Digestive Diseases and Sciences, Vol. 37, No. 10 (October 1992), pp. 1483-1488
HCV RNA and Antibody to HCV Core Protein in Japanese Patients with Chronic Liver Disease NOBUKAZU YUKI, NORIO HAYASHI, HIDEKI HAGIWARA, TETSUO TAKEHARA, AKINORI KASAHARA, HIDEYUKI FUSAMOTO, SADAO MANABE, AKIHISA TAKAMIZAWA, TAKENOBU KAMADA, and HIROTO OKAYAMA
We evaluated the prevalence of hepatitis C virus (HCV) RNA and antibody (antiHCVcore) to the putative HCV core protein in Japanese patients with chronic liver disease. Sera were screened by solid-phase enzyme immunoassay with a recombinant HCV core protein and by the reverse transcription-polymerase chain reaction (RT-PCR) test which directly detects the HCV genome. Anti-HCVcore was detected with high titers in 95% (69/73) of chronic non-A, non-B hepatitis, and 94% (65/69) of anti-HCVcorepositive patients had the genome. Anti-HCVcore was also found with lower titers in 24% (10/41) of chronic hepatitis B virus carriers, and three of them had the genome. Only one (3%) of the 35 patients negative for anti-HCVcore tested positive to RT-PCR. These findings indicate the overwhelming prevalence of HCV infection in Japanese patients with chronic non-A, non-B hepatitis and a close relationship between the presence of anti-HCVcore and chronic hepatitis C in this population. KEY WORDS" hepatitis C virus core protein antibody; hepatitis C; hepatitis C virus; hepatitis C virus RNA; non-A, non-B hepatitis; polymerase chain reaction.
The genome of a non-A, non-B hepatitis virus was cloned recently from a chimpanzee and termed hepatitis C virus (HCV) (1). The HCV genome is a positive-stranded RNA molecule of approximately 10 kb and codes for a polyprotein. The 5'-terminal sequence is thought to be the structural region coding for core and envelope proteins with the larger remaining part coding for nonstructural proManuscript received November 18, 1991; accepted May 5, 1992. From the First Department of Medicine, Osaka University Medical School, Osaka 553; Research Foundation for Microbial Diseases of Osaka University, Kannonji, Kagawa 768; and Department of Molecular Genetics, Research Institute for Microbial Diseases of Osaka University, Suita, Osaka 565, Japan. This work was supported by a Grant-in-Aid from the Ministry of Education, Science and Culture, Japan. Address for reprint requests: Dr. Norio Hayashi, First Department of Medicine, Osaka University Medical School, Fukushima 1-1-50, Fukushima-ku, Osaka 553, Japan.
teins. A part of the nonstructural region of the genome was expressed in yeast (C100-3 antigen), and a specific assay was established to detect antibody to this recombinant antigen (anti-C100-3) (2). The development of this assay shed light on the implications of HCV in various types of liver diseases. Using this test system, HCV has been shown to be the predominant agent of non-A, non-B hepatitis in different geographical areas (3-8). However, a considerable proportion of Japanese patients with non-A, non-B hepatitis test negative for anti-C100-3, and the etiological agent remains to be determined. So far, it has also been demonstrated that HCV RNA can be detected even in patients negative for anti-C100-3 (9) and relatively low sensitivity is a problem associated with this diagnostic system perhaps for the following reasons. The re-
Digestive Diseases and Sciences, Vol. 37, No. 10 (October 1992)
0163-2116/92/1000-1483506.50/09 1992PlenumPublishingCorporation
1483
YUKI ET AL gion o f the polyprotein corresponding to CI00-3 is s o m e w h a t variable in sequence a m o n g different H C V strains. M o r e o v e r , the CI00-3 region might h a v e only w e a k antigenicity or simply not be exp o s e d to the host i m m u n e s y s t e m during H C V propagation. Recently, e D N A clones, which c o v e r the entire H C V g e n o m e , w e r e isolated f r o m h u m a n c a r d e r s in this local a r e a (10). B a s e d on this cloned genome, we d e v e l o p e d a diagnostic a s s a y for the detection o f antibody (anti-HCVcore) against putative core protein, which is highly c o n s e r v e d a m o n g H C V strains. Using this a s s a y s y s t e m and the sensitive reverse transcription-polymerase chain reaction (RT-PCR) test for the detection o f H C V R N A , we evaluated the p r e v a l e n c e of H C V infection in J a p a n e s e patients with chronic liver disease.
M A T E R I A L S AND M E T H O D S Expression and Purification of HCV Core Protein. Complete details of the expression and purification strategies will be reported elsewhere (Okayama et al, manuscript in preparation). Briefly, an HCV cDNA fragment spanning the putative core region (nucleotides 369-700) (10) was inserted into plasmid expression vector, downstream of the phage T7 promoter and expressed in Escherichia coil To obtain purified core protein necessary for the ELISA tests, cell extracts were purified using hydroxyapatite column chromatography. A protein with a calculated molecular weight of 15.3 kDa was identified. It was specifically reacted to sera from patients with HCV infection in immunoblotting experiments. Antisera raised against this protein in rabbits by standard methods reacted strongly to the protein. Clinical Status of Patients Tested. Sera were obtained from 73 Japanese patients with chronic non-A, non-B hepatitis. The diagnosis was based on clinical histories and laboratory examinations. All patients were negative for HB s antigen (HBsAg) and showed no evidence of alcoholic, autoimmune, or drug-induced liver disease. Nine patients had a history of a blood transfusion 7-34 (median 20) years before diagnosis. Liver histology, available for 51 patients, showed the features of chronic persistent hepatitis (CPH) in 10 cases, chronic active hepatitis (CAH) in 24, and liver cirrhosis in 17. The remaining 22 patients had cirrhosis with hepatocellular carcinoma (HCC) as diagnosed by imaging procedures (ultrasonography, computed tomography plus angiography). Also examined were sera from 41 Japanese patients with chronic hepatitis B virus (HBV) infection, who were carriers of HBsAg for more than 12 months. Among these patients, 27 had HB~ antigen (HBeAg) and 12 had antibody to HB~Ag (anti-HB~). No patients had ever received blood transfusions. Four were asymptomatic HBV carriers with normal liver function tests, and the rest were HBV carriers with chronic liver disease. Liver histology
1484
indicated CPH in 15 cases, CAH in 11, and cirrhosis in 6. The remaining five patients had cirrhosis with HCC. The control sera were obtained from 20 healthy subjects with normal liver function tests, who had no known HBV markers, and were negative for anti-C100-3. All samples were stored at - 8 0 ~ C. Serological Testing. HBsAg, HBeAg, and anti-HBe were determined by commercially available radioimmunoassays (Dainabot Co., Ltd., Tokyo, Japan). Anti-Cl00-3 was tested with an ELISA system (Ortho Diagnostic Systems Co., Ltd., Tokyo, Japan). The assay was performed according to the manufacturer's instructions. Detection of Serum Antibody to HCV Core Protein. All serum samples were tested for the presence of antiHCVcore by a solid-phase enzyme immunoassay. Microtiter plates (Flow Laboratories Inc., McLean, Virginia) were coated with 50 ixl of HCV core protein (2 p~g/ml) diluted in 50 mmol/liter sodium carbonate (pH 9.6) at 4~ C for 24 hr. The plates were then washed eight times with 0.1% (v/v) Tween-20 in Tris-buffered saline (pH 8.0) (TBS) and postcoated with heat-sterilized milk protein (Block Ace, Snow Brand Milk Products Co., Ltd., Tokyo, Japan) at 37~ C