Original Article
DOI: 10.1111/vco.12149
Hedgehog signaling is activated in canine transitional cell carcinoma and contributes to cell proliferation and survival T. L. Gustafson1 , B. E. Kitchell2 and B. Biller3 1
Colorado State University, Animal Cancer Center, Fort Collins, CO, USA VCA Veterinary Care Animal Hospital and Referral Center, Oncology, Albuquerque, NM, USA 3 Colorado State University, CVMBS-VTH, Animal Cancer Center, Fort Collins, CO, USA 2
Abstract
Keywords Hedgehog, transitional cell carcinoma
Transitional cell carcinoma (TCC) is the most commonly diagnosed tumor of the canine urinary system. Hedgehog (HH) signaling represents one possible novel therapeutic target, based on its recently identified central role in human urothelial carcinoma. The purpose of this study was to determine if HH mediators are expressed in canine TCC and the effect of inhibition of this pathway on cell growth and survival. HH pathway mediators were found to be expressed in five canine TCC cell lines. Indian HH was expressed in tumor cells in five canine bladder tumor tissues, but not in normal canine bladder tissue. Inhibition of HH signaling with cyclopamine and GANT61 led to significantly decreased cell proliferation but had a smaller effect on apoptosis. These results support future investigation of inhibitors of HH signaling in the treatment of canine TCC.
Introduction
Correspondence address: T. L. Gustafson Colorado State University Animal Cancer Center Fort Collins CO USA e-mail: [email protected]
Transitional cell carcinoma (TCC) of the urinary bladder is common in dogs, particularly in certain breeds such as the Scottish Terrier, West Highland White Terrier, Beagle and Shetland Sheepdog.1,2 Urothelial carcinoma is also the fifth most common form of cancer in humans in the USA, accounting for >54 000 new cancer cases in the USA each year.3 Naturally occurring bladder cancer in the dog very closely resembles invasive bladder cancer in humans.1 Therefore, similar molecular pathways of tumor pathogenesis may be present in both humans and dogs such that human advances can be exploited to benefit canine health and vice versa. Hedgehog (HH) proteins are key mediators of normal embryonic development.4 In humans, Sonic Hedgehog (SHH) promotes growth, patterning and morphogenesis of many tissues and organs. SHH signals through binding to Patched (PTCH), which in the absence of SHH, inhibits Smoothened (SMO). SMO regulates the effectors of HH signaling (glioma-associated oncogene homologue
© 2015 John Wiley & Sons Ltd
1–3, GLI1-3). In the presence of HH binding to PTCH, SMO releases GLI proteins, which activate transcription of downstream effectors and also increase expression of HH mediators, PTCH and GLI proteins.5 Indian hedgehog (IHH) is a lesser known HH family member which plays roles in endochondral bone development and gastrointestinal development.6 – 8 IHH is a master regulator of bone development and as such regulates parathyroid hormone-related peptide (PTHrP) and stimulation of chondrocyte proliferation.7 IHH is also critical for differentiation of visceral endoderm.9 Later in development, IHH appears to regulate the proliferation and differentiation of intestinal epithelial stem cells.8 In addition to a role in normal development, preclinical data suggests aberrant regulation of HH signaling in cancers of the skin, brain, lung, breast, prostate, pancreas, colon and bladder.5,10 In human urothelial carcinoma, HH signaling is required for tumorigenesis and tumor growth.11 – 13 This is
1
2 T. L. Gustafson et al.
illustrated by recent work that shows that transformed human urothelial cells and many urothelial carcinoma cell lines exhibit constitutive HH signaling.11 In addition, increased levels of SHH and its target genes, including GLI1, are found in up to 96% of human bladder tumors.14 Clinical relevance is showed by the correlation of SHH, PTCH1 and GLI1 expression with higher stage, presence of lymph node metastasis and shorter disease-free and overall survival durations.12 Importantly, the HH pathway represents a therapeutic target.5 Inhibition of HH signaling through the GLI inhibitor, GANT61, significantly reduces invasiveness of human bladder TCC lines.13 Cyclopamine, a naturally occurring inhibitor derived from the corn lily (Veratrum californicum), blocks the HH pathway through binding to SMO. The pharmacologic analog of cyclopamine, vismodegib, is used to treat basal cell carcinoma and medulloblastoma, which are cancers known to be driven by HH pathway mutations.5 In this study, we set out to determine if HH mediators are expressed in canine TCC and the effect of inhibition of this pathway on cell growth and survival. On the basis of similarity of advanced TCC in humans and dogs, we hypothesized that HH mediators would be expressed in canine TCC and that inhibition of HH signaling would lead to decreased cell proliferation or increased apoptosis. Our results suggest that HH signaling plays an important role in canine TCC and that inhibition of this pathway may represent a new treatment approach.
Materials and methods Cell line maintenance Canine (K9) TCC, K9TCC-In, K9TCC-AxA, K9TCC-Sh, and K9TCC-NK cell lines (provided by
Dr Knapp) were maintained in Dulbecco’s minimal essential medium supplemented with 10% fetal bovine serum. These cell lines were derived from individual treatment-naïve grade 2 or 3 invasive TCCs based on histopathology and have been previously characterized.15 All cell lines were validated for species and genetic identity using shorttandem-repeat profiling as previously described.16 All cells were maintained in 5% CO2 at 37 ∘ C.
RNA isolation and real time RT-PCR RNA was isolated using a Qiaquick RNeasy Mini kit with Qiashredder columns (Qiagen, Valencia, CA, USA). RNA was quantified by UV spectroscopy. One microgram RNA was reverse transcribed using qScript cDNA synthesis kit (Quanta Biosciences, Gaithersburg, MD, USA). cDNA was then used as template for SYBR Green quantitative PCR (Quanta Biosciences). Primers for real time PCR (Table 1) were validated with standard curves to calculate efficiency, based on previously reported methods.17 Standard curves are shown in Fig. S1, Supporting Information. Data was analyzed using the ΔΔCt method. Reactions were performed in triplicate. PCR products were verified for size by agarose gel electrophoresis. Hypoxanthine phosphoribosyltransferase 1 (HPRT1) and PTCH1 were sequenced using ABI BigDye Terminator v3.1 (Life Technologies, Grand Island, NY, USA) on an ABI 3130xL Genetic Analyzer (Life Technologies) to confirm identity. IHH, GLI1 and GLI2 PCR products were verified by restriction digestion (Fig. S2).
