosine deaminase (ADA). This mutation, also at a CG dinucleotide, occurs on different haplotypes (Markert et al. 1989). Limited haplotype analysis using only three markers was sufficient to demonstrate that the seven alleles carrying this same mutation are associated with three distinct haplotypes. On the other hand, the present results for apo B are similar to those reported for the phenylalanine hydroxylase locus. In this case, where detailed analysis using eight RFLP markers resolved 46 haplotypes, each of four different phenylketonuria (PKU) mutations was associated with only one haplotype (Daiger et al. 1989). In the hemoglobin gene cluster, where a wide variety of mutations have been studied at the population level, most mutations are primarily associated with specific haplotypes (Orkin et al. 1982), a result consistent with

Haplotype Analysis of Apolipoprotein B

the view that such mutations originated in specific ethnic groups (Antonarakis et al. 1985). However, in many cases a given mutation has spread to new chromosome backgrounds as a result of recombination. Furthermore, several examples of recurrent P-thalassemic mutations have been documented (Huang et al. 1986), suggesting that certain regions of the 0-globin gene are hypermutable. At the present time, our analysis of this apo B mutation has been limited to subjects drawn from populations in North America and Europe of predominantly Caucasian origin. Together with their common haplotype, the high frequency of this mutation in such populations suggests a Caucasian origin. However, this hypothesis must remain tentative until other populations are studied. Further surveys of other populations are planned in conjunction with a search for other mutations that result in defective LDL.

Acknowledgments This research was supported by National Institutes of Health grant HL38781. The authors thank Al Averbach and Sally Gullatt Seehafer for editorial assistance, Joan Ketchmark for manuscript preparation, and Charles Benedict and Tom Rolain for graphics.

References Antonarakis SE, Kazazian HHJr, Orkin SH (1985) DNA polymorphism and molecular pathology of the human globin gene clusters. Hum Genet 69:1-14 Boerwinkle E, Chan L (1989) A three codon insertion/deletion polymorphism in the signal peptide region of the human apolipoprotein B (apoB) gene directly typed by the polymerase chain. Nucleic Acids Res 17:4003 Boerwinkle E, Xiong W. Fourest E, Chan L (1989) Rapid typing of tandemly repeated hypervariable loci by the polymerase chain reaction: application to the apolipoprotein B 3' hypervariable region. Proc Natl Acad Sci USA 86: 212-216 Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32: 314-331 Daiger SP, Chakraborty R, Reed L, Fekete G, Schuler D, Berenssi G, Nasz I, et al (1989) Polymorphic DNA haplotypes at the phenylalanine hydroxylase (PAH) locus in European families with phenylketonuria (PKU). Am J Hum Genet 45:310-318 Friedl W, Ludwig EH, Paulweber B, Sandhofer F, McCarthy BJ (1990) Hypervariability in a minisatellite 3' of the apolipo-