for 2 hr. The plates were washed again with 0.1% Tween-20 in TBS and incubated at room temperature for 1 hr with 50 Ixl of 50-fold diluted test sera. After another washing, 50 ~1 of peroxidase-conjugated goat anti-human IgG antibody (Kirkegaard and Perry Laboratories Inc., Gaithersburg, Maryland) was added to the plates followed by incubation at room temperature for another 1 hr. They were then washed, and 100 ~1 of a solution containing o-phenylene diamine and H202 was added to each well. After a 30-min incubation at room temperature, the reaction was stopped with 50 Ixl of 4 N H2SO 4 and the optical density at 492 nm (OD492) was measured with a photo-enzyme-linked immunosorbent assay colorimeter (Titertek Multiscan MCC/340, Flow Laboratories Inc.). In each assay, sera from 20 healthy subjects with normal liver function tests and no known HBV markers, and negative for anti-C100-3 were included as negative controls. The mean value + 3 SD of OD492 for 20 control subjects was taken as the cutoff value. Samples with a cutoff index (CI) > 1.0 were considered positive. All assays were done in duplicate. All positive sera were retested in triplicate both in the presence and absence of the coated core protein in order to confirm the specificity and the reproducibility. The specificity was confirmed by the decrease in OD492within the negative range in the absence of the core protein. The specificity of the solid-phase enzyme immunoassay was further confirmed by absorption tests. The serum reactivity could be inhibited by preincubation with excess amounts of core protein. Detection of HCV RNA by Polymerase Chain Reaction. HCV RNA was extracted from blood samples, converted to eDNA with reverse transcriptase and then amplified by the polymerase chain reaction (PCR) method as described elsewhere (11, 12). Oligonucleotides corresponding to the highly conserved 5'-noncoding region of the HCV genome (13) were used as primers: antisense primer, 5'CATGGTGCACGGTCTACGAG3' (nucleotides 308327); sense primer, 5'ACTCCACCATAGATCACTCC3' (nucleotides 7-26). RNA was prepared from sera as Digestive Diseases and Sciences, Vol. 37, No. 10 (October 1992)
HCV RNA AND ANTIBODY TO HCV CORE PROTEIN TABLE 1. DETECTIONOF ANTIBODYTO HCV COREPROTEIN(ANTI-HCVcoRE)AND HCV RNA SEQUENCESIN CHRONICLIVER DISEASERELATIVETO THE PRESENCEOF ANTI-CI00-3 Patients
Anti-C100-3-positive chronic non-A, non-B liver disease Anti-C 100-3-negative chronic non-A, non-B liver disease Anti-C100-3-negative chronic HBV infection
N
Age (years)*
Sex (M/F)
Past history of blood transfusion
Anti-HCVcore prevalence
Detection of HCV R N A
44
56 -+ 10t
29/15
4/44 (9%)~:
44/44 (100%)t,w
43/44 (98%)t,82
29
56 -+ lit
18/11
5/29 (17%)t
25/29 (86%)t
23/29 (79%)t
41
42 --- 12
32/9
0/41
10/41 (24%)
3/41 (7%)
*Values are mean -+ SD. tP < 0.01 vs anti-C100-3-negative chronic HBV infection. SP < 0.05 vs anti-Cl00-3-negative chronic HBV infection. w < 0.05 vs anti-Cl00-3-negative chronic non-A, non-B liver disease. 82 < 0.01 vs anti-Cl00-3-negative chronic non-A, non-B liver disease.
follows. Two hundred microliters of serum was mixed with 100 i~1 of 21% polyethylene glycol 6000 in 1.5 mol/liter NaCI and left at 4~ C for 2 hr. After centrifugation at 18,500g for 20 min at 4~ C, the pellet was resuspended in 600 I~1 of 0.1 mol/liter Tris HC1 buffer (pH 7.5) containing 4 mol/liter guanidinium thiocyanate, 0.5% sodium lauryl sarcosinate, and 1% 13-mercaptoethanol. The lysate was extracted with phenol-chloroform, and RNA was precipitated from the aqueous phase by chilling at - 8 0 ~ C for 1 hr after addition of 0.1 vol of 3 mol/liter sodium acetate (pH 6.0) and 2.5 vol of absolute ethanol and by subsequent centrifugation. The pelleted RNA was rinsed with 70% ethanol, dried, and dissolved in 7 ixl of distilled water, cDNA was synthesized with 200 units of Moloney murine leukemia virus reverse transcriptase (Bethesda Research Laboratories, Gaithersburg, Maryland), 20 pmol of the antisense primer, 1 mmol/liter each dNTP and 20 units of RNase inhibitor (Promega, Madison, Wisconsin) in a final volume of 20 Ixl as described by the vendor. The cDNA product was added to 80 I~1 of amplification mixture containing 2.5 units of Taq polymerase (Perkin-Elmer Cetus, Norwalk, Connecticut), 20 pmol each of both primers, 1.2 mmol/liter MgCI2 and 45 mmol/liter KC1. The mixture was overlaid with mineral oil and amplified in a DNA thermal cycler (Perkin-Elmer Cetus) for 40 cycles (at 94~ C for 0.5 min, at 55~ C for 1 min and at 72 ~ C for 1 min), followed by a 10-min final extension at 72 ~ C. A 10-~1 aliquot was taken, electrophoresed on an agarose gel, transferred onto a nylon membrane, hybridized with 32p-labeled HCV cDNA that corresponds to the amplified sequence, and autoradiographed. Because of the extreme sensitivity of PCR, great care was taken to prevent false-positive results, and measures recommended by Kwok and Higuchi (14) for preventing contamination were strictly applied throughout this study. Statistical Analysis. Statistical analysis for group comparisons was done by the • method and the unpaired Student's t test. Digestive Diseases and Sciences, Vol. 37, No. 10 (October 1992)
RESULTS
Detection of Anti-HCVcore and HCV RNA Sequences Relative to Detection of Anti-C100-3. Seventy-three patients with chronic non-A, non-B hepatitis and 41 chronic H B V carriers were tested for anti-C100-3. Anti-C100-3 was found in 44 (60%) of the 73 patients with chronic non-A, non-B hepatitis (8 with C P H , 14 with C A H , I1 with liver cirrhosis, and 11 cirrhotics with HCC). On the other hand, none of the 41 H B V carriers had detectable titers o f anti-C100-3. T h e anti-C100-3-positive and -negative patients were then tested for a n t i - H C V c o r e and H C V R N A sequences. T h e results are s u m m a r i z e d in Table 1 along with the clinical characteristics of the patients. T h e m e a n age of the patients with anti-C100-3-positive and -negative chronic non-A, non-B hepatitis was significantly higher (56 - 10 years and 56 --- 11 years, respectively) than that of the H B V carriers (42 --- 12 years) (P < 0.01 for both). Blood transfusions had b e e n received b y four (9%) patients with anti-C100-3-positive chronic non-A, non-B hepatitis and five (17%) with antiC100-3-negative chronic non-A, non-B hepatitis. All the anti-C100-3-positive patients (44/44) had detectable levels of a n t i - H C V c o r e , and 98% (43/44) had H C V R N A sequences. A n t i - H C V c o r e was also found frequently in cases of anti-Cl00-3-negative chronic non-A, non-B hepatitis 25/29 (86%), including four of the five patients w h o had previously received blood transfusions. H C V R N A sequences were detected in 22 (88%) of the 25 patients positive for a n t i - H C V c o r e and in a n o t h e r patient negative for it. Despite the fact that all the H B V carriers
1485
YUKI ET AL TABLE 2. DETECTION OF ANTIBODY TO HCV CORE PROTEIN (ANTI-HCVcoRE) AND HCV RNA SEQUENCES IN CHRONIC NoN-A, NoN-B LIVER DISEASE OF VARIOUS CATEGORIES
Patients*
N
CPH CAH LC LC + HCC
10 24 17 22
Age (years) ~ 49 54 58 60
--- 12:Lw 4- 12w • 8 • 7
Sex (M/F) 7/3 10/1482 12/5 18/4
Past history of blood transfusion 2/10 2/24 2/17 3/22
(20%) (8%) (12%) (14%)
Anti-HCVcore prevalence 9/10 24/24 16/17 20/22
(90%) (100%) (94%) (91%)
Detection of HCV R N A 10/10 22/24 15/17 19/22
(100%) (92%) (88%) (86%)
*CPH, chronic persistent hepatitis; CAH, chronic active hepatitis; LC, liver cirrhosis; HCC, hepatocellular carcinoma. tValues are mean • SD. :~P < 0.05 vs LC. w < 0.05 vs LC + HCC. 82 < 0.01 vs LC + HCC.