Western blot Protein was isolated using RIPA buffer [25 mM Tris–HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate
Table 1. Primers used for real time RT-PCR
Target gene IHH GLI1 GLI2 PTCH1 HPRT1
Forward primer
Reverse primer
Size of product (bp)
CTGGAAGGGATCTGAGTTGG CAGCAGCTGAACCTTATGGA GCCTCAAGAAAGTGGGAAGA TGTCTGTAATCCTTCATGGGC TGCTCGAGATGTGATGAAGG
GGTCAAGTTGCAATGGTGTG GGGTGGTTCAGGATAGGAGA TGGAGAAACAGGATTGGGTAAA AAAGAGATGCCTTGGACCTG TCCCCTGTTGACTGGTCATT
75 116 103 139 191
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
Hedgehog signaling in canine TCC
3
Figure 1. Expression of HH genes in five canine TCC cell lines. Variable expression of IHH, PTCH1, GLI1 and GLI2 was observed across the cell lines. RNA expression was evaluated by real time RT-PCR using HPRT1 as the internal standard. Bars represent the mean ΔΔCt ± SD of triplicate reactions.
(SDS)] with protease inhibitors added. Protein was quantified with the BCA Protein Assay kit (Pierce Biotechnology, Rockford, IL, USA) and absorbance was measured using a microplate reader at 570 nm. Equal amounts of protein were separated by SDS polyacrylamide gel electrophoresis, transferred to a polyvinylidene difluoride (PVDF) membrane, and hybridized to an appropriate primary antibody and a HRP-conjugated secondary antibody for subsequent detection by ECL using standard techniques. HeLa cell lysate (BD Biosciences, San Diego, CA, USA) was used as a positive control. Antibodies used were anti-IHH (1:1000, Abcam, Cambridge, MA, USA), anti-GAPDH (1:2000, Santa Cruz, Biotechnology, Dallas, TX, USA), and anti-rabbit secondary antibody (1:5000, Bio-Rad, Hercules, CA, USA).
Solution (Dako, Carpinteria, CA, USA, pH 6.0), blocked with Background Sniper (Biocare Medical, Concord, CA, USA) for 5 min at room temperature, and incubated with Anti-IHH (Abcam) antibody at 1:200 dilution (in Antibody Diluent, Dako) overnight at 4 ∘ C. A negative control section was incubated without primary antibody. Sections were then incubated with prediluted secondary antibody, horseradish peroxidase-conjugated anti-rabbit/mouse IgG (Envision and Dual Link System HRP, Dako), for 1 h at 4 ∘ C. Diaminobenzidine (DAB, Ventana Medical Systems, Tucson, AZ, USA) was used as a chromogen for immunoreactive complex detection. Sections were then counterstained with hematoxylin, dehydrated and mounted with Permount.
Cell proliferation assay Immunohistochemistry Formalin-fixed paraffin-embedded tumor sections (5 μm) were deparaffinized and rehydrated in xylene and graded ethanol baths. Sections were treated at 125 ∘ C for 1 min in Target Retrieval
Cells of the K9TCC and K9TCC-Sh lines were seeded at 1–2 × 106 cells mL−1 in 6-well plates. Cells were treated with equal volumes of either vehicle (ethanol), 10 𝜇M cyclopamine or 10 𝜇M GANT61, based on similar doses used in recent
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
4 T. L. Gustafson et al.
Figure 2. Expression of IHH in cell lines and canine bladder tumors.( A) Western blot for IHH in five TCC cell lines compared to GAPDH control. HeLa cell lysate was used as a positive control because of known IHH expression. (B) IHC for IHH in normal canine thymus, showing expression in thymocytes, and in normal canine bladder, showing lack of detection. (C) IHC for IHH in five canine bladder tumors. Clusters of cells representing the minority of tumor cells stained positively for IHH in bladder tumor sections examined. Boxes show portion of image at higher magnification.
human in vitro models to achieve signaling inhibition in bladder, prostate and biliary carcinoma cells.13,18,19 Cells were harvested at time points, 0, 48 and 96 h, and counted using a Cellometer Auto T4 cell counter (Nexcelom Bioscience, Lawrence, MA, USA). Viability was determined by Trypan blue (Life Technologies, Grand Island, NY, USA) staining. Each experiment was conducted in triplicate.
AlamarBlue assay Cells of the K9TCC and K9TCC-Sh cell lines were seeded at 2000 cells/well in 96 well plates. Cells were treated as before with equal volumes of either vehicle (ethanol), cyclopamine or GANT61. Final concentrations of cyclopamine and GANT61 ranged from 2.5 to 30 𝜇M. After 48 and 96 h, alamarBlue
(Life Technologies) was added and the cells were incubated for 1 h at 37 ∘ C. Fluorescence emission was measured at 590 nm. Five replicates of each treatment were performed.
Annexin V assay Cells of the K9TCC and K9TCC-Sh lines were seeded at 1–2 × 105 cells mL−1 in 25 cm2 flasks. Cells were treated with equal volumes of either vehicle (ethanol), 10 𝜇M cyclopamine or 10 𝜇M GANT61. Cells and supernatant were harvested by scraping after 48 or 96 h. Cells were washed with PBS and then stained with Annexin V-V450 (BD Biosciences) and propidium iodide (PI, BD Biosciences), according to manufacturer instructions. Cells were analyzed on a CyanADP flow cytometer (Dako). Annexin V (+) and PI (−) cells
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
Hedgehog signaling in canine TCC
were considered in early apoptosis; Annexin V (+) and PI (+) cells were considered in late apoptosis. Each assay was conducted in duplicate for each treatment.
