This article was downloaded by: [University of Nebraska, Lincoln] On: 31 August 2015, At: 19:35 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: 5 Howick Place, London, SW1P 1WG

Journal of Biomolecular Structure and Dynamics Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tbsd20

HDAC inhibition through valproic acid modulates the methylation profiles in human embryonic kidney cells a

a

ab

Shabir Ahmad Ganai , Shashwath Malli Kalladi & Vijayalakshmi Mahadevan a

Center for Nanotechnology & Advanced Biomaterials, School of Chemical & Biotechnology, SASTRA University, Thanjavur 613401, India b

School of Chemical & Biotechnology, SASTRA University, Thanjavur 613401, India Published online: 11 Jul 2014.

Click for updates To cite this article: Shabir Ahmad Ganai, Shashwath Malli Kalladi & Vijayalakshmi Mahadevan (2015) HDAC inhibition through valproic acid modulates the methylation profiles in human embryonic kidney cells, Journal of Biomolecular Structure and Dynamics, 33:6, 1185-1197, DOI: 10.1080/07391102.2014.938247 To link to this article: http://dx.doi.org/10.1080/07391102.2014.938247

PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions

Journal of Biomolecular Structure and Dynamics, 2015 Vol. 33, No. 6, 1185–1197, http://dx.doi.org/10.1080/07391102.2014.938247

HDAC inhibition through valproic acid modulates the methylation profiles in human embryonic kidney cells Shabir Ahmad Ganaia, Shashwath Malli Kalladia and Vijayalakshmi Mahadevana,b* a

Center for Nanotechnology & Advanced Biomaterials, School of Chemical & Biotechnology, SASTRA University, Thanjavur 613401, India; bSchool of Chemical & Biotechnology, SASTRA University, Thanjavur 613401, India Communicated by Ramaswamy H. Sarma

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

(Received 12 April 2014; accepted 20 June 2014) Post-translational modifications on the tails of core and linker histones dictate transcription and have vital roles in disease and development. Acetylation and deacetylation events enabled by histone acetyl transferases and histone deacetylases (HDACs) on the chromatin milieu are intricately involved in gene regulation. Inhibition of HDACs is emerging as a powerful strategy in regenerative therapy, transplantation, development and in nuclear reprogramming events. Valproic acid (VPA), belonging to the short-chain fatty acid group of HDAC inhibitors, modulates the epigenome altering gene expression profiles across cell lines. This work attempts to explore the methylation profiles triggered by VPA treatment on human embryonic kidney cells (HEK 293) through a biochemical and computational approach. VPA treatment (for 48 h) has been observed to hypermethylate lysine 4 on the core histone H3 and confers a hypomethylation status of H3 lysine 27 in HEK 293 cells leaving the nuclear area and nuclear contour unaltered. Our structural docking and Binding Free Energy (BFE) calculations establish an active role for VPA in inhibiting the demethylase JARID1A (Jumonji, AT Rich Interactive Domain 1A) and the methyl-transferase EZH2 (Enhancer of Zeste Homologue 2). This work has also proven that VPA can inhibit the activity of proteins like GSK3β and PKCβII involved in developmental disorders. This work establishes a dynamic correlation between histone methylation events and HDAC inhibition and may define newer epigenetic strategies for treating neurodevelopmental and oncological disorders. Keywords: histone deacetylase inhibitor; human embryonic kidney cells; valproic acid; immunofluorescence; developmental kinases; molecular mechanics-generalised born surface area

1. Introduction Chromatin in eukaryotic cell nuclei is constituted of DNA-histone complexes (Luger, Mader, Richmond, Sargent, & Richmond, 1997) that undergoes dynamic remodelling to regulate gene-expression programmes (Saha, Wittmeyer, & Cairns, 2006; Sproul, Gilbert, & Bickmore, 2005; Wu, 1997). Post-translational modifications on the histone tails such as acetylation, methylation, phosphorylation and ubiquitylation (Grunstein, 1997; Nowak & Corces, 2004; Weake & Workman, 2008; Zhang, Siino, Jones, Yau, & Bradbury, 2004) facilitate transcription and are implied in cell cycle, apoptosis, development, memory, regeneration and differentiation (Brilli, Swanhart, Caestecker, & Hukriede, 2013; Consalvi et al., 2011; Liu, Cheng, Kwan, Lubieniecka, & Nielsen, 2008; Martín-Sánchez et al., 2011; Zhao et al., 2013). Histone acetylation is a significant chromatin event tightly controlled by the balance between the histone acetyl transferases and histone deacetylases (HDACs). Deacetylation results in chromatin condensation and subsequent transcriptional repression while acetylation has an antagonistic effect leading to gene *Corresponding author. Email: [email protected] © 2014 Taylor & Francis

expression in cells (Kuo & Allis, 1998; Yang & Seto, 2007). Epigenetic dysregulation of the HDAC enzymes alters phenotypes and homoeostasis contributing to neoplastic growth (Legube & Trouche, 2003; Van Damme et al., 2012). Therefore, inhibition of HDACs through small-molecule inhibitors has gained significant attention in clinical research (Ververis, Hiong, Karagiannis, & Licciardi, 2013). Several of these inhibitors are in the final phases of clinical trials and are proven to be effective in synergistic therapy (Karagiannis & El-Osta, 2006; Kim & Bae, 2011; Yang & Seto, 2007). The HDAC inhibitors (HDACi) may be benzamide derivatives, cyclic tetrapeptides, short-chain fatty acids, depsipeptides, ketones or synthetic pyridyl derivatives (de Ruijter, van Gennip, Caron, Kemp, & van Kuilenburg, 2003; Munshi et al., 2005). Valproic acid (VPA) is a carboxylic acid derivative with branched chain having no aromatic ring. It is the drug of choice for epilepsy, bipolar disorders, social phobias and neuropathic pain (Johannessen & Johannessen, 2003). It functions by enhancing the synthesis and release of neurotransmitter Gamma Amino Butyric Acid in specific brain regions (Hu et al., 2003).