tested were negative for anti-C100-3, anti-HCVcore was found in 10 (24%) of the 41 carriers. Among the 10 anti-HCVcore-positive HBV carriers, four were with CPH, two with CAH, three with liver cirrhosis, and one with cirrhosis with HCC. Eight of these 10 were positive for HBeAg, and two had anti-HBe. HCV RNA sequences were detected in three (30%) of the 10 anti-HCVcore-positive HBV carriers (one with CPH and two with liver cirrhosis), who all were positive for HB~Ag. Thus, there was a quite remarkable correlation between the detection of anti-HCVcore and the presence of HCV RNA sequences in patients with chronic non-A, non-B hepatitis. Approximately 94% of the anti-HCVcore-positive patients (65/69) had detectable levels of HCV RNA, whereas 98% of the HCV RNA-positive patients (65/66) were positive for anti-HCVcore. In contrast, 98% of the anti-C100-3-positive patients (43/44) had HCV RNA whereas only 65% of the HCV RNA-positive patients (43/66) were positive for anti-C100-3. In chronic non-A, non-B hepatitis, anti-HCVcore was found frequently, irrespective of the stage of the liver disease, as were the HCV RNA sequences (Table 2). Anti-HCVcore was found in 90% (9/10) of CPH, 100% (24/24) of CAH, 94% (16/17) of cirrhosis, and 91% (20/22) of cirrhosis with HCC. HCV RNA sequences were detected in 100% (10/10) of CPH, 92% (22/24) of CAH, 88% (15/17) of cirrhosis, and 86% (19/22) of cirrhosis with HCC. Anti-HCVcore Titers and Detection of HCV RNA Sequences. Figure 1 presents the anti-HCVcore titers in chronic non-A, non-B hepatitis for comparison with those in chronic HBV infection. AntiHCVcore showed significantly higher titers in each category of chronic non-A, non-B hepatitis than in HBV carriers (P < 0.01). Among those with chronic non-A, non-B hepatitis, 64 (93%) of 69 antiHCVcore-positive cases tested positive for it with a 1486
cutoff index (CI) > 5, while none of the chronic HBV carriers did. When we examined the total group, there was a significant correlation between the occurrence of high anti-HCVcore titers and the detection of HCV RNA sequences. Patients with high titers of anti-HCVcore (ie, with CI > 5) seemed to have a significantly (P < 0.01) higher prevalence (63 of 64 = 98%) of HCV RNA sequences than those with lower titers of antiHCVcore [ie, with CI between 1 and 5 (5 of 15 = 33%)] and those negative for anti-HCVcore (1 of 35 = 3%). A significant difference in the prevalence of HCV RNA sequences was also observed between the group with lower titers of anti-HCVcore and that negative for it (P < 0.01). DISCUSSION The present study revealed the overwhelming prevalence of HCV infection in Japanese patients with chronic non-A, non-B hepatitis. The prevalence of HCV RNA and anti-HCVcore was much higher than expected from the detection of antiC100-3. So far, a few reports have suggested that antibodies to the core gene products of HCV are efficiently induced during HCV infection and may contribute to a more accurate diagnosis (15-17). However, the clinical implication of anti-HCVcore in chronic liver disease has not been fully documented in relation to the detection of the HCV genome. Our study demonstrated that the occurrence of anti-HCVcore closely correlated with chronic HCV infection, as proved by the presence of the HCV genome. The correlation between the occurrence of anti-HCVcore and the presence of HCV RNA sequences exceeded 90% throughout different pathological stages of chronic non-A, non-B hepatitis, indicating that anti-HCVcore is a specific diagnostic marker for HCV infection in this Digestive Diseases and Sciences, Vol. 37, No. tO (October 1992)
HCV RNA AND ANTIBODY TO HCV CORE PROTEIN
25
d > -o
20
o
.Q c-
IIO .gl~f
10
-1-
olGe
I
c0o
---6--
5 g 0
-
-
~
Chronic HBV Infection (n:41)
CPH (n=10)
CAH (n=24)
LC (n:17)
LC + HCC (n:22)
Chronic, Non- A, Non- B Liver Disease
Fig 1. Titers of antibodyto HCV core protein (anti-HCVcore)in chronicliver disease relative to the detection of HCV RNA sequences. Antibodyshowed significantlyhigher titers in chronic non-A, non-B liver disease of various categoriesthan in chronic HBV infection(P < 0.01). CPH = chronic persistent hepatitis; CAH = chronic active hepatitis; LC = liver cirrhosis; HCC = hepatocellular carcinoma. Open circles represent sera negative for HCV RNA sequences, and solid circles represent sera positive for HCV RNA sequences. category of liver disease. This strong correlation may be attributable to its higher immunogenicity and also its higher amino acid conservation among different HCV strains. Moreover, the HCV strain we used to make the putative core antigen might be identical to the strain that infected the patients we examined, since most of the patients we examined came from the same local area as cDNA used to make the core protein was cloned. The final outcome of chronic viral hepatitis is cirrhosis and hepatocellular carcinoma. In HBV infection, viral replication is usually not very active in patients with advanced liver disease, who are thought to have had a long period of HBV infection, compared with early stages of infection. In HCV infection, on the other hand, ongoing viral replication was revealed even in such patients. We found the frequent occurrence of HCV RNA sequences in each category of chronic non-A, non-B hepatitis. Anti-HCVcore was also found frequently with high titers in each category. Both findings indicate that strong viral production persists throughout various stages of liver disease induced by HCV. Quick responses to interferon treatment in chronic HCV infection suggest that liver injury in chronic HCV infection is a direct cytopathic effect of the virus Digestive Diseases and Sciences, VoL 37, No. 10 (October 1992)
(18, 19), while in HBV infection it is considered to be immunologically mediated. Our findings were compatible with this idea. Liver injury in chronic HCV infection may progress in a somewhat different manner from HBV infection. HCV, known to be a positive-stranded RNA virus, has not been shown to be integrated in the cellular DNA, and it remains to be worked out whether HCV itself can contribute to liver carcinogenesis. However, persistent liver injury caused by persistent HCV infection may also be related to the development of HCC (3, 6-8). Another finding in this study is that a small proportion of chronic HBV carriers negative to anti-C100-3 assay had low titers of anti-HCVcore. Using anti-C100-3 assay, it has been shown that possible coinfection with HBV and HCV may be a risk factor of more serious liver disease (4, 8, 20). As for patients with low titers of anti-HCVcore, however, tests for HCV RNA sequences were often negative. In such cases, anti-HCVcore may indicate previous exposure to HCV, as is the case in the detection of low titers of antibody to hepatitis B core antigen (anti-HBc) in chronic non-A, non-B hepatitis. We conjecture that exposure to the two viruses may be more common, indicating a similar mode of infection of both viruses.