Statistical analysis Results are reported as the mean ± standard deviation of replicates. Cell survival data were fitted to a non-linear regression model to determine the mean half maximum inhibitory concentration (IC50 ) for each cell line. The IC50 was defined as the drug concentration that caused 50% metabolic activity compared with the control. Statistical evaluation was performed using one-way analysis of variance (ANOVA) with a Tukey post-test. P < 0.05 was considered statistically significant.
5
lines. Normal canine thymus was used to validate the antibody for IHC, because IHH is normally expressed in thymocytes (Fig. 2B). Expression restricted to the epithelial population of the canine thymus was seen as expected.22,23 IHH expression was then evaluated in five canine TCC tissues. IHH was detected in all five tumors; however, expression was not uniform throughout the tumors. IHH was detected in clusters of cells within the tumors, representing a minority of the total tumor cell population (Fig. 2C). Average number of positive cells in tumor sections ranged from 10 to 37 cells per high power field, representing 5–25% of the total cells. IHH expression was not observed in the surrounding stroma or normal canine bladder urothelium.
Inhibition of HH signaling decreases cell proliferation and viability
Results HH expression in canine TCC To investigate whether HH mediators play a role in canine TCC, RNA expression was first evaluated in five previously characterized canine TCC cell lines (K9TCC, K9TCC-In, K9TCC-Sh, K9TCC-AxA and K9TCC-Nk) using real time RT-PCR. The HH pathway genes IHH, PTCH1, GLI1 and GLI2 were found to be expressed in the five canine TCC cell lines (Fig. 1). Attempts to amplify SHH from the cell lines revealed no product (data not shown). Four out of five cell lines expressed high levels of IHH. The K9TCC cell line expressed high levels of GLI1 but low levels of GLI2 compared to the other lines. Interestingly, the K9TCC-Sh cell line expressed relatively low levels of IHH yet high levels of PTCH1, GLI1 and GLI2. As expected, PTCH1 expression mirrored that of GLI2, consistent with the observation that PTCH1 is a downstream target of GLI transcription. To determine if the HH expression seen in vitro was also true in vivo, IHH protein expression was evaluated in five canine bladder tumors and normal bladder tissue through immunohistochemistry (IHC). Protein expression was first verified in the five TCC cell lines by Western blot, using HeLa cell extract as a positive control (Fig. 2A).20,21 The greatest protein expression was seen in the K9TCC cell line, but IHH was detectable in all five cell
On the basis of differential expression of IHH and GLI in the K9TCC and K9TCC-Sh cell lines, we then examined the effect of inhibition of HH signaling. Cells were treated with cyclopamine, an inhibitor of SMO, or GANT61, an inhibitor of GLI, used in recent in vitro models to achieve signaling inhibition and cytotoxicity in human bladder, prostate and biliary carcinoma cells.13,18,19 After treatment with either drug, expression of the downstream targets of HH signaling, GLI1, GLI2 and PTCH1, were significantly decreased in both cell lines (Fig. 3). In order to determine drug concentrations which inhibit proliferation in each cell line, cells were treated with increasing concentrations of cyclopamine and GANT61 for 48 or 96 h (Fig. 4A). Cell metabolic activity data were fitted to a nonlinear regression model in order to determine the IC50 for each cell line at each time point. Treatment with cyclopamine and GANT61 resulted in a dose- and time-dependent decrease in metabolic activity in both cell lines (Table 2). On the basis of these values, proliferation in the canine TCC cell lines was evaluated using a concentration of 10 𝜇M cyclopamine and 10 𝜇M GANT61 compared to vehicle-treated controls. Cell proliferation was significantly decreased after 96 h of treatment with cyclopamine and GANT61 in each cell line (Fig. 4B).
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
6 T. L. Gustafson et al.
Figure 3. Inhibition of HH signaling decreases expression of downstream targets. Expression of GLI1, GLI2 and PTCH1 in (A) K9TCC and (B) K9TCC-Sh cells after 96 h of treatment with cyclopamine 10 𝜇M or GANT61 10 𝜇M compared to vehicle-treated cells. RNA expression was evaluated by real time RT-PCR using HPRT1 as the internal standard. Bars represent the mean ΔΔCt ± SD of triplicate reactions. * indicates p < 0.05.
GANT61 increases apoptosis in K9TCC cells In addition to anti-proliferative effects, HH signaling may also activate growth factors and antiapoptotic factors in malignant cells.24 – 26 To determine the impact of HH inhibition on apoptosis in canine TCC, K9TCC and K9TCC-Sh cell lines were again treated with cyclopamine and GANT61 for 96 h. As shown in Fig. 5, treatment with GANT61 led to a significant increase in apoptosis in the K9TCC cell line. In K9TCC-Sh cells, however, an effect on apoptosis was not observed. Cyclopamine did not increase apoptosis in either cell line. Apoptosis was also evaluated after 48 h of drug treatment; however, no significant effect on apoptosis was present in either cell line (data not shown).
Discussion In this study we investigated the role of HH signaling in canine TCC. Although SHH could not be identified in any of the TCC cell lines, IHH was relatively abundant. IHH and Desert Hedgehog (DHH), along with SHH, have recently been suggested to have various roles in human cancers. Both IHH and SHH are highly expressed in human gastric cancer.27,28 DHH has prognostic value in clear cell renal cell carcinoma whereas IHH plays
a role in squamous cell carcinoma progression and metastasis.29,30 In human osteosarcoma cell lines, IHH has been found to be upregulated, and inhibition of signaling leads to decreased xenograft tumor size.31 HH gene expression is also known to vary in tissue specificity between species. For example, during development different patterns of expression of SHH are seen in the cerebellum between humans and mice,32 and SHH expression patterns differ between rats and mice during esophageal and tracheal development.33 Therefore, it is possible that IHH plays a predominant role in canine TCC, in contrast to the situation seen in urothelial carcinoma in humans, which is driven by SHH. To evaluate other genes in the HH pathway, we next examined expression of GLI1, GLI2 and PTCH1 in canine TCC cell lines. Different patterns of expression of HH mediators were exhibited in various cell lines. The K9TCC cell line displayed high levels of IHH and GLI1, but low GLI2 expression. The K9TCC-Sh cell line expressed high levels of PTCH1, GLI1 and GLI2, despite having low IHH expression. In human cancers, several mechanisms of HH pathway activation have been described, including ligand-dependent and ligand-independent means.5,34 In K9TCC cells, the high levels of IHH suggest that this ligand is important for signaling. However, in K9TCC-Sh
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
Hedgehog signaling in canine TCC
7
Figure 4. Inhibition of HH decreases cell proliferation. (A) Metabolic activity after 48 and 96 h of treatment with increasing concentrations of cyclopamine or GANT61 in K9TCC and K9TCC-Sh cell lines, assessed by alamarBlue assay. Bars represent the mean of five samples, and data are expressed as the mean ± SD. (B) Cell proliferation in K9TCC and K9TCC-Sh cells treated with 10 𝜇M cyclopamine, 10 𝜇M GANT61, or vehicle. Symbols represent the mean of triplicate samples, and data are expressed as the mean ± SD. * indicates p < 0.05.