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

1186

S.A. Ganai et al.

Increasing evidence from literature suggests a directional relationship between HDAC inhibition and histone methylation (Nightingale et al., 2007). VPA, traditionally used in epilepsy treatment and as a mood stabiliser has also been shown to tune the epigenome through inhibiting HDACs (Gottlicher et al., 2001; Phiel et al., 2001; Spina & Perugi, 2004). It is well known that VPA alters the DNA methylation patterns targetting the basic epigenetic mechanisms (Milutinovic, D’Alessio, Detich, & Szyf, 2007). This work is focussed on understanding the influence of VPA-mediated HDAC inhibition on the methylation status of HEK 293 cells. Pharmacological treatment of VPA for 48 h on HEK 293 cells showed alteration in the methylation status of the lysines on the core histone H3. Lysine 4 is hypermethylated and lysine 27 is hypomethylated upon VPA treatment. We have also established through structural modelling that the HDAC inhibitor VPA influences the activity of JARID1A, the demethylase involved in the demethylation of H3K4 (Christensen et al., 2007). VPA also significantly influences EZH2, the methyltransferase that methylates H3K27 (Ezhkova et al., 2011). VPA, conventionally employed for disorders of the central nervous system (CNS) also showed inhibitory activity on two developmental kinases GSK3β and PKCβII. Computational docking and binding free energy calculations establish the kinase inhibitory potential of VPA in developmental disorders. This work establishes a hitherto unknown mechanism of crosstalk between HDAC inhibition and histone methylation and explores a new role for VPA in kinase inhibition. 2. Materials and methods

and diluted in complete medium following manufacturer’s protocols. Cells were treated with VPA at a concentration of 1 mM/ml for 48 h and were taken for further investigation. Relevant control plates without VPA treatment were also set up for the study.

2.4. Immunostaining HEK 293 cells (plated on cover slip stuck 35 mm petri dishes) treated with VPA for 48 h were fixed with 4% paraformaldehyde for 20 min at room temperature. The cells were permeabilised with .3% Triton X-100 for 10 min and were blocked with the blocking buffer (5% Goat Serum in PBS) for 1 h at room temperature. Primary antibodies at appropriate dilutions (diluted in Bovine Serum Albumin and .3% Triton X-100 in PBS) were added to the cells and the plates were kept at overnight incubation at 4 °C. The antibody against H3K4me3 was used at the dilution of 1:400 and the antibodies against H3K9me3 and H3K27me3 (all from Cell Signalling Technologies, Danvers, USA) were used at dilutions of 1:100 and 1:1600, respectively. The primary antibody for EZH2 (Rabbit mAb from Cell Signalling Technologies, Danvers, USA) was used at a dilution of 1:200. The medium containing the primary antibody was then removed and secondary antibodies tagged to Alexa Fluor 647 at a dilution of 1:1000 were added to the cells and incubated for 1 h at room temperature. The cells were then washed with PBS and stained with the DNA-binding dye Hoechst 33,342 (1 μg/ml Life Technologies, New York, USA) for 5 min at room temperature in dark. The cells were then washed with PBS and imaged for epigenetic expression.

2.1. Model system Human Embryonic Kidney – HEK 293 cells (a kind gift from Panicker lab, at NCBS-TIFR, Bangalore-India) were used as the model system to probe the alteration in methylation levels and their epigenetic states during HDAC inhibition. 2.2. Cell culture HEK 293 cells were cultured in Dulbecco’s Modified Eagle Medium (Gibco) supplemented with 10% Foetal Bovine Serum (Gibco) and 1% Penicillin-Streptomycin (Gibco) and maintained at 37 °C in a 5% CO2 incubator. The experiments were set up with HEK 293 cells plated at a density of .05 million cells/ml on 35 mm petri dishes (Nunc- GmbH Wiesbaden, Germany). The cells were incubated for adherence overnight. 2.3. HDAC inhibition on cells The HDAC inhibitor VPA (Sigma Aldrich Co., USA; Cat.No:99-66-1; V006) was reconstituted in ethyl alcohol

2.5. Imaging epigenetic marks HEK 293 cells immunostained with epigenetic antibodies and counter-stained with Hoechst 33,342 were imaged using the Olympus FV-1000 Laser Scanning Confocal Microscope with the 60X oil immersion objective (NA 1.4) with appropriate filters and excitation optics. Thirty images of HEK 293 cell nuclei were obtained from each plate and the mean area, nuclear contour index and the total fluorescence intensity of the epigenetic marks were calculated using an in-house program developed for the same.

2.6. RNA isolation and RT-PCR Total RNA from HEK 293 cells was isolated after the treatment of 1 mM VPA for 48 h using RNeasy Mini Kit (Qiagen, Limburg, Netherlands). The concentration of RNA was quantified using Nanodrop Spectrophotometer (Nanodrop Technologies, Wilmington, USA).

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

Valproic acid modulates the epigenome of HEK293 cells One microgram of RNA was taken for cDNA preparation using iScriptTM cDNA Synthesis Kit (BioRad, CA, USA). Relative transcription levels of JARID1A were analysed by Real Time PCR in 20 μl reaction volume on 96 well plates (Thermo Scientific, MA, USA) using an Eppendorf Realplex2 Real Time PCR system (Eppendorf, Hamburg, Germany). Transcript levels were normalised to β-Actin levels. All experiments were carried out in triplicates. Primers used for the study were JARID1A (Imperial Life Sciences (P) Limited, Haryana, India) and β-actin (KiCqStart SYBR Green Primers, Sigma, MO, USA). The sequences of the primers are as follows JARID1A FP 5′CAATGTGATGGTGGCTGTGA3¹: RP- 5′ TATGAAGGAAGGAGGTGGTGC3′; β-Actin FP-5′ GACGACATGGAGAAAATCTG3′: RP 5′ ATGATCTGGGTCATCTTCTC3′.