1487
Y U K I ET AL
Again, the current study revealed that HCV is indeed a major causative agent of chronic non-A, non-B hepatitis in Japan. Although persistent HCV infection can be confirmed by amplification of HCV RNA sequences with the polymerase chain reaction, the techniques are not routinely available. Our study suggests that determination of anti-HCVcore titers may serve as a viral replicative marker. REFERENCES 1. Choo Q-L, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M: Isolation of a eDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 244:359-362, 1989 2. Kuo G, Choo Q-L, Alter HJ, Gitnick GL, Redeker AG, Purcell RH, Miyamura T, Dienstag JL, Alter MJ, Stevens CE, Tegtmeier GE, Bonino F, Colombo M, Lee W-S, Kuo C, Berger K, Shuster JR, Overby LR, Bradley DW, Houghton M: An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 244:362-364, 1989 3. Bruix J, Barrera JM, Calvet X, Ereilla G, Costa J, SanchezTapias JM, Ventura M, Vail M, Bruguera M, Bru C, Castillo R, Rodes J: Prevalence of antibodies to hepatitis C virus in Spanish patients with hepatocelhilar carcinoma and hepatic cirrhosis. Lancet 2:1004-1006, 1989 4. Colombo M, Kuo G, Choo QL, Donato MF, Ninno ED, Tommasini MA, Dioguardi N, Houghton M: Prevalence of antibodies to hepatitis C virus in Italian patients with hepatocellular carcinoma. Lancet 2:1006-1008, 1989 5. Hopf U, Mtller B, Kiither D, Stemerowicz R, Lobeck H, Liidtke-Handjery A, Walter E, Blum HE, Roggendorf M, Deinhardt F: Long-term follow-up of posttransfusion and sporadic chronic hepatitis non-A, non-B and frequency of circulating antibodies to hepatitis C virus (HCV). J Hepatol 10:69-76, 1990 6. Saito I, Miyamura T, Ohbayashi A, Harada H, Katayama T, Kikuchi S, Watanabe Y, Koi S, Onji M, Ohta Y, Choo Q-L, Houghton M, Kuo G: Hepatitis C virus infection is associated with the development of hepatocellular carcinoma. Proc Natl Acad Sci USA 87:6547-6549, 1990 7. Kiyosawa K, Sodeyama T, Tanaka E, Gibo Y, Yoshizawa K, Nakano Y, Furuta S, Akahane Y, Nishioka K, Purcell RH, Alter HJ: Interrelationship of blood transfusion, non-A, non-B hepatitis and hepatocellular carcinoma: Analysis by detection of antibody to hepatitis C virus. Hepatology 12:671-675, 1990 8. Yuki N, Hayashi N, Kasahara A, Hagiwara H, Katayama K, Fusamoto H, Kamada T: Hepatitis B virus markers and antibodies to hepatitis C virus in Japanese patients with hepatocellular carcinoma. Dig Dis Sci 37:65-72, 1992
1488
9. Weiner AJ, Kuo G, Bradley DW, Bonino F, Saracco G, Lee C, Rosenblatt J, Choo Q-L, Houghton M: Detection of hepatitis C viral sequences in non-A, non-B hepatitis. Lancet 335:1-3, 1990 10. Takamizawa A, Mori C, Fuke I, Manabe S, Murakami S, Fujita J, Onishi E, Andoh T, Yoshida I, Okayama H: Structure and organization of the hepatitis C virus genome isolated from human carriers. J Virol 65:1105-1113, 1991 11. Hagiwara H, Hayashi N, Mira E, Hiramatsu N, Ueda K, Takehara T, Yuki N, Kasahara A, Fusamoto H, Kamada T: Detection of hepatitis C virus RNA in chronic non-A, non-B liver disease. Gastroenterology 102:692-694, 1992 12. Takehara T, Hayashi N, Mita E, Hagiwara H, Ueda K, Katayama K, Kasahara A, Fusamoto H, Kamada T: Detection of complementary sequence of hepatitis C virus RNA by reverse transcription and polymerase chain reaction. Implication for hepatitis C virus replication in infected tissue. Hepatology 15:387-694, 1992 13. Okamoto H, Okada S, Sugiyama Y, Yotsumoto S, Tanaka T, Yoshizawa H, Tsuda F, Miyakawa Y, Mayumi M: The 5'-terminal sequence of the hepatitis C virus genome. Jpn J Exp Med 60:167-177, 1990 14. Kwok S, Higuchi R: Avoiding false positives with PCR. Nature 339:237-238, 1989 15. Okamoto H, Munekata E, Tsuda F, Takahashi K, Yotsumoto S, Tanaka T, Tachibana K, Akahane Y, Sugai Y, Miyakawa Y, Mayumi M: Enzyme-linked immunosorbent assay for antibodies against the capsid protein of hepatitis C virus with a synthetic oligopeptide. Jpn J Exp Med 60:223233, 1990 16. Harada S, Watanabe Y, Takeuchi K, Suzuki T, Katayama T, Takebe Y, Saito I, Miyamura T: Expression of processed core protein of hepatitis C virus in mammalian cells. J Virol 65:3015-3021, 1991 17. Nasoff MS, Zebedee SL, Inchausp6 G, Prince AM: Identification of an immunodominant epitope within the capsid protein of hepatitis C virus. Proc Natl Acad Sci USA 88:5462-5466, 1991 18. Davis GL, Balart LA, Schiff ER, Lindsay K, Bodenheimer HC, Perrillo RP, Carey W, Jacobson IM, Payne J, Dienstag JL, Van Thiel DH, Tamburro C, Lefkowitch J, Albrecht J, Meschievitz C, Ortego TJ, Gibas A: Treatment of chronic hepatitis C with recombinant interferon alpha. A multicenter randomized, controlled trial. N Engl J Med 321:1501-1506, 1989 19. Bisceglie AM, Martin P, Kassianides C, Lisker-Melman M, Murray L, Waggoner J, Goodman Z, Banks SM, Hoofnagle JH: Recombinant interferon alfa therapy for chronic hepatitis C. A randomized, double-blind, placebo-controlled trial. N Engl J Med 321:1506-1510, 1989 20. Kew MC, Houghton M, Choo QL, Kuo G: Hepatitis C virus antibodies in southern African blacks with hepatocellular carcinoma. Lancet 335:873-874, 1990
Digestive Diseases and Sciences, Vol. 37, No. 10 (October 1992)
HCV RNA and Antibody to HCV Core Protein in Japanese Patients with Chronic Liver Disease NOBUKAZU YUKI, NORIO HAYASHI, HIDEKI HAGIWARA, TETSUO TAKEHARA, AKINORI KASAHARA, HIDEYUKI FUSAMOTO, SADAO MANABE, AKIHISA TAKAMIZAWA, TAKENOBU KAMADA, and HIROTO OKAYAMA
We evaluated the prevalence of hepatitis C virus (HCV) RNA and antibody (antiHCVcore) to the putative HCV core protein in Japanese patients with chronic liver disease. Sera were screened by solid-phase enzyme immunoassay with a recombinant HCV core protein and by the reverse transcription-polymerase chain reaction (RT-PCR) test which directly detects the HCV genome. Anti-HCVcore was detected with high titers in 95% (69/73) of chronic non-A, non-B hepatitis, and 94% (65/69) of anti-HCVcorepositive patients had the genome. Anti-HCVcore was also found with lower titers in 24% (10/41) of chronic hepatitis B virus carriers, and three of them had the genome. Only one (3%) of the 35 patients negative for anti-HCVcore tested positive to RT-PCR. These findings indicate the overwhelming prevalence of HCV infection in Japanese patients with chronic non-A, non-B hepatitis and a close relationship between the presence of anti-HCVcore and chronic hepatitis C in this population. KEY WORDS" hepatitis C virus core protein antibody; hepatitis C; hepatitis C virus; hepatitis C virus RNA; non-A, non-B hepatitis; polymerase chain reaction.