cells there is perhaps a ligand-independent mechanism, such as PTCH1 mutation, driving expression of downstream targets. Further studies are needed to identify the presence and prevalence of PTCH1 mutations in canine TCC. Consistent with expression of IHH in canine TCC cell lines, IHH was also detectable in canine bladder tumor tissues. IHH protein was not found uniformly throughout the tumor tissues, however, but in small clusters representing 5–25% of the tumor cells. A minority of cells in these tumors appear to be involved in HH signaling, which may represent highly proliferating cells. The K9TCC cells, which express much greater levels of IHH, appeared more sensitive to cyclopamine based on a trend toward lower IC50
values compared to K9TCC-Sh cells. Inhibition of HH signaling with cyclopamine and GANT61 led to decreased cell proliferation in the K9TCC and K9TCC-Sh cell lines. This is expected based on the well-established role of HH in promoting proliferation during development and in several human cancers.4,7,10 HH signaling promotes proliferation rather than differentiation during development of the intestinal tract, brain and bone.7 In cancer models HH also upregulates cyclins, E2F and cyclin-dependent kinases.35 Further, inhibition of GLI slows progression through the G1/S checkpoint in human colon carcinoma cells, showing the direct role of HH signaling in proliferation.35 B-cell lymphoma-2 (BCL2) has also been shown to be a target of HH signaling through GLI2 in
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
8 T. L. Gustafson et al.
Figure 5. Apoptosis in K9TCC and K9TCC-Sh cells treated with HH inhibitors. (A) K9TCC and (B) K9TCC-Sh cells treated with 10 𝜇M cyclopamine or 10 𝜇M GANT61 for 96 h compared to vehicle-treated or untreated cells. Bars represent the mean of the sums of the percentages of Annexin V+/PI- and Annexin V+/PI+ cells. Data are expressed as the mean ± SD. * indicates p < 0.05. Table 2. IC50 values for K9TCC and K9TCC-Sh cell lines-treated with cyclopamine and GANT61 48 h Cell line + drug K9TCC + Cyclopamine K9TCC-Sh + Cyclopamine K9TCC + GANT61 K9TCC-Sh + GANT61
96 h
IC50 (95% CI)
R2
IC50 (95% CI)
R2
14 𝜇M (12–17) 19 𝜇M (16–22) 15 𝜇M (12–19) 13 𝜇M (9.7–19)
0.97 0.97 0.96 0.93
9.2 𝜇M (6.5–13) 13 𝜇M (10–16) 7.9 𝜇M (6.5–9.7) 8.0 𝜇M (5.7–11)
0.95 0.96 0.98 0.95
Cell metabolic activity data were fitted to a nonlinear regression model in order to determine the IC50 values for each cell line. 95% confidence interval is shown in parentheses. Correlation coefficients (R2 values) were evaluated to determine the goodness of fit of the derived values for each dose–response curve.
basal cell carcinoma.26 Therefore, HH could have a secondary role in preventing apoptosis in some cancers. Upon evaluation of apoptosis in the canine TCC cell lines, differential effects of the inhibitors were seen. A high background rate of apoptosis was also observed in both cell lines despite various harvesting methods and performing the assay at both the 48 and 96-h time points. This background may be due to a high sensitivity to anoikis in these cell lines. However, 96 h of treatment with GANT61 led to a modest but detectable increase in apoptosis in K9TCC cells whereas cyclopamine had no effect. Our findings are consistent with other studies in which differential effects of cyclopamine and GANT61 on proliferation and apoptosis have previously been reported in human biliary tract cancer.19 Together, these observations illustrate the potential need for a more personalized medicine
approach in dogs with certain cancers, targeting specific pathways utilized by tumor cells for survival, growth and metastasis. A limitation of this study is that the differential effects of cyclopamine and GANT61 on HH signaling in canine TCC may be the result of off target effects rather than being directly related to HH signaling mediators. Further experiments utilizing microarray analysis or RNA interference methodologies may help to elucidate any additional anti-tumor effects of these drugs. Another important limitation is that therapeutic use of cyclopamine is constrained by poor pharmacokinetic and physiochemical profiles as well as low potency.10 GANT61 has shown anti-neoplastic activity in vitro and in vivo, but has yet to be evaluated in human clinical trials.10 However, the SMO inhibitor vismodegib recently has been approved by the Food and Drug Administration for the treatment of metastatic and recurrent locally advanced
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
Hedgehog signaling in canine TCC
basal cell carcinoma and is currently being evaluated in a number of clinical studies.10 Our findings support further investigation of vismodegib and other HH inhibitors in canine TCC.
Acknowledgements The authors would like to thank Deborah Knapp for providing K9TCC cell lines, Brad Charles and EJ Ehrhart for assistance with immunohistochemistry techniques, Barbara Rose and Amanda Guth for their assistance with flow cytometry, and Dawn Duval for her assistance with real time RT-PCR and for cell line validation.