2.7. Protein preparation Crystal structures of histone demethylase JARID1A, histone methyl transferase EZH2, glycogen synthase kinase 3β (GSK3β) and protein kinase C βII (PKCβII) (PDB accession number 3GL6, MCI0, 4ACC, 2I0E, respectively) were retrieved from the Protein Data Bank (http://www.rcsb.org). Protein preparation was done using Schrödinger Suite. Hydrogen atoms were added and non-essential heteroatoms were deleted. Non-bridging water molecules were also removed. Structures were optimised and energy minimised using the OPLS-2005 force field (Salam, Nuti, & Sherman, 2009). The grid was generated either using co-crystallised ligands as centroids or using known active site residues in the crystal structures as centroids.

2.8. Ligand preparation The structure of the HDAC inhibitor VPA was drawn using ChemSketch and prepared using the LigPrep module of the Schrödinger Suite. All possible conformations were generated along with the three low-energy ring conformations and the pH was kept in the range of 5–9 (LigPrep, 2012).

2.9. Docking and binding free energy calculations Docking was done using the Glide module of Schrödinger suite and calculations were done using the extra precision mode of flexible docking (Friesner et al., 2006). Valproate was docked against all the four protein receptors prepared as detailed above. Molecular mechanics-generalised born surface area (MMGBSA) was used for calculating the binding free energy of valproate against the individual receptors. Binding free energy was calculated using the equation (Lyne, Lamb, & Saeh, 2006).

1187

DGb ¼ DEMM þ DGsolv þ DGSA where ΔEMM is the difference between the minimised energies of ligand-protein complex and the total energies of protein and ligand in free form and ΔGsolv is the difference in the GBSA solvation energies of the ligandreceptor complex and the sum of the solvation energies of receptor and ligand in the unbound state. ΔGSA is the difference in the surface area energies for the free receptor and ligand. 3. Results and discussion 3.1. VPA does not alter nuclear geometry of HEK 293 cells Nuclear morphology is dynamic and can be altered by various physicochemical phenomena that trigger signalling inside the nuclei (Chen, Mrksich, Huang, Whitesides, & Ingber, 1997; Le Beyec et al., 2007; Vergani, Grattarola, & Nicolini, 2004). In order to understand ifalterations in acetylation profiles reflect on nuclear architecture and chromatin function, the nuclear area and nuclear contour index of HEK 293 cell nuclei treated with 1 mM VPA were calculated. No significant change was observed in nuclear area after 48 h of VPA treatment (Figure 1(a)). The nuclear contour index also remained unchanged on treatment with VPA over the same time (Figure 1(b)). Valproate belongs to the short-chain fatty acid group of HDACi and is implied in chromatin decondensation and improved acetylation in breast tumour cells (MCF-7) isolated from mice (Marchion, Bicaku, Daud, Sullivan, & Munster, 2005). It has earlier been shown that VPA induces differentiation of teratocarcinoma cells on treatment with VPA for 48 h (Gottlicher et al., 2001). We hypothesise that the inability of the HEK 293 cell nuclei to enhance their nuclear area as observed in this case, may be due to a possible VPA-induced differentiation of these cells. It can be thought that the differentiation process might trigger chromatin condensation hence preventing an increased nuclear space. The observation that colon cancer cells (HT-29) expressing p53 mutations resist changes in nuclear volume on treatment with a similar class of HDAC inhibitor sodium butyrate supports our findings (Bartova et al., 2005). Recent reports establish a strong connection between the shape of the nucleus and changes in the functional expression of the cells (Hertzog, Hertzog, & Patrinichi, 2009). In order to see if VPA induces changes in nuclear shape, we calculated the nuclear contour of the HEK cells and found no alterations in the contour index confirming ellipticity of the nuclei under observation. 3.2. VPA induces H3K4 hypermethylation in HEK 293 cells with a decrease in JARID1A expression HDACi have been shown to induce hyperacetylation states in histones and hypermethylation of H3K4 in

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

1188

S.A. Ganai et al.

Figure 1. Pharmacological intervention with valproic acid for 48 h at 1 mM does not alter (a) nuclear area (b) and nuclear contour index in HEK 293 cells (n = 3, N = 30).

specific cell types (Cunliffe, 2008; Yildirim et al., 2003). Since VPA is extensively employed as an antidepressant and antiepileptic drug, we attempted to explore the histone modification patterns it influences globally in human embryonic kidney cells (HEK 293). Our assay on the epigenetic marks shows that H3K4me3 is increased relatively by 33.2% upon treatment with VPA 1 mM for 48 h (Figure 2(a) and (b)). In order to understand if JARID1A, the site-specific demethylase for H3K4 me3, induces the hypermethylation on VPA treatment, we quantified the expression of JAR1D1A in HEK293 cells after a 48 h treatment with 1 mM VPA by real time PCR. It is observed that the JARID1A expression is reduced by ~60% on treatment with VPA confirming the downregulation of demethylase by VPA treatment (Figure 2(c)). Several experiments have suggested a functional link between hyperacetylation of histone H3 and increased methylation of H3K4. It can be thought in such cases that the HDAC inhibitor either stimulates the activity of the methyl transferase required for H3K4 methylation or downregulates the demethylase for H3K4 (Lee, Wynder, et al., 2006; Nightingale et al., 2007). Three distinct HDACi vorinostat, MS-275 and AR-42 have been shown to enhance H3K4 methylation levels by transcriptionally repressing the JARID1 family of demethylases involved in methylating H3K4 (Huang et al., 2011). In this regard, we investigated the structural influence of VPA treatment on the complex of JARID1A and the histone H3 tail (Wang et al., 2009). The crystal structure of JARID1APHD3 (plant homeodomain) complexed with H3K4me3 peptide (PDB ID: 3GL6) was chosen as the template for understanding the effect of VPA treatment on the JARID1A histone tail peptide complex. On analysis of the two structural models created with and without VPA, we found that VPA targets certain residues of the histone H3