719 protein B gene in patients with coronary heart disease compared with normal controls. J Lipid Res 31:659-665 Goldstein JL, Brown MS (1977) The low-density lipoprotein pathway and its relation to atherosclerosis. Annu Rev Biochem 46:897-930 Hegele RA, Huang LS, Herbert PN, Blum CB, Buring JE, Hennekens CH, Breslow J (1986) Apolipoprotein B-gene DNA polymorphisms associated with myocardial infarction. N Engl J Med 315:1509-1515 Higgs DR, WainscoatJS, FlintJ, Hill AVS, Thein SL, Nicholls RD, Teal H, et al (1986) Analysis of the human a-globin gene cluster reveals a highly informative genetic locus. Proc Natl Acad Sci USA 83:5165-5169 Huang LS, Breslow J (1987) A unique AT-rich hypervariable minisatellite 3' to the apoB gene defines a high information restriction fragment length polymorphism. J Biol Chem 262:8952-8955 Huang S, Wong C, Antonarakis SE, Rolien T. Lo WHY, Kazazian HH Jr (1986) The same TATA box 0-thalassemia mutation in Chinese and US blacks: another example of independent origins of mutation. Hum Genet 74:162-164 Innerarity TL, Mahley RW, Weisgraber KH, Bersot TP, Krauss RM, Vega GL, Grundy SM, et al. Familial defective apolipoprotein B100: a mutation of apolipoprotein B that causes hypercholesterolemia. J Lipid Res (in press) Innerarity TL, Weisgraber KH, Arnold K, Mahley RW, Krauss RM, Vega GL, Grundy SM (1987) Familial defective apolipoprotein B100: low density lipoproteins with abnormal receptor binding. Proc Natl Acad Sci USA 84:69196923 Jarman AP, Higgs DR (1988) A new hypervariable marker for the human a-globin gene cluster. Am J Hum Genet 43:249-256 Jeffreys AJ, Royle NJ, Wilson V, Wong Z (1988) Spontaneous mutation rates to new length alleles at tandem repetitive hypervariable loci in human DNA. Nature 332:278-281 Jeffreys AJ, Wilson V, Thein SJ (1985) Hypervariable minisatellite regions in human DNA. Nature 314:67-73 Jenner K, Sidoli A, Ball M, Rodriguez JR, Pagani F, Giudici G, Vergani C (1988) Characterization of genetic markers in the 3' end of the apo B gene and their use in family and population studies. Atherosclerosis 69:39-49 Koeberl DD, Bottema CDK, Buerstedde J-M, Sommer SS (1989) Functionally important regions of the factor IX gene have a low rate of polymorphism and a high rate of mutation in the dinucleotide CpG. AmJ Hum Genet 45:448-457 Litt M, Luty JA (1989) A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. AmJ Hum Genet 44:397-401 Ludwig EH, Blackhart BD, Pierotti VR, Caiati L, Fortier C, Knott T, Scott J, et al (1987) DNA sequence of the human apolipoprotein B gene. DNA 6:363-372 Ludwig EH, Friedl W, McCarthy BJ t1989) High-resolution analysis of a hypervariable region in the human apolipoprotein B gene. Am J Hum Genet 45:458-464

720 Markert ML, Norby-Slycord C, Ward FE (1989) A high proportion of ADA point mutations associated with a specific alanine-to-valine substitution. Am J Hum Genet 45:354-361 Nakamura Y, Leppert M, O'Connell P, Wolff R, Holm T, Culver M, Martin C (1987) Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 235:1616-1622 Orkin SH, Kazazian HH Jr (1984) The mutation and polymorphism of the human 3-globin gene and its surrounding DNA. Annu Rev Genet 18:131-171 Orkin SH, Kazazian HHJr, Antonarakis SE, Goff SC, Boehm CD, Sexton JP, Weber PG, et al (1982) Linkage of 13-thalassaemia mutations and 3-globin gene polymorphisms with DNA polymorphisms in human 13-globin gene cluster. Nature 296:627-629 Rajput-Williams J, Knott TJ, Wallis SC, Sweetnam P, Yarnell J. Cox N, Bell GI, et al (1988) Variation of apolipoprotein-B gene is associated with obesity, high blood cholesterol levels, and increased risk of coronary heart disease. Lancet 2:1442-1446 Saiki RK, Gelfand DH, Stoffel SJ, Scharf SJ, Higuchi R, Horn GT, Mullis KB, et al (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491

Ludwig and McCarthy Soria LF, Ludwig EH, Clarke HRG, Vega GL, Grundy SM, McCarthy BJ (1989) Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100. Proc Natl Acad Sci USA 86:587-591 Vega GL, Grundy SM (1986) In vivo evidence for reduced binding of low density lipoproteins to receptors as a cause of primary moderate hypercholesterolemia. J Clin Invest 78:1410-1414 Wang X, Schlapfer Y, Ma R, Butler R, Elovson J, Schumaker VN (1988) Apolipoprotein B: the Ag(al/d) immunogenetic polymorphism coincides with a T-to-C substitution at nucleotide 1981, creating an Alu I restriction site. Arteriosclerosis 8:429-435 Weber JL, May PE (1989) Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am J Hum Genet 44:388-396 Young SG, Hubl ST (1989) An ApaLl restriction site polymorphism is associated with the MB19 polymorphism in apolipoprotein B. J Lipid Res 30:443-449 Youssoufian H, Antonarakis SE, Bell W, Griffin AM, Kazazian HH Jr (1988) Nonsense and missense mutations in hemophilia A: estimate of the relative mutation rate at CG dinucleotides. Am J Hum Genet 42:718-725