Supporting Information Additional Supporting Information may be found in the online version of this article: Figure S1. Efficiency calculations for real-time primers. Efficiency was calculated based on the slope of a standard curve generated by graphing Ct versus the log of the quantity of template cDNA. Serial dilutions of a mix of template cDNAs were used to add 1–100 ng template. Adequate efficiency to use ΔΔCt method analysis was judged to be between 90 and 110%. Figure S2. Restriction digests of IHH, GLI1 and GLI2 real time PCR products. IHH was digested with BccI (43 and 32 bp products) and BseRI (44 and 30 bp products). GLI2 was digested with ApaI (31 and 70 bp products) and XmaI (48 and 55 bp products). GLI1 was digested with BslI (70 and 46 bp products) and BstNI (21, 29 and 66 bp products). Expected bands were obtained with the two different digests for each product, verifying correct amplification.
References 1. Knapp DW, Glickman NW, Denicola DB, Bonney PL, Lin TL and Glickman LT. Naturally-occurring canine transitional cell carcinoma of the urinary bladder A relevant model of human invasive bladder cancer. Urologic Oncology 2000; 5: 47–59. 2. Glickman LT, Raghavan M, Knapp DW, Bonney PL and Dawson MH. Herbicide exposure and the risk of transitional cell carcinoma of the urinary bladder in Scottish Terriers. Journal of the American Veterinary Medical Association 2004; 224: 1290–1297.
9
3. Henry CJ, McCaw DL, Turnquist SE, Tyler JW, Bravo L, Sheafor S, et al. Clinical evaluation of mitoxantrone and piroxicam in a canine model of human invasive urinary bladder carcinoma. Clinical Cancer Research 2003; 9: 906–911. 4. Choudhry Z, Rikani AA, Choudhry AM, Tariq S, Zakaria F, Asghar MW, et al. Sonic hedgehog signalling pathway: a complex network. Annals of Neurosciences 2014; 21: 28–31. 5. Lin TL and Matsui W. Hedgehog pathway as a drug target: smoothened inhibitors in development. Onco Targets Ther 2012; 5: 47–58. 6. Fu X, Yang X and Zhao L. Indian hedgehog, a neglected member of hedgehog pathway, may offer a novel avenue for colorectal cancer therapy. Cancer Biotherapy & Radiopharmaceuticals 2009; 24: 733–735. 7. Lai LP and Mitchell J. Indian hedgehog: its roles and regulation in endochondral bone development. Journal of Cellular Biochemistry 2005; 96: 1163–1173. 8. Ramalho-Santos M, Melton DA and McMahon AP. Hedgehog signals regulate multiple aspects of gastrointestinal development. Development 2000; 127: 2763–2772. 9. Maye P, Becker S, Kasameyer E, Byrd N and Grabel L. Indian hedgehog signaling in extraembryonic endoderm and ectoderm differentiation in ES embryoid bodies. Mechanisms of Development 2000; 94: 117–132. 10. Yun JI, Kim HR, Park H, Kim SK and Lee J. Small molecule inhibitors of the hedgehog signaling pathway for the treatment of cancer. Archives of Pharmacal Research 2012; 35: 1317–1333. 11. Fei DL, Sanchez-Mejias A, Wang Z, Flaveny C, Long J, Singh S, et al. Hedgehog signaling regulates bladder cancer growth and tumorigenicity. Cancer Research 2012; 72: 4449–4458. 12. He HC, Chen JH, Chen XB, Qin GQ, Cai C, Liang YX, et al. Expression of hedgehog pathway components is associated with bladder cancer progression and clinical outcome. Pathology and Oncology Research 2012; 18: 349–355. 13. Mechlin CW, Tanner MJ, Chen M, Buttyan R, Levin RM and Mian BM. Gli2 expression and human bladder transitional carcinoma cell invasiveness. Journal of Urology 2010; 184: 344–351. 14. Pignot G, Vieillefond A, Vacher S, Zerbib M, Debre B, Lidereau R, et al. Hedgehog pathway activation in human transitional cell carcinoma of the bladder. British Journal of Cancer 2012; 106: 1177–1186. 15. Dhawan D, Ramos-Vara JA, Stewart JC, Zheng R and Knapp DW. Canine invasive transitional cell carcinoma cell lines: in vitro tools to complement a
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
10
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
T. L. Gustafson et al.
relevant animal model of invasive urinary bladder cancer. Urologic Oncology 2009; 27: 284–292. O’Donoghue LE, Rivest JP and Duval DL. Polymerase chain reaction-based species verification and microsatellite analysis for canine cell line validation. Journal of Veterinary Diagnostic Investigation 2011; 23: 780–785. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry 2009; 55: 611–622. Fan L, Pepicelli CV, Dibble CC, Catbagan W, Zarycki JL, Laciak R, et al. Hedgehog signaling promotes prostate xenograft tumor growth. Endocrinology 2004; 145: 3961–3970. Kiesslich T, Mayr C, Wachter J, Bach D, Fuereder J, Wagner A, et al. Activated hedgehog pathway is a potential target for pharmacological intervention in biliary tract cancer. Mol Cell Biochem 2014; 396: 257–268. Samarzija I and Beard P. Hedgehog pathway regulators influence cervical cancer cell proliferation, survival and migration. Biochemical and Biophysical Research Communications 2012; 425: 64–69. Liu VWS, Chiu PM, Yao KM, Chan DW, Cheung ANY, Hui CC, et al. Study of hedgehog signaling in cervical cancer. AACR Meet Abstr 2005; 2005: 44-b. Sacedon R, Varas A, Hernandez-Lopez C, Gutierrez-deFrias C, Crompton T, Zapata AG, et al. Expression of hedgehog proteins in the human thymus. J Histochem Cytochem 2003; 51: 1557–1566. Outram SV, Hager-Theodorides AL, Shah DK, Rowbotham NJ, Drakopoulou E, Ross SE, et al. Indian hedgehog (Ihh) both promotes and restricts thymocyte differentiation. Blood 2009; 113: 2217–2228. Merchant AA and Matsui W. Targeting Hedgehog – a cancer stem cell pathway. Clinical Cancer Research 2010; 16: 3130–3140. Duman-Scheel M, Weng L, Xin S and Du W. Hedgehog regulates cell growth and proliferation by inducing Cyclin D and Cyclin E. Nature 2002; 417: 299–304.