altering the conformational flexibility of the complex. It was observed that the 9-aa H3 peptide in complex with JARID1A formed new interchain protein interactions and electrostatic interactions on docking with VPA. The small molecule inhibitor VPA makes hydrogen bonds with Ala1 of the H3 peptide and ionic interactions between the Asp1624 of JARID1A and Gln5 of histone H3, with Val1639 and Thr3 of H3 (Figures 3(a)–(c)). We speculate that such minor structural alterations might significantly influence the enzymatic activity of the histone demethylase JARID1A, hence regulating the hypermethylation state of the lysine 4 on the histone H3. Our observations are supported by earlier experimental findings that VPA, NaB, TSA and MS-275 increase the levels of H3K4me2 and H3K4me3 in rat cortical neurons and astrocytes (Marinova, Leng, Leeds, & Chuang, 2011). Overexpression of JARID1B demethylase has been implied in breast, prostate and lung cancers. Recent studies have shown that the inhibition of JARID1B with the inhibitor reduces cell proliferation through enhancement of trimethylation status of H3K4 (Sayegh et al., 2013). VPA and TSA have been shown to inhibit both deacetylase and demethylase activity significantly in HEK 293 and HeLa cells. These findings suggest a functional link between HDAC inhibition and deacetylase/ demethylase activity (Lee, Wynder, et al., 2006; Mannironi et al., 2014). Our observations thus establish VPA as a key molecular player in epigenetic therapy. 3.3. VPA induces H3K27me3 hypomethylation in HEK 293 cells Epigenetic changes are implied in the silencing of several tumour-suppressor genes facilitating tumourigenesis and cancer progression (Esteller, 2008; Strahl & Allis, 2000). Trimethylation of lysine 27 on the histone H3

1189

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

Valproic acid modulates the epigenome of HEK293 cells

Figure 2. Epigenetic profiles altered by valproic acid treatment. The active mark H3K4me3 increases upon VPA treatment (a) Images of HEK 293 cell nuclei showing alteration of permissive epigenetic mark H3K4me3 upon VPA treatment (Panel 2) (b) Quantification of total fluorescence intensity show enhanced levels of H3K4me3 upon VPA treatment. The data presented here is the mean ± standard deviation of three individual experiments (*p < .05). (c) Quantification of expression of demethylase JARID1A in HEK 293 cells upon treatment with VPA (1 mM) for 48 h. The mRNA expression levels of site specific demethylase of H3K4me3, JARID1A decreased upon treatment with valproic acid for 48 h.

has been well documented as a repressive epigenetic signature in cells at the embryonic and developmental stages. The Polycomb groups of proteins catalyse the signalling and maintain silencing phenotypes in different systems under study. (Ringrose & Paro, 2004; Schuettengruber, Chourrout, Vervoort, Leblanc, &

Cavalli, 2007). We wanted to test the influence of VPA treatment on the methylation levels induced by VPA in HEK 293 cells. On treatment with VPA for 48 h, we observed a relative decrease of 19.3% in the levels of H3K27me3 in HEK 293 cells (Figures 4(a) and (b)).

S.A. Ganai et al.

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

1190

Figure 3. Valproic acid influences the structural inhibition of H3K4me3 by Demethylase JARID1A. Valproate forms newer interactions when docked to the demethylase JARID1A – H3 (1–9)K4me3 complex (PDB ID:3GL6) (a) Interaction of the JARID1A –H3 peptide complex (b) Interaction of the JARID1A-H3 complex with valproci acid (c) Ligand interaction diagram of the JARID1A –H3(1–9)K4me3 complex with valproic acid.

The Polycomb group of proteins forms chromatinassociated complexes that function to repress several thousand genes involved in embryonic development and differentiation (Bernstein et al., 2006; Boyer et al., 2006; Lee, Jenner, et al., 2006). The Polycomb repressorcomplex deposits trimethylated lysine 27 on histone H3 through its catalytic subunit EZH2 or EZH1 (Cao et al., 2002; Margueron & Reinberg, 2011). Motivated by these experiments, we attempted to obtain a structural interpretation of the interactions of the methylase EZH2 with VPA. VPA showed a strong docking with EZH2 as evidenced by G-score of −3.0. Binding free energies of the EZH2-VPA complexes calculated using MMGBSA in the frozen state (no flexibility to receptor) and in the flexible state (where receptors atoms were given flexibility up to 4 Å) were −31.794 kcal/mol and −31.184 kcal/ mol, respectively. VPA forms hydrogen bond interactions with Gly643 and Lys680 of the catalytic set domain of EZH2. The active sites residues of EZH2 like Tyr641 and Ala677 were also found to interact with VPA (Figure 5(a) and (b)). These residues have been identified as active site residues of EZH2 (McCabe et al., 2012), hence demonstrating an inhibitory role for VPA on EZH2. High levels of expression of H3K27me3 has emerged as an independent predictor of cancer-specific survival and is over-expressed in prostate, breast and bladder cancers and in melanoma (Bachmann et al., 2006; Collett et al., 2006; Kleer et al., 2003; McCabe et al., 2012; Raman et al., 2005; Varambally et al., 2002). Our finding that VPA exerts an integrated control over the expression levels of H3K27me3 through EZH2 may hence be considered a potential strategy to predict cancer prognosis. VPA induces hypomethylation in HEK 293 cells by regulating EZH2. The Polycomb Repressive Complex 2 (PRC2) comprises three key proteins – EZH2, SUZ12 and EED. SUZ is suppressor of zeste 12 and EED is embryonic ectoderm development. The methyltransferase activity is mediated by the enhancer of zeste SU3-9 and the trithorax domain of EZH2 which methylates the lysine 27 on the tail of histone H3 (Fiskus et al., 2009). The observed decrease in the levels of H3K27me3 prompted us to understand if this depletion is associated with the concomitant decrease in the levels of EZH2 in HEK 293 cells. Quantification of the levels of EZH2 in HEK 293 cells followed by pharmacological intervention with VPA demonstrated a loss in levels of EZH2 (66.35%), probably influencing the epigenetic roles of H3K27me3 in embryonic kidney cells (Figures 6(a) and (b)). 3.4. VPA does not alter H3K9me3 in HEK-293 cells H3K9me3 is a gene-repressive mark which facilitates heterochromatin spreading through heterochromatin protein 1 alpha (HP1α) (Fischle et al., 2003). We did not