The genome of a non-A, non-B hepatitis virus was cloned recently from a chimpanzee and termed hepatitis C virus (HCV) (1). The HCV genome is a positive-stranded RNA molecule of approximately 10 kb and codes for a polyprotein. The 5'-terminal sequence is thought to be the structural region coding for core and envelope proteins with the larger remaining part coding for nonstructural proManuscript received November 18, 1991; accepted May 5, 1992. From the First Department of Medicine, Osaka University Medical School, Osaka 553; Research Foundation for Microbial Diseases of Osaka University, Kannonji, Kagawa 768; and Department of Molecular Genetics, Research Institute for Microbial Diseases of Osaka University, Suita, Osaka 565, Japan. This work was supported by a Grant-in-Aid from the Ministry of Education, Science and Culture, Japan. Address for reprint requests: Dr. Norio Hayashi, First Department of Medicine, Osaka University Medical School, Fukushima 1-1-50, Fukushima-ku, Osaka 553, Japan.
teins. A part of the nonstructural region of the genome was expressed in yeast (C100-3 antigen), and a specific assay was established to detect antibody to this recombinant antigen (anti-C100-3) (2). The development of this assay shed light on the implications of HCV in various types of liver diseases. Using this test system, HCV has been shown to be the predominant agent of non-A, non-B hepatitis in different geographical areas (3-8). However, a considerable proportion of Japanese patients with non-A, non-B hepatitis test negative for anti-C100-3, and the etiological agent remains to be determined. So far, it has also been demonstrated that HCV RNA can be detected even in patients negative for anti-C100-3 (9) and relatively low sensitivity is a problem associated with this diagnostic system perhaps for the following reasons. The re-
Digestive Diseases and Sciences, Vol. 37, No. 10 (October 1992)
0163-2116/92/1000-1483506.50/09 1992PlenumPublishingCorporation
1483
YUKI ET AL gion o f the polyprotein corresponding to CI00-3 is s o m e w h a t variable in sequence a m o n g different H C V strains. M o r e o v e r , the CI00-3 region might h a v e only w e a k antigenicity or simply not be exp o s e d to the host i m m u n e s y s t e m during H C V propagation. Recently, e D N A clones, which c o v e r the entire H C V g e n o m e , w e r e isolated f r o m h u m a n c a r d e r s in this local a r e a (10). B a s e d on this cloned genome, we d e v e l o p e d a diagnostic a s s a y for the detection o f antibody (anti-HCVcore) against putative core protein, which is highly c o n s e r v e d a m o n g H C V strains. Using this a s s a y s y s t e m and the sensitive reverse transcription-polymerase chain reaction (RT-PCR) test for the detection o f H C V R N A , we evaluated the p r e v a l e n c e of H C V infection in J a p a n e s e patients with chronic liver disease.
M A T E R I A L S AND M E T H O D S Expression and Purification of HCV Core Protein. Complete details of the expression and purification strategies will be reported elsewhere (Okayama et al, manuscript in preparation). Briefly, an HCV cDNA fragment spanning the putative core region (nucleotides 369-700) (10) was inserted into plasmid expression vector, downstream of the phage T7 promoter and expressed in Escherichia coil To obtain purified core protein necessary for the ELISA tests, cell extracts were purified using hydroxyapatite column chromatography. A protein with a calculated molecular weight of 15.3 kDa was identified. It was specifically reacted to sera from patients with HCV infection in immunoblotting experiments. Antisera raised against this protein in rabbits by standard methods reacted strongly to the protein. Clinical Status of Patients Tested. Sera were obtained from 73 Japanese patients with chronic non-A, non-B hepatitis. The diagnosis was based on clinical histories and laboratory examinations. All patients were negative for HB s antigen (HBsAg) and showed no evidence of alcoholic, autoimmune, or drug-induced liver disease. Nine patients had a history of a blood transfusion 7-34 (median 20) years before diagnosis. Liver histology, available for 51 patients, showed the features of chronic persistent hepatitis (CPH) in 10 cases, chronic active hepatitis (CAH) in 24, and liver cirrhosis in 17. The remaining 22 patients had cirrhosis with hepatocellular carcinoma (HCC) as diagnosed by imaging procedures (ultrasonography, computed tomography plus angiography). Also examined were sera from 41 Japanese patients with chronic hepatitis B virus (HBV) infection, who were carriers of HBsAg for more than 12 months. Among these patients, 27 had HB~ antigen (HBeAg) and 12 had antibody to HB~Ag (anti-HB~). No patients had ever received blood transfusions. Four were asymptomatic HBV carriers with normal liver function tests, and the rest were HBV carriers with chronic liver disease. Liver histology
1484
indicated CPH in 15 cases, CAH in 11, and cirrhosis in 6. The remaining five patients had cirrhosis with HCC. The control sera were obtained from 20 healthy subjects with normal liver function tests, who had no known HBV markers, and were negative for anti-C100-3. All samples were stored at - 8 0 ~ C. Serological Testing. HBsAg, HBeAg, and anti-HBe were determined by commercially available radioimmunoassays (Dainabot Co., Ltd., Tokyo, Japan). Anti-Cl00-3 was tested with an ELISA system (Ortho Diagnostic Systems Co., Ltd., Tokyo, Japan). The assay was performed according to the manufacturer's instructions. Detection of Serum Antibody to HCV Core Protein. All serum samples were tested for the presence of antiHCVcore by a solid-phase enzyme immunoassay. Microtiter plates (Flow Laboratories Inc., McLean, Virginia) were coated with 50 ixl of HCV core protein (2 p~g/ml) diluted in 50 mmol/liter sodium carbonate (pH 9.6) at 4~ C for 24 hr. The plates were then washed eight times with 0.1% (v/v) Tween-20 in Tris-buffered saline (pH 8.0) (TBS) and postcoated with heat-sterilized milk protein (Block Ace, Snow Brand Milk Products Co., Ltd., Tokyo, Japan) at 37~ C for 2 hr. The plates were washed again with 0.1% Tween-20 in TBS and incubated at room temperature for 1 hr with 50 Ixl of 50-fold diluted test sera. After another washing, 50 ~1 of peroxidase-conjugated goat anti-human IgG antibody (Kirkegaard and Perry Laboratories Inc., Gaithersburg, Maryland) was added to the plates followed by incubation at room temperature for another 1 hr. They were then washed, and 100 ~1 of a solution containing o-phenylene diamine and H202 was added to each well. After a 30-min incubation at room temperature, the reaction was stopped with 50 Ixl of 4 N H2SO 4 and the optical density at 492 nm (OD492) was measured with a photo-enzyme-linked immunosorbent assay colorimeter (Titertek Multiscan MCC/340, Flow