26. Regl G, Kasper M, Schnidar H, Eichberger T, Neill GW, Philpott MP, et al. Activation of the BCL2 promoter in response to Hedgehog/GLI signal transduction is predominantly mediated by GLI2. Cancer Research 2004; 64: 7724–7731. 27. Saqui-Salces M and Merchant JL. Hedgehog signaling and gastrointestinal cancer. Biochimica et Biophysica Acta 1803; 2010: 786–795. 28. Ohta H, Aoyagi K, Fukaya M, Danjoh I, Ohta A, Isohata N, et al. Cross talk between hedgehog and epithelial-mesenchymal transition pathways in gastric pit cells and in diffuse-type gastric cancers. British Journal of Cancer 2009; 100: 389–398. 29. Kakanj P, Reuter K, Sequaris G, Wodtke C, Schettina P, Frances D, et al. Indian hedgehog controls proliferation and differentiation in skin tumorigenesis and protects against malignant progression. Cell Reports 2013; 4: 340–351. 30. Jager W, Thomas C, Fazli L, Hurtado-Coll A, Li E, Janssen C, et al. DHH is an independent prognosticator of oncologic outcome in clear cell renal cell carcinoma. Journal of Urology 2014; 192: 1842–1848. 31. Lo WW, Wunder JS, Dickson BC, Campbell V, McGovern K, Alman BA, et al. Involvement and targeted intervention of dysregulated Hedgehog signaling in osteosarcoma. Cancer 2014; 120: 537–547. 32. Haldipur P, Bharti U, Govindan S, Sarkar C, Iyengar S, Gressens P, et al. Expression of Sonic hedgehog during cell proliferation in the human cerebellum. Stem Cells and Development 2012; 21: 1059–1068. 33. Ioannides AS, Henderson DJ, Spitz L and Copp AJ. Role of Sonic hedgehog in the development of the trachea and oesophagus. Journal of Pediatric Surgery 2003; 38: 29–36. 34. Gonnissen A, Isebaert S and Haustermans K. Hedgehog signaling in prostate cancer and its therapeutic implication. International Journal of Molecular Sciences 2013; 14: 13979–14007. 35. Shi T, Mazumdar T, Devecchio J, Duan ZH, Agyeman A, Aziz M, et al. cDNA microarray gene expression profiling of hedgehog signaling pathway inhibition in human colon cancer cells. PLoS One 2010; 5: 1–23.
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
DOI: 10.1111/vco.12149
Hedgehog signaling is activated in canine transitional cell carcinoma and contributes to cell proliferation and survival T. L. Gustafson1 , B. E. Kitchell2 and B. Biller3 1
Colorado State University, Animal Cancer Center, Fort Collins, CO, USA VCA Veterinary Care Animal Hospital and Referral Center, Oncology, Albuquerque, NM, USA 3 Colorado State University, CVMBS-VTH, Animal Cancer Center, Fort Collins, CO, USA 2
Abstract
Keywords Hedgehog, transitional cell carcinoma
Transitional cell carcinoma (TCC) is the most commonly diagnosed tumor of the canine urinary system. Hedgehog (HH) signaling represents one possible novel therapeutic target, based on its recently identified central role in human urothelial carcinoma. The purpose of this study was to determine if HH mediators are expressed in canine TCC and the effect of inhibition of this pathway on cell growth and survival. HH pathway mediators were found to be expressed in five canine TCC cell lines. Indian HH was expressed in tumor cells in five canine bladder tumor tissues, but not in normal canine bladder tissue. Inhibition of HH signaling with cyclopamine and GANT61 led to significantly decreased cell proliferation but had a smaller effect on apoptosis. These results support future investigation of inhibitors of HH signaling in the treatment of canine TCC.
Introduction
Correspondence address: T. L. Gustafson Colorado State University Animal Cancer Center Fort Collins CO USA e-mail: [email protected]
Transitional cell carcinoma (TCC) of the urinary bladder is common in dogs, particularly in certain breeds such as the Scottish Terrier, West Highland White Terrier, Beagle and Shetland Sheepdog.1,2 Urothelial carcinoma is also the fifth most common form of cancer in humans in the USA, accounting for >54 000 new cancer cases in the USA each year.3 Naturally occurring bladder cancer in the dog very closely resembles invasive bladder cancer in humans.1 Therefore, similar molecular pathways of tumor pathogenesis may be present in both humans and dogs such that human advances can be exploited to benefit canine health and vice versa. Hedgehog (HH) proteins are key mediators of normal embryonic development.4 In humans, Sonic Hedgehog (SHH) promotes growth, patterning and morphogenesis of many tissues and organs. SHH signals through binding to Patched (PTCH), which in the absence of SHH, inhibits Smoothened (SMO). SMO regulates the effectors of HH signaling (glioma-associated oncogene homologue
© 2015 John Wiley & Sons Ltd
1–3, GLI1-3). In the presence of HH binding to PTCH, SMO releases GLI proteins, which activate transcription of downstream effectors and also increase expression of HH mediators, PTCH and GLI proteins.5 Indian hedgehog (IHH) is a lesser known HH family member which plays roles in endochondral bone development and gastrointestinal development.6 – 8 IHH is a master regulator of bone development and as such regulates parathyroid hormone-related peptide (PTHrP) and stimulation of chondrocyte proliferation.7 IHH is also critical for differentiation of visceral endoderm.9 Later in development, IHH appears to regulate the proliferation and differentiation of intestinal epithelial stem cells.8 In addition to a role in normal development, preclinical data suggests aberrant regulation of HH signaling in cancers of the skin, brain, lung, breast, prostate, pancreas, colon and bladder.5,10 In human urothelial carcinoma, HH signaling is required for tumorigenesis and tumor growth.11 – 13 This is