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

Valproic acid modulates the epigenome of HEK293 cells

1191

Figure 4. HEK 293 cells show hypomethylation on H3K27me3 upon VPA treatment (a) Images of HEK 293 cell nuclei showing alteration of the repressive epigenetic mark H3K27me3 upon VPA treatment (Panel 2) (b) Quantification of total fluorescence intensity showing decrease in levels of H3K27me3 upon VPA treatment. The data presented here is the mean ± standard deviation of three individual experiments (*p < .05).

observe substantial changes in the levels of H3K9me3 following VPA treatment (Figure 7(a) and (b)). 3.5. VPA targets developmental kinases Though VPA is a potential drug for bipolar disorders and offers neuroprotection, experimental evidences indicate its intricate role in developmental regulatory pathways like glycogen synthase kinase 3α (GSK3α) and GSK3β, AKT and the ERK pathway among others. Overexpression of GSK3β in mice leads to developmental defects like microcephaly. Impaired function of the cerebral cortex and wet weight reduction of the entire brain by 20% have also been shown to accompany GSK3β upregulation (Spittaels et al., 2002). Inhibition of GSK3β has been attempted as a strategy to tackle developmental disorders (Hur & Zhou, 2010). Similarly,

overexpression states of PKCβII have been shown to enhance neovascularization of retina due to ischaemiainduced retinopathy and in myocardial hypertrophy and chronic lymphocytic leukaemia (CLL). Inhibition of PKCβII with a specific inhibitor like enzastaurin induces apoptosis in vitro in human CLL samples (Holler et al., 2009). In this study, we therefore attempted to investigate the structural influence of VPA on the two developmental kinases GSK3β and PKCβII. 3.6. VPA regulates glycogen synthase kinase 3β (GSK3β) GSK3β is a serine/threonine kinase involved in regulating critical developmental processes (Luo, 2012; Spittaels et al., 2002). In order to obtain a structural understanding of a possible interaction of GSK3β with

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

1192

S.A. Ganai et al.

Figure 5. Valproic acid influences the active sites of the methylase EZH2 (a) VPA targets Lys680 and Gly643 at the active site of EZH2 (b) Residues of EZH2 interacting with VPA within 5 Å.

Figure 6. EZH2 levels decrease upon treatment with valproic acid. Images of HEK 293 cell nuclei showing alteration in translational levels of methyltransferase EZH2 upon VPA treatment (Panel 2) (b) Quantification of total fluorescence intensity showing significant reduction in EZH2 protein levels upon VPA treatment. The data presented here is the mean ± standard deviation of three individual experiments (*p < .05).

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

Valproic acid modulates the epigenome of HEK293 cells

1193

Figure 7. Epigenetic signature H3K9me3 is not affected by treatment with valproic acid (a) Images of HEK 293 cell nuclei showing effect of VPA on the levels of H3K9me3 (Panel 2) (b) Quantification of total fluorescence intensity showing no substantial difference in H3K9me3 levels upon VPA treatment. The data presented here is the mean ± standard deviation of three individual experiments (*p < .05).

VPA, extra-precision flexible docking was attempted with GSK3β (PDB ID: 4ACC) and VPA. Our in silico studies showed targeting of GSK3β by VPA. VPA displayed a G-score of −3.9 and binding free energy value of −24.449 kcal/mol against GSK3β. Previous reports have shown that in the active state conformation of GSK3β, Lys85 and Glu97 form salt bridge while Asp200 and Gly202 form hydrogen bond (Buch et al., 2010). VPA targets Lys85 and Asp200 by forming hydrogen bond with these residues and hence may make them non-available for salt bridge formation and hydrogen bonding with their corresponding residues, respectively (Figure 8(a) and (b)). This results in an inactive state of GSK3β suggesting a possible role for VPA in developmental disorders.

3.7. VPA regulates protein kinase C βII (PKCβII) Protein kinase CβII (PKCβII) is a critical player in regulating diabetic complications (Way, Katai, & King, 2001). The expression of the isoforms of PKCβ is altered during the pre and post-natal periods of kidney development. Adult kidneys express PKCβII in parietal epithelial cells demonstrate that activation of PKCβII is critical in development. Therefore, we wanted to explore the possible influence of VPA on PKCβII. Our in silico studies showed targeting of this kinase by VPA. VPA showed a G-score of −3.0 and binding free energy value of −26.895 kcal/mol against PKCβII. Previous studies have shown that Asn471 and Asp484 are involved in the formation of activation loop of this kinase. This loop helps in the binding of two divalent cations which in turn help

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

1194

S.A. Ganai et al.

Figure 8. Valproic acid targets the active site of developmental kinase GSK3β (a) VPA interacts with Lys85 and Asp200 at the active site of GSK3β through hydrogen bonding (b) Ligand interaction diagram shows the residues of GSK3β within 5 Å interacting with VPA.

Figure 9. Valproic acid targets the active site of developmental kinase PKCβII. Docked complex of VPA and PKCβII (a) VPA interacts with Asp484 of PKCβII through hydrogen bonding (b) Ligand interaction diagrams show the residues of EZH2 interacting with VPA within 5 Å.

in nucleotide recognition (Grodsky et al., 2006). VPA forms hydrogen bond with Asp484 (Figure 9(a) and (b)). This may hinder the formation of activation loop and subsequent enzyme function. This shows that VPA may prove as a promising candidate in diabetes-induced complications involving PKCβII activation. 4. Conclusion The vital roles of HDACs and histone demethylases in disease aetiology and cellular differentiation are increasingly being investigated for therapy. In this work, we have shown that the HDAC inhibitor VPA enhances the

trimethylation state of H3K4 while downregulating the levels of H3K27me3. VPA has been extensively employed for treating bipolar disorders, depression and epilepsy. VPA has been shown to modulate neuronal transmission pathways but the epigenetic mechanisms invoked by VPA in cell growth and apoptosis are yet to be understood clearly. VPA has a demonstrated effect in chromatin remodelling and in sensitising cancer cells and modulating cellular responses to ionising radiation (Karagiannis & El-Osta, 2006). This work has established that chromatin-remodelling mechanisms are effected through alterations in gene-expression patterns by VPA at the molecular and epigenetic levels. Our