Laboratories Inc.). In each assay, sera from 20 healthy subjects with normal liver function tests and no known HBV markers, and negative for anti-C100-3 were included as negative controls. The mean value + 3 SD of OD492 for 20 control subjects was taken as the cutoff value. Samples with a cutoff index (CI) > 1.0 were considered positive. All assays were done in duplicate. All positive sera were retested in triplicate both in the presence and absence of the coated core protein in order to confirm the specificity and the reproducibility. The specificity was confirmed by the decrease in OD492within the negative range in the absence of the core protein. The specificity of the solid-phase enzyme immunoassay was further confirmed by absorption tests. The serum reactivity could be inhibited by preincubation with excess amounts of core protein. Detection of HCV RNA by Polymerase Chain Reaction. HCV RNA was extracted from blood samples, converted to eDNA with reverse transcriptase and then amplified by the polymerase chain reaction (PCR) method as described elsewhere (11, 12). Oligonucleotides corresponding to the highly conserved 5'-noncoding region of the HCV genome (13) were used as primers: antisense primer, 5'CATGGTGCACGGTCTACGAG3' (nucleotides 308327); sense primer, 5'ACTCCACCATAGATCACTCC3' (nucleotides 7-26). RNA was prepared from sera as Digestive Diseases and Sciences, Vol. 37, No. 10 (October 1992)
HCV RNA AND ANTIBODY TO HCV CORE PROTEIN TABLE 1. DETECTIONOF ANTIBODYTO HCV COREPROTEIN(ANTI-HCVcoRE)AND HCV RNA SEQUENCESIN CHRONICLIVER DISEASERELATIVETO THE PRESENCEOF ANTI-CI00-3 Patients
Anti-C100-3-positive chronic non-A, non-B liver disease Anti-C 100-3-negative chronic non-A, non-B liver disease Anti-C100-3-negative chronic HBV infection
N
Age (years)*
Sex (M/F)
Past history of blood transfusion
Anti-HCVcore prevalence
Detection of HCV R N A
44
56 -+ 10t
29/15
4/44 (9%)~:
44/44 (100%)t,w
43/44 (98%)t,82
29
56 -+ lit
18/11
5/29 (17%)t
25/29 (86%)t
23/29 (79%)t
41
42 --- 12
32/9
0/41
10/41 (24%)
3/41 (7%)
*Values are mean -+ SD. tP < 0.01 vs anti-C100-3-negative chronic HBV infection. SP < 0.05 vs anti-Cl00-3-negative chronic HBV infection. w < 0.05 vs anti-Cl00-3-negative chronic non-A, non-B liver disease. 82 < 0.01 vs anti-Cl00-3-negative chronic non-A, non-B liver disease.
follows. Two hundred microliters of serum was mixed with 100 i~1 of 21% polyethylene glycol 6000 in 1.5 mol/liter NaCI and left at 4~ C for 2 hr. After centrifugation at 18,500g for 20 min at 4~ C, the pellet was resuspended in 600 I~1 of 0.1 mol/liter Tris HC1 buffer (pH 7.5) containing 4 mol/liter guanidinium thiocyanate, 0.5% sodium lauryl sarcosinate, and 1% 13-mercaptoethanol. The lysate was extracted with phenol-chloroform, and RNA was precipitated from the aqueous phase by chilling at - 8 0 ~ C for 1 hr after addition of 0.1 vol of 3 mol/liter sodium acetate (pH 6.0) and 2.5 vol of absolute ethanol and by subsequent centrifugation. The pelleted RNA was rinsed with 70% ethanol, dried, and dissolved in 7 ixl of distilled water, cDNA was synthesized with 200 units of Moloney murine leukemia virus reverse transcriptase (Bethesda Research Laboratories, Gaithersburg, Maryland), 20 pmol of the antisense primer, 1 mmol/liter each dNTP and 20 units of RNase inhibitor (Promega, Madison, Wisconsin) in a final volume of 20 Ixl as described by the vendor. The cDNA product was added to 80 I~1 of amplification mixture containing 2.5 units of Taq polymerase (Perkin-Elmer Cetus, Norwalk, Connecticut), 20 pmol each of both primers, 1.2 mmol/liter MgCI2 and 45 mmol/liter KC1. The mixture was overlaid with mineral oil and amplified in a DNA thermal cycler (Perkin-Elmer Cetus) for 40 cycles (at 94~ C for 0.5 min, at 55~ C for 1 min and at 72 ~ C for 1 min), followed by a 10-min final extension at 72 ~ C. A 10-~1 aliquot was taken, electrophoresed on an agarose gel, transferred onto a nylon membrane, hybridized with 32p-labeled HCV cDNA that corresponds to the amplified sequence, and autoradiographed. Because of the extreme sensitivity of PCR, great care was taken to prevent false-positive results, and measures recommended by Kwok and Higuchi (14) for preventing contamination were strictly applied throughout this study. Statistical Analysis. Statistical analysis for group comparisons was done by the • method and the unpaired Student's t test. Digestive Diseases and Sciences, Vol. 37, No. 10 (October 1992)
RESULTS
Detection of Anti-HCVcore and HCV RNA Sequences Relative to Detection of Anti-C100-3. Seventy-three patients with chronic non-A, non-B hepatitis and 41 chronic H B V carriers were tested for anti-C100-3. Anti-C100-3 was found in 44 (60%) of the 73 patients with chronic non-A, non-B hepatitis (8 with C P H , 14 with C A H , I1 with liver cirrhosis, and 11 cirrhotics with HCC). On the other hand, none of the 41 H B V carriers had detectable titers o f anti-C100-3. T h e anti-C100-3-positive and -negative patients were then tested for a n t i - H C V c o r e and H C V R N A sequences. T h e results are s u m m a r i z e d in Table 1 along with the clinical characteristics of the patients. T h e m e a n age of the patients with anti-C100-3-positive and -negative chronic non-A, non-B hepatitis was significantly higher (56 - 10 years and 56 --- 11 years, respectively) than that of the H B V carriers (42 --- 12 years) (P < 0.01 for both). Blood transfusions had b e e n received b y four (9%) patients with anti-C100-3-positive chronic non-A, non-B hepatitis and five (17%) with antiC100-3-negative chronic non-A, non-B hepatitis. All the anti-C100-3-positive patients (44/44) had detectable levels of a n t i - H C V c o r e , and 98% (43/44) had H C V R N A sequences. A n t i - H C V c o r e was also found frequently in cases of anti-Cl00-3-negative chronic non-A, non-B hepatitis 25/29 (86%), including four of the five patients w h o had previously received blood transfusions. H C V R N A sequences were detected in 22 (88%) of the 25 patients positive for a n t i - H C V c o r e and in a n o t h e r patient negative for it. Despite the fact that all the H B V carriers
1485
YUKI ET AL TABLE 2. DETECTION OF ANTIBODY TO HCV CORE PROTEIN (ANTI-HCVcoRE) AND HCV RNA SEQUENCES IN CHRONIC NoN-A, NoN-B LIVER DISEASE OF VARIOUS CATEGORIES
Patients*
N
CPH CAH LC LC + HCC
10 24 17 22
Age (years) ~ 49 54 58 60
--- 12:Lw 4- 12w • 8 • 7
Sex (M/F) 7/3 10/1482 12/5 18/4
Past history of blood transfusion 2/10 2/24 2/17 3/22
(20%) (8%) (12%) (14%)
Anti-HCVcore prevalence 9/10 24/24 16/17 20/22
(90%) (100%) (94%) (91%)
Detection of HCV R N A 10/10 22/24 15/17 19/22
(100%) (92%) (88%) (86%)
*CPH, chronic persistent hepatitis; CAH, chronic active hepatitis; LC, liver cirrhosis; HCC, hepatocellular carcinoma. tValues are mean • SD. :~P < 0.05 vs LC. w < 0.05 vs LC + HCC. 82 < 0.01 vs LC + HCC.