1
2 T. L. Gustafson et al.
illustrated by recent work that shows that transformed human urothelial cells and many urothelial carcinoma cell lines exhibit constitutive HH signaling.11 In addition, increased levels of SHH and its target genes, including GLI1, are found in up to 96% of human bladder tumors.14 Clinical relevance is showed by the correlation of SHH, PTCH1 and GLI1 expression with higher stage, presence of lymph node metastasis and shorter disease-free and overall survival durations.12 Importantly, the HH pathway represents a therapeutic target.5 Inhibition of HH signaling through the GLI inhibitor, GANT61, significantly reduces invasiveness of human bladder TCC lines.13 Cyclopamine, a naturally occurring inhibitor derived from the corn lily (Veratrum californicum), blocks the HH pathway through binding to SMO. The pharmacologic analog of cyclopamine, vismodegib, is used to treat basal cell carcinoma and medulloblastoma, which are cancers known to be driven by HH pathway mutations.5 In this study, we set out to determine if HH mediators are expressed in canine TCC and the effect of inhibition of this pathway on cell growth and survival. On the basis of similarity of advanced TCC in humans and dogs, we hypothesized that HH mediators would be expressed in canine TCC and that inhibition of HH signaling would lead to decreased cell proliferation or increased apoptosis. Our results suggest that HH signaling plays an important role in canine TCC and that inhibition of this pathway may represent a new treatment approach.
Materials and methods Cell line maintenance Canine (K9) TCC, K9TCC-In, K9TCC-AxA, K9TCC-Sh, and K9TCC-NK cell lines (provided by
Dr Knapp) were maintained in Dulbecco’s minimal essential medium supplemented with 10% fetal bovine serum. These cell lines were derived from individual treatment-naïve grade 2 or 3 invasive TCCs based on histopathology and have been previously characterized.15 All cell lines were validated for species and genetic identity using shorttandem-repeat profiling as previously described.16 All cells were maintained in 5% CO2 at 37 ∘ C.
RNA isolation and real time RT-PCR RNA was isolated using a Qiaquick RNeasy Mini kit with Qiashredder columns (Qiagen, Valencia, CA, USA). RNA was quantified by UV spectroscopy. One microgram RNA was reverse transcribed using qScript cDNA synthesis kit (Quanta Biosciences, Gaithersburg, MD, USA). cDNA was then used as template for SYBR Green quantitative PCR (Quanta Biosciences). Primers for real time PCR (Table 1) were validated with standard curves to calculate efficiency, based on previously reported methods.17 Standard curves are shown in Fig. S1, Supporting Information. Data was analyzed using the ΔΔCt method. Reactions were performed in triplicate. PCR products were verified for size by agarose gel electrophoresis. Hypoxanthine phosphoribosyltransferase 1 (HPRT1) and PTCH1 were sequenced using ABI BigDye Terminator v3.1 (Life Technologies, Grand Island, NY, USA) on an ABI 3130xL Genetic Analyzer (Life Technologies) to confirm identity. IHH, GLI1 and GLI2 PCR products were verified by restriction digestion (Fig. S2).
Western blot Protein was isolated using RIPA buffer [25 mM Tris–HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate
Table 1. Primers used for real time RT-PCR
Target gene IHH GLI1 GLI2 PTCH1 HPRT1
Forward primer
Reverse primer
Size of product (bp)
CTGGAAGGGATCTGAGTTGG CAGCAGCTGAACCTTATGGA GCCTCAAGAAAGTGGGAAGA TGTCTGTAATCCTTCATGGGC TGCTCGAGATGTGATGAAGG
GGTCAAGTTGCAATGGTGTG GGGTGGTTCAGGATAGGAGA TGGAGAAACAGGATTGGGTAAA AAAGAGATGCCTTGGACCTG TCCCCTGTTGACTGGTCATT
75 116 103 139 191
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
Hedgehog signaling in canine TCC
3
Figure 1. Expression of HH genes in five canine TCC cell lines. Variable expression of IHH, PTCH1, GLI1 and GLI2 was observed across the cell lines. RNA expression was evaluated by real time RT-PCR using HPRT1 as the internal standard. Bars represent the mean ΔΔCt ± SD of triplicate reactions.
(SDS)] with protease inhibitors added. Protein was quantified with the BCA Protein Assay kit (Pierce Biotechnology, Rockford, IL, USA) and absorbance was measured using a microplate reader at 570 nm. Equal amounts of protein were separated by SDS polyacrylamide gel electrophoresis, transferred to a polyvinylidene difluoride (PVDF) membrane, and hybridized to an appropriate primary antibody and a HRP-conjugated secondary antibody for subsequent detection by ECL using standard techniques. HeLa cell lysate (BD Biosciences, San Diego, CA, USA) was used as a positive control. Antibodies used were anti-IHH (1:1000, Abcam, Cambridge, MA, USA), anti-GAPDH (1:2000, Santa Cruz, Biotechnology, Dallas, TX, USA), and anti-rabbit secondary antibody (1:5000, Bio-Rad, Hercules, CA, USA).
Solution (Dako, Carpinteria, CA, USA, pH 6.0), blocked with Background Sniper (Biocare Medical, Concord, CA, USA) for 5 min at room temperature, and incubated with Anti-IHH (Abcam) antibody at 1:200 dilution (in Antibody Diluent, Dako) overnight at 4 ∘ C. A negative control section was incubated without primary antibody. Sections were then incubated with prediluted secondary antibody, horseradish peroxidase-conjugated anti-rabbit/mouse IgG (Envision and Dual Link System HRP, Dako), for 1 h at 4 ∘ C. Diaminobenzidine (DAB, Ventana Medical Systems, Tucson, AZ, USA) was used as a chromogen for immunoreactive complex detection. Sections were then counterstained with hematoxylin, dehydrated and mounted with Permount.