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

Valproic acid modulates the epigenome of HEK293 cells structural modelling reveals a conformational change induced by VPA on JARID1A demethylase demonstrating a possible mechanistic and structural connection between HDAC inhibition and regulation of H3K4 demethylases. Parallel increase in the levels of histone H3 acetylation and H3K4 trimethylation might also regulate a wide repertoire of genes associated with development, differentiation and tumour suppression. Inhibition of kinases is looked upon as a powerful strategy to treat developmental disorders. Discovery and development of kinase inhibitors for such disorders has been a major focus of pharmaceutical industry in the past few decades. Interestingly, the docking and binding free energy calculations reported in this work have established the potential of VPA in inhibiting the activities of GSK3β and PKCβII. The epigenetic changes we observed in embryonic cells and the diverse target molecules identified through our structural modelling establish that VPA targets multiple pathways exerting epigenetic control at different stages. Such target mechanisms may define newer directions in tumour therapy and in treating neurodevelopmental disorders. References Bachmann, I. M., Halvorsen, O. J., Collett, K., Stefansson, I. M., Straume, O., Haukaas, S. A., … Akslen, L. A. (2006). EZH2 expression is associated with high proliferation rate and aggressive tumor subgroups in cutaneous melanoma and cancers of the endometrium, prostate, and breast. Journal of Clinical Oncology, 24, 268–273. Bartova, E., Pachernik, J., Harnicarova, A., Kovarik, A., Kovarikova, M., Hofmanova, J., … Kozubek, S. (2005). Nuclear levels and patterns of histone H3 modification and HP1 proteins after inhibition of histone deacetylases. Journal of Cell Science, 118, 5035–5046. Bernstein, B. E., Mikkelsen, T. S., Xie, X., Kamal, M., Huebert, D. J., Cuff, J., … Lander, E. S. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell, 125, 315–326. Boyer, L. A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L. A., Lee, T. I., … Jaenisch, R. (2006). Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature, 441, 349–353. Brilli, L. L., Swanhart, L. M., Caestecker, M. P., & Hukriede, N. A. (2013). HDAC inhibitors in kidney development and disease. Pediatric Nephrology, 28, 1909–1921. Buch, I., Fishelovitch, D., London, N., Raveh, B., Wolfson, H. J., & Nussinov, R. (2010). Allosteric regulation of glycogen synthase kinase 3beta: A theoretical study. Biochemistry, 49, 10890–10901. Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., … Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science, 298, 1039–1043. Chen, C. S., Mrksich, M., Huang, S., Whitesides, G. M., & Ingber, D. E. (1997). Geometric control of cell life and death. Science, 276, 1425–1428. Christensen, J., Agger, K., Cloos, P. A., Pasini, D., Rose, S., Sennels, L., … Helin, K. (2007). RBP2 belongs to a family

1195

of demethylases, specific for tri-and dimethylated lysine 4 on histone 3. Cell, 128, 1063–1076. Collett, K., Eide, G. E., Arnes, J., Stefansson, I. M., Eide, J., Braaten, A., … Akslen, L. A. (2006). Expression of enhancer of zeste homologue 2 is significantly associated with increased tumor cell proliferation and is a marker of aggressive breast cancer. Clinical Cancer Research, 12, 1168–1174. Consalvi, S., Saccone, V., Giordani, L., Minetti, G., Mozzetta, C., & Puri, P. L. (2011). Histone deacetylase inhibitors in the treatment of muscular dystrophies: Epigenetic drugs for genetic diseases. Molecular Medicine, 17, 457–465. Cunliffe, V. T. (2008). Eloquent silence: Developmental functions of class I histone deacetylases. Current Opinion in Genetics & Development, 18, 404–410. de Ruijter, A. J., van Gennip, A. H., Caron, H. N., Kemp, S., & van Kuilenburg, A. B. (2003). Histone deacetylases (HDACs): Characterization of the classical HDAC family. Biochemical Journal, 370, 737–749. Esteller, M. (2008). Epigenetics in cancer. New England Journal of Medicine, 358, 1148–1159. Ezhkova, E., Lien, W. H., Stokes, N., Pasolli, H. A., Silva, J. M., & Fuchs, E. (2011). EZH1 and EZH2 cogovern histone H3K27 trimethylation and are essential for hair follicle homeostasis and wound repair. Genes & Development, 25, 485–498. Fischle, W., Wang, Y., Jacobs, S. A., Kim, Y., Allis, C. D., & Khorasanizadeh, S. (2003). Molecular basis for the discrimination of repressive methyl-lysine marks in histone H3 by Polycomb and HP1 chromodomains. Genes and Development, 17, 1870–1881. Fiskus, W., Wang, Y., Sreekumar, A., Buckley, K. M., Shi, H., Jillella, A., … Bhalla, K. N. (2009). Combined epigenetic therapy with the histone methyltransferase EZH2 inhibitor 3-deazaneplanocin A and the histone deacetylase inhibitor panobinostat against human AML cells. Blood, 114, 2733–2743. Friesner, R. A., Murphy, R. B., Repasky, M. P., Frye, L. L., Greenwood, J. R., Halgren, T. A., … Mainz, D. T. (2006). Extra precision glide: Docking and scoring incorporating a model of hydrophobic enclosure for protein−ligand complexes. Journal of Medicinal Chemistry, 49, 6177–6196. Gottlicher, M., Minucci, S., Zhu, P., Kramer, O. H., Schimpf, A., Giavara, S., … Heinzel, T. (2001). Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells. The Embo Journal, 20, 6969–6978. Grodsky, N., Li, Y., Bouzida, D., Love, R., Jensen, J., Nodes, B., … Grant, S. (2006). Structure of the catalytic domain of human protein kinase C beta II complexed with a bisindolylmaleimide inhibitor. Biochemistry, 45, 13970–13981. Grunstein, M. (1997). Histone acetylation in chromatin structure and transcription. Nature, 389, 349–352. Hertzog, R. G., Hertzog, D. I., & Patrinichi, B. (2009). Cytochemical study regarding the effect of trichostatin A on cell cultures. Therapeutics, Pharmacology and Clinical Toxicology, XIII. 154–160. Holler, C., Piñón, J. D., Denk, U., Heyder, C., Hofbauer, S., Greil, R., & Egle, A. (2009). PKCβ is essential for the development of chronic lymphocytic leukemia in the TCL1 transgenic mouse model: Validation of PKCβ as a therapeutic target in chronic lymphocytic leukemia. Blood, 113, 2791–2794. Hu, E., Dul, E., Sung, C. M., Chen, Z., Kirkpatrick, R., Zhang, G. F., … Jaye, M. (2003). Identification of novel