tested were negative for anti-C100-3, anti-HCVcore was found in 10 (24%) of the 41 carriers. Among the 10 anti-HCVcore-positive HBV carriers, four were with CPH, two with CAH, three with liver cirrhosis, and one with cirrhosis with HCC. Eight of these 10 were positive for HBeAg, and two had anti-HBe. HCV RNA sequences were detected in three (30%) of the 10 anti-HCVcore-positive HBV carriers (one with CPH and two with liver cirrhosis), who all were positive for HB~Ag. Thus, there was a quite remarkable correlation between the detection of anti-HCVcore and the presence of HCV RNA sequences in patients with chronic non-A, non-B hepatitis. Approximately 94% of the anti-HCVcore-positive patients (65/69) had detectable levels of HCV RNA, whereas 98% of the HCV RNA-positive patients (65/66) were positive for anti-HCVcore. In contrast, 98% of the anti-C100-3-positive patients (43/44) had HCV RNA whereas only 65% of the HCV RNA-positive patients (43/66) were positive for anti-C100-3. In chronic non-A, non-B hepatitis, anti-HCVcore was found frequently, irrespective of the stage of the liver disease, as were the HCV RNA sequences (Table 2). Anti-HCVcore was found in 90% (9/10) of CPH, 100% (24/24) of CAH, 94% (16/17) of cirrhosis, and 91% (20/22) of cirrhosis with HCC. HCV RNA sequences were detected in 100% (10/10) of CPH, 92% (22/24) of CAH, 88% (15/17) of cirrhosis, and 86% (19/22) of cirrhosis with HCC. Anti-HCVcore Titers and Detection of HCV RNA Sequences. Figure 1 presents the anti-HCVcore titers in chronic non-A, non-B hepatitis for comparison with those in chronic HBV infection. AntiHCVcore showed significantly higher titers in each category of chronic non-A, non-B hepatitis than in HBV carriers (P < 0.01). Among those with chronic non-A, non-B hepatitis, 64 (93%) of 69 antiHCVcore-positive cases tested positive for it with a 1486
cutoff index (CI) > 5, while none of the chronic HBV carriers did. When we examined the total group, there was a significant correlation between the occurrence of high anti-HCVcore titers and the detection of HCV RNA sequences. Patients with high titers of anti-HCVcore (ie, with CI > 5) seemed to have a significantly (P < 0.01) higher prevalence (63 of 64 = 98%) of HCV RNA sequences than those with lower titers of antiHCVcore [ie, with CI between 1 and 5 (5 of 15 = 33%)] and those negative for anti-HCVcore (1 of 35 = 3%). A significant difference in the prevalence of HCV RNA sequences was also observed between the group with lower titers of anti-HCVcore and that negative for it (P < 0.01). DISCUSSION The present study revealed the overwhelming prevalence of HCV infection in Japanese patients with chronic non-A, non-B hepatitis. The prevalence of HCV RNA and anti-HCVcore was much higher than expected from the detection of antiC100-3. So far, a few reports have suggested that antibodies to the core gene products of HCV are efficiently induced during HCV infection and may contribute to a more accurate diagnosis (15-17). However, the clinical implication of anti-HCVcore in chronic liver disease has not been fully documented in relation to the detection of the HCV genome. Our study demonstrated that the occurrence of anti-HCVcore closely correlated with chronic HCV infection, as proved by the presence of the HCV genome. The correlation between the occurrence of anti-HCVcore and the presence of HCV RNA sequences exceeded 90% throughout different pathological stages of chronic non-A, non-B hepatitis, indicating that anti-HCVcore is a specific diagnostic marker for HCV infection in this Digestive Diseases and Sciences, Vol. 37, No. tO (October 1992)
HCV RNA AND ANTIBODY TO HCV CORE PROTEIN
25
d > -o
20
o
.Q c-
IIO .gl~f
10
-1-
olGe
I
c0o
---6--
5 g 0
-
-
~
Chronic HBV Infection (n:41)
CPH (n=10)
CAH (n=24)
LC (n:17)
LC + HCC (n:22)
Chronic, Non- A, Non- B Liver Disease
Fig 1. Titers of antibodyto HCV core protein (anti-HCVcore)in chronicliver disease relative to the detection of HCV RNA sequences. Antibodyshowed significantlyhigher titers in chronic non-A, non-B liver disease of various categoriesthan in chronic HBV infection(P < 0.01). CPH = chronic persistent hepatitis; CAH = chronic active hepatitis; LC = liver cirrhosis; HCC = hepatocellular carcinoma. Open circles represent sera negative for HCV RNA sequences, and solid circles represent sera positive for HCV RNA sequences. category of liver disease. This strong correlation may be attributable to its higher immunogenicity and also its higher amino acid conservation among different HCV strains. Moreover, the HCV strain we used to make the putative core antigen might be identical to the strain that infected the patients we examined, since most of the patients we examined came from the same local area as cDNA used to make the core protein was cloned. The final outcome of chronic viral hepatitis is cirrhosis and hepatocellular carcinoma. In HBV infection, viral replication is usually not very active in patients with advanced liver disease, who are thought to have had a long period of HBV infection, compared with early stages of infection. In HCV infection, on the other hand, ongoing viral replication was revealed even in such patients. We found the frequent occurrence of HCV RNA sequences in each category of chronic non-A, non-B hepatitis. Anti-HCVcore was also found frequently with high titers in each category. Both findings indicate that strong viral production persists throughout various stages of liver disease induced by HCV. Quick responses to interferon treatment in chronic HCV infection suggest that liver injury in chronic HCV infection is a direct cytopathic effect of the virus Digestive Diseases and Sciences, VoL 37, No. 10 (October 1992)
(18, 19), while in HBV infection it is considered to be immunologically mediated. Our findings were compatible with this idea. Liver injury in chronic HCV infection may progress in a somewhat different manner from HBV infection. HCV, known to be a positive-stranded RNA virus, has not been shown to be integrated in the cellular DNA, and it remains to be worked out whether HCV itself can contribute to liver carcinogenesis. However, persistent liver injury caused by persistent HCV infection may also be related to the development of HCC (3, 6-8). Another finding in this study is that a small proportion of chronic HBV carriers negative to anti-C100-3 assay had low titers of anti-HCVcore. Using anti-C100-3 assay, it has been shown that possible coinfection with HBV and HCV may be a risk factor of more serious liver disease (4, 8, 20). As for patients with low titers of anti-HCVcore, however, tests for HCV RNA sequences were often negative. In such cases, anti-HCVcore may indicate previous exposure to HCV, as is the case in the detection of low titers of antibody to hepatitis B core antigen (anti-HBc) in chronic non-A, non-B hepatitis. We conjecture that exposure to the two viruses may be more common, indicating a similar mode of infection of both viruses.