Cell proliferation assay Immunohistochemistry Formalin-fixed paraffin-embedded tumor sections (5 μm) were deparaffinized and rehydrated in xylene and graded ethanol baths. Sections were treated at 125 ∘ C for 1 min in Target Retrieval
Cells of the K9TCC and K9TCC-Sh lines were seeded at 1–2 × 106 cells mL−1 in 6-well plates. Cells were treated with equal volumes of either vehicle (ethanol), 10 𝜇M cyclopamine or 10 𝜇M GANT61, based on similar doses used in recent
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
4 T. L. Gustafson et al.
Figure 2. Expression of IHH in cell lines and canine bladder tumors.( A) Western blot for IHH in five TCC cell lines compared to GAPDH control. HeLa cell lysate was used as a positive control because of known IHH expression. (B) IHC for IHH in normal canine thymus, showing expression in thymocytes, and in normal canine bladder, showing lack of detection. (C) IHC for IHH in five canine bladder tumors. Clusters of cells representing the minority of tumor cells stained positively for IHH in bladder tumor sections examined. Boxes show portion of image at higher magnification.
human in vitro models to achieve signaling inhibition in bladder, prostate and biliary carcinoma cells.13,18,19 Cells were harvested at time points, 0, 48 and 96 h, and counted using a Cellometer Auto T4 cell counter (Nexcelom Bioscience, Lawrence, MA, USA). Viability was determined by Trypan blue (Life Technologies, Grand Island, NY, USA) staining. Each experiment was conducted in triplicate.
AlamarBlue assay Cells of the K9TCC and K9TCC-Sh cell lines were seeded at 2000 cells/well in 96 well plates. Cells were treated as before with equal volumes of either vehicle (ethanol), cyclopamine or GANT61. Final concentrations of cyclopamine and GANT61 ranged from 2.5 to 30 𝜇M. After 48 and 96 h, alamarBlue
(Life Technologies) was added and the cells were incubated for 1 h at 37 ∘ C. Fluorescence emission was measured at 590 nm. Five replicates of each treatment were performed.
Annexin V assay Cells of the K9TCC and K9TCC-Sh lines were seeded at 1–2 × 105 cells mL−1 in 25 cm2 flasks. Cells were treated with equal volumes of either vehicle (ethanol), 10 𝜇M cyclopamine or 10 𝜇M GANT61. Cells and supernatant were harvested by scraping after 48 or 96 h. Cells were washed with PBS and then stained with Annexin V-V450 (BD Biosciences) and propidium iodide (PI, BD Biosciences), according to manufacturer instructions. Cells were analyzed on a CyanADP flow cytometer (Dako). Annexin V (+) and PI (−) cells
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
Hedgehog signaling in canine TCC
were considered in early apoptosis; Annexin V (+) and PI (+) cells were considered in late apoptosis. Each assay was conducted in duplicate for each treatment.
Statistical analysis Results are reported as the mean ± standard deviation of replicates. Cell survival data were fitted to a non-linear regression model to determine the mean half maximum inhibitory concentration (IC50 ) for each cell line. The IC50 was defined as the drug concentration that caused 50% metabolic activity compared with the control. Statistical evaluation was performed using one-way analysis of variance (ANOVA) with a Tukey post-test. P < 0.05 was considered statistically significant.
5
lines. Normal canine thymus was used to validate the antibody for IHC, because IHH is normally expressed in thymocytes (Fig. 2B). Expression restricted to the epithelial population of the canine thymus was seen as expected.22,23 IHH expression was then evaluated in five canine TCC tissues. IHH was detected in all five tumors; however, expression was not uniform throughout the tumors. IHH was detected in clusters of cells within the tumors, representing a minority of the total tumor cell population (Fig. 2C). Average number of positive cells in tumor sections ranged from 10 to 37 cells per high power field, representing 5–25% of the total cells. IHH expression was not observed in the surrounding stroma or normal canine bladder urothelium.
Inhibition of HH signaling decreases cell proliferation and viability
Results HH expression in canine TCC To investigate whether HH mediators play a role in canine TCC, RNA expression was first evaluated in five previously characterized canine TCC cell lines (K9TCC, K9TCC-In, K9TCC-Sh, K9TCC-AxA and K9TCC-Nk) using real time RT-PCR. The HH pathway genes IHH, PTCH1, GLI1 and GLI2 were found to be expressed in the five canine TCC cell lines (Fig. 1). Attempts to amplify SHH from the cell lines revealed no product (data not shown). Four out of five cell lines expressed high levels of IHH. The K9TCC cell line expressed high levels of GLI1 but low levels of GLI2 compared to the other lines. Interestingly, the K9TCC-Sh cell line expressed relatively low levels of IHH yet high levels of PTCH1, GLI1 and GLI2. As expected, PTCH1 expression mirrored that of GLI2, consistent with the observation that PTCH1 is a downstream target of GLI transcription. To determine if the HH expression seen in vitro was also true in vivo, IHH protein expression was evaluated in five canine bladder tumors and normal bladder tissue through immunohistochemistry (IHC). Protein expression was first verified in the five TCC cell lines by Western blot, using HeLa cell extract as a positive control (Fig. 2A).20,21 The greatest protein expression was seen in the K9TCC cell line, but IHH was detectable in all five cell
On the basis of differential expression of IHH and GLI in the K9TCC and K9TCC-Sh cell lines, we then examined the effect of inhibition of HH signaling. Cells were treated with cyclopamine, an inhibitor of SMO, or GANT61, an inhibitor of GLI, used in recent in vitro models to achieve signaling inhibition and cytotoxicity in human bladder, prostate and biliary carcinoma cells.13,18,19 After treatment with either drug, expression of the downstream targets of HH signaling, GLI1, GLI2 and PTCH1, were significantly decreased in both cell lines (Fig. 3). In order to determine drug concentrations which inhibit proliferation in each cell line, cells were treated with increasing concentrations of cyclopamine and GANT61 for 48 or 96 h (Fig. 4A). Cell metabolic activity data were fitted to a nonlinear regression model in order to determine the IC50 for each cell line at each time point. Treatment with cyclopamine and GANT61 resulted in a dose- and time-dependent decrease in metabolic activity in both cell lines (Table 2). On the basis of these values, proliferation in the canine TCC cell lines was evaluated using a concentration of 10 𝜇M cyclopamine and 10 𝜇M GANT61