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

1196

S.A. Ganai et al.

isoform-selective inhibitors within class I histone deacetylases. Journal of Pharmacology and Experimental Therapeutics, 307, 720–728. Huang, P. H., Chen, C. H., Chou, C. C., Sargeant, A. M., Kulp, S. K., Teng, C. M., … Chen, C. S. (2011). Histone deacetylase inhibitors stimulate histone H3 lysine 4 methylation in part via transcriptional repression of histone H3 lysine 4 demethylases. Molecular Pharmacology, 79, 197–206. Hur, E. M., & Zhou, F. Q. (2010). GSK3 signalling in neural development. Nature Reviews Neuroscience, 11, 539–551. Johannessen, C. U., & Johannessen, S. I. (2003). Valproate: Past, present, and future. CNS Drug Reviews, 9, 199–216. Karagiannis, T. C., & El-Osta, A. (2006). Clinical potential of histone deacetylase inhibitors as stand alone therapeutics and in combination with other chemotherapeutics or radiotherapy for cancer. Epigenetics, 1, 121–126. Kim, H. J., & Bae, S. C. (2011). Histone deacetylase inhibitors: Molecular mechanisms of action and clinical trials as anticancer drugs. American Journal of Translational Research, 3, 166–179. Kleer, C. G., Cao, Q., Varambally, S., Shen, R., Ota, I., Tomlins, S. A., … Chinnaiyan, A. M. (2003). EZH2 is a marker of aggressive breast cancer and promotes neoplastic transformation of breast epithelial cells. Proceedings of the National Academy of Sciences of the United States of America, 100, 11606–11611. Kuo, M. H., & Allis, C. D. (1998). Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays, 20, 615–626. Le Beyec, J., Xu, R., Lee, S. Y., Nelson, C. M., Rizki, A., Alcaraz, J., & Bissell, M. J. (2007). Cell shape regulates global histone acetylation in human mammary epithelial cells. Experimental Cell Research, 313, 3066–3075. Lee, M. G., Wynder, C., Bochar, D. A., Hakimi, M. A., Cooch, N., & Shiekhattar, R. (2006). Functional interplay between histone demethylase and deacetylase enzymes. Molecular and Cellular Biology, 26, 6395–6402. Lee, T. I., Jenner, R. G., Boyer, L. A., Guenther, M. G., Levine, S. S., Kumar, R. M., … Young, R. A. (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell, 125, 301–313. Legube, G., & Trouche, D. (2003). Regulating histone acetyltransferases and deacetylases. EMBO Reports, 4, 944–947. LigPrep. 2012. Schrodinger (Version 2.5). New York, NY: LLC. Liu, S., Cheng, H., Kwan, W., Lubieniecka, J. M., & Nielsen, T. O. (2008). Histone deacetylase inhibitors induce growth arrest, apoptosis, and differentiation in clear cell sarcoma models. Molecular Cancer Therapeutics, 7, 1751–1761. Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., & Richmond, T. J. (1997). Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature, 389, 251–260. Luo, J. (2012). The role of GSK3beta in the development of the central nervous system. Frontiers in Biology, 7, 212–220. Lyne, P. D., Lamb, M. L., & Saeh, J. C. (2006). Accurate prediction of the relative potencies of members of a series of kinase inhibitors using molecular docking and MM-GBSA scoring. Journal of Medicinal Chemistry, 49, 4805–4808. Mannironi, C., Proietto, M., Bufalieri, F., Cundari, E., Alagia, A., Danovska, S., … Negri, R. (2014). An high-throughput in vivo screening system to select H3K4-specific histone demethylase inhibitors. PLoS One, 9, e86002. Marchion, D. C., Bicaku, E., Daud, A. I., Sullivan, D. M., & Munster, P. N. (2005). Valproic acid alters chromatin structure by regulation of chromatin modulation proteins. Cancer Research, 65, 3815–3822.