1487
Y U K I ET AL
Again, the current study revealed that HCV is indeed a major causative agent of chronic non-A, non-B hepatitis in Japan. Although persistent HCV infection can be confirmed by amplification of HCV RNA sequences with the polymerase chain reaction, the techniques are not routinely available. Our study suggests that determination of anti-HCVcore titers may serve as a viral replicative marker. REFERENCES 1. Choo Q-L, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M: Isolation of a eDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 244:359-362, 1989 2. Kuo G, Choo Q-L, Alter HJ, Gitnick GL, Redeker AG, Purcell RH, Miyamura T, Dienstag JL, Alter MJ, Stevens CE, Tegtmeier GE, Bonino F, Colombo M, Lee W-S, Kuo C, Berger K, Shuster JR, Overby LR, Bradley DW, Houghton M: An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 244:362-364, 1989 3. Bruix J, Barrera JM, Calvet X, Ereilla G, Costa J, SanchezTapias JM, Ventura M, Vail M, Bruguera M, Bru C, Castillo R, Rodes J: Prevalence of antibodies to hepatitis C virus in Spanish patients with hepatocelhilar carcinoma and hepatic cirrhosis. Lancet 2:1004-1006, 1989 4. Colombo M, Kuo G, Choo QL, Donato MF, Ninno ED, Tommasini MA, Dioguardi N, Houghton M: Prevalence of antibodies to hepatitis C virus in Italian patients with hepatocellular carcinoma. Lancet 2:1006-1008, 1989 5. Hopf U, Mtller B, Kiither D, Stemerowicz R, Lobeck H, Liidtke-Handjery A, Walter E, Blum HE, Roggendorf M, Deinhardt F: Long-term follow-up of posttransfusion and sporadic chronic hepatitis non-A, non-B and frequency of circulating antibodies to hepatitis C virus (HCV). J Hepatol 10:69-76, 1990 6. Saito I, Miyamura T, Ohbayashi A, Harada H, Katayama T, Kikuchi S, Watanabe Y, Koi S, Onji M, Ohta Y, Choo Q-L, Houghton M, Kuo G: Hepatitis C virus infection is associated with the development of hepatocellular carcinoma. Proc Natl Acad Sci USA 87:6547-6549, 1990 7. Kiyosawa K, Sodeyama T, Tanaka E, Gibo Y, Yoshizawa K, Nakano Y, Furuta S, Akahane Y, Nishioka K, Purcell RH, Alter HJ: Interrelationship of blood transfusion, non-A, non-B hepatitis and hepatocellular carcinoma: Analysis by detection of antibody to hepatitis C virus. Hepatology 12:671-675, 1990 8. Yuki N, Hayashi N, Kasahara A, Hagiwara H, Katayama K, Fusamoto H, Kamada T: Hepatitis B virus markers and antibodies to hepatitis C virus in Japanese patients with hepatocellular carcinoma. Dig Dis Sci 37:65-72, 1992
1488
9. Weiner AJ, Kuo G, Bradley DW, Bonino F, Saracco G, Lee C, Rosenblatt J, Choo Q-L, Houghton M: Detection of hepatitis C viral sequences in non-A, non-B hepatitis. Lancet 335:1-3, 1990 10. Takamizawa A, Mori C, Fuke I, Manabe S, Murakami S, Fujita J, Onishi E, Andoh T, Yoshida I, Okayama H: Structure and organization of the hepatitis C virus genome isolated from human carriers. J Virol 65:1105-1113, 1991 11. Hagiwara H, Hayashi N, Mira E, Hiramatsu N, Ueda K, Takehara T, Yuki N, Kasahara A, Fusamoto H, Kamada T: Detection of hepatitis C virus RNA in chronic non-A, non-B liver disease. Gastroenterology 102:692-694, 1992 12. Takehara T, Hayashi N, Mita E, Hagiwara H, Ueda K, Katayama K, Kasahara A, Fusamoto H, Kamada T: Detection of complementary sequence of hepatitis C virus RNA by reverse transcription and polymerase chain reaction. Implication for hepatitis C virus replication in infected tissue. Hepatology 15:387-694, 1992 13. Okamoto H, Okada S, Sugiyama Y, Yotsumoto S, Tanaka T, Yoshizawa H, Tsuda F, Miyakawa Y, Mayumi M: The 5'-terminal sequence of the hepatitis C virus genome. Jpn J Exp Med 60:167-177, 1990 14. Kwok S, Higuchi R: Avoiding false positives with PCR. Nature 339:237-238, 1989 15. Okamoto H, Munekata E, Tsuda F, Takahashi K, Yotsumoto S, Tanaka T, Tachibana K, Akahane Y, Sugai Y, Miyakawa Y, Mayumi M: Enzyme-linked immunosorbent assay for antibodies against the capsid protein of hepatitis C virus with a synthetic oligopeptide. Jpn J Exp Med 60:223233, 1990 16. Harada S, Watanabe Y, Takeuchi K, Suzuki T, Katayama T, Takebe Y, Saito I, Miyamura T: Expression of processed core protein of hepatitis C virus in mammalian cells. J Virol 65:3015-3021, 1991 17. Nasoff MS, Zebedee SL, Inchausp6 G, Prince AM: Identification of an immunodominant epitope within the capsid protein of hepatitis C virus. Proc Natl Acad Sci USA 88:5462-5466, 1991 18. Davis GL, Balart LA, Schiff ER, Lindsay K, Bodenheimer HC, Perrillo RP, Carey W, Jacobson IM, Payne J, Dienstag JL, Van Thiel DH, Tamburro C, Lefkowitch J, Albrecht J, Meschievitz C, Ortego TJ, Gibas A: Treatment of chronic hepatitis C with recombinant interferon alpha. A multicenter randomized, controlled trial. N Engl J Med 321:1501-1506, 1989 19. Bisceglie AM, Martin P, Kassianides C, Lisker-Melman M, Murray L, Waggoner J, Goodman Z, Banks SM, Hoofnagle JH: Recombinant interferon alfa therapy for chronic hepatitis C. A randomized, double-blind, placebo-controlled trial. N Engl J Med 321:1506-1510, 1989 20. Kew MC, Houghton M, Choo QL, Kuo G: Hepatitis C virus antibodies in southern African blacks with hepatocellular carcinoma. Lancet 335:873-874, 1990
Digestive Diseases and Sciences, Vol. 37, No. 10 (October 1992)