Margueron, R., & Reinberg, D. (2011). The Polycomb complex PRC2 and its mark in life. Nature, 469, 343–349. Marinova, Z., Leng, Y., Leeds, P., & Chuang, D. M. (2011). Histone deacetylase inhibition alters histone methylation associated with heat shock protein 70 promoter modifications in astrocytes and neurons. Neuropharmacology, 60, 1109–1115. Martín-Sánchez, E., Sánchez-Beato, M., Rodríguez, M. E., Sánchez-Espiridión, B., Gómez-Abad, C., Bischoff, J. R., … García, J. F. (2011). HDAC inhibitors induce cell cycle arrest, activate the apoptotic extrinsic pathway and synergize with a novel PIM inhibitor in Hodgkin lymphomaderived cell lines. British Journal of Haematology, 152, 352–356. McCabe, M. T., Ott, H. M., Ganji, G., Korenchuk, S., Thompson, C., Van Aller, G. S., … Creasy, C. L. (2012). EZH2 inhibition as a therapeutic strategy for lymphoma with EZH2-activating mutations. Nature, 492, 108–112. Milutinovic, S., D’Alessio, A. C., Detich, N., & Szyf, M. (2007). Valproate induces widespread epigenetic reprogramming which involves demethylation of specific genes. Carcinogenesis, 28, 560–571. Munshi, A., Kurland, J. F., Nishikawa, T., Tanaka, T., Hobbs, M. L., Tucker, S. L., … Meyn, R. E. (2005). Histone deacetylase inhibitors radiosensitize human melanoma cells by suppressing DNA repair activity. Clinical Cancer Research, 11, 4912–4922. Nightingale, K. P., Gendreizig, S., White, D. A., Bradbury, C., Hollfelder, F., & Turner, B. M. (2007). Cross-talk between histone modifications in response to histone deacetylase inhibitors: MLL4 links histone H3 acetylation and histone H3K4 methylation. Journal of Biological Chemistry, 282, 4408–4416. Nowak, S. J., & Corces, V. G. (2004). Phosphorylation of histone H3: A balancing act between chromosome condensation and transcriptional activation. Trends in Genetics, 20, 214–220. Phiel, C. J., Zhang, F., Huang, E. Y., Guenther, M. G., Lazar, M. A., & Klein, P. S. (2001). Histone deacetylase is a direct target of valproic acid, a potent anticonvulsant, mood stabilizer, and teratogen. Journal of Biological Chemistry, 276, 36734–36741. Raman, J. D., Mongan, N. P., Tickoo, S. K., Boorjian, S. A., Scherr, D. S., & Gudas, L. J. (2005). Increased expression of the polycomb group gene, EZH2, in transitional cell carcinoma of the bladder. Clinical Cancer Research, 11, 8570–8576. Ringrose, L., & Paro, R. (2004). Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annual Review of Genetics, 38, 413–443. Saha, A., Wittmeyer, J., & Cairns, B. R. (2006). Chromatin remodelling: The industrial revolution of DNA around histones. Nature Reviews Molecular Cell Biology, 7, 437–447. Salam, N. K., Nuti, R., & Sherman, W. (2009). Novel method for generating structure-based pharmacophores using energetic analysis. Journal of Chemical Information and Modeling, 49, 2356–2368. Sayegh, J., Cao, J., Zou, M. R., Morales, A., Blair, L. P., Norcia, M., … Yan, Q. (2013). Identification of small molecule inhibitors of Jumonji AT-rich interactive domain 1B (JARID1B) histone demethylase by a sensitive high throughput screen. Journal of Biological Chemistry, 288, 9408–9417. Schuettengruber, B., Chourrout, D., Vervoort, M., Leblanc, B., & Cavalli, G. (2007). Genome regulation by polycomb and trithorax proteins. Cell, 128, 735–745.

Downloaded by [University of Nebraska, Lincoln] at 19:35 31 August 2015

Valproic acid modulates the epigenome of HEK293 cells Spina, E., & Perugi, G. (2004). Antiepileptic drugs: Indications other than epilepsy. Epileptic Disorders, 6, 57–75. Spittaels, K., Van den Haute, C., Van Dorpe, J., Terwel, D., Vandezande, K., Lasrado, R., … Van Leuven, F. (2002). Neonatal neuronal overexpression of glycogen synthase kinase-3β reduces brain size in transgenic mice. Neuroscience, 113, 797–808. Sproul, D., Gilbert, N., & Bickmore, W. A. (2005). The role of chromatin structure in regulating the expression of clustered genes. Nature Reviews Genetics, 6, 775–781. Strahl, B. D., & Allis, C. D. (2000). The language of covalent histone modifications. Nature, 403, 41–45. Van Damme, M., Crompot, E., Meuleman, N., Mineur, P., Bron, D., Lagneaux, L., & Stamatopoulos, B. (2012). HDAC isoenzyme expression is deregulated in chronic lymphocytic leukemia B-cells and has a complex prognostic significance. Epigenetics, 7, 1403–1412. Varambally, S., Dhanasekaran, S. M., Zhou, M., Barrette, T. R., Kumar-Sinha, C., Sanda, M. G., … Chinnaiyan, A. M. (2002). The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature, 419, 624–629. Vergani, L., Grattarola, M., & Nicolini, C. (2004). Modifications of chromatin structure and gene expression following induced alterations of cellular shape. The International Journal of Biochemistry & Cell Biology, 36, 1447–1461. Ververis, K., Hiong, A., Karagiannis, T. C., & Licciardi, P. V. (2013). Histone deacetylase inhibitors (HDACIs): Multitargeted anticancer agents. Biologics, 7, 47–60.

1197

Wang, G. G., Song, J., Wang, Z., Dormann, H. L., Casadio, F., Li, H., … Allis, C. D. (2009). Haematopoietic malignancies caused by dysregulation of a chromatin-binding PHD finger. Nature, 459, 847–851. Way, K. J., Katai, N., & King, G. L. (2001). Protein kinase C and the development of diabetic vascular complications. Diabetic Medicine, 18, 945–959. Weake, V. M., & Workman, J. L. (2008). Histone ubiquitination: Triggering gene activity. Molecular Cell, 29, 653–663. Wu, C. (1997). Chromatin remodeling and the control of gene expression. Journal of Biological Chemistry, 272, 28171–28174. Yang, X. J., & Seto, E. (2007). HATs and HDACs: From structure, function and regulation to novel strategies for therapy and prevention. Oncogene, 26, 5310–5318. Yildirim, E., Zhang, Z., Uz, T., Chen, C. Q., Manev, R., & Manev, H. (2003). Valproate administration to mice increases histone acetylation and 5-lipoxygenase content in the hippocampus. Neuroscience Letters, 345, 141–143. Zhang, K., Siino, J. S., Jones, P. R., Yau, P. M., & Bradbury, E. M. (2004). A mass spectrometric “Western blot” to evaluate the correlations between histone methylation and histone acetylation. Proteomics, 4, 3765–3775. Zhao, Y., Xing, B., Dang, Y. H., Qu, C. L., Zhu, F., & Yan, C. X. (2013). Microinjection of valproic acid into the ventrolateral orbital cortex enhances stress-related memory formation. PLoS One, 8, e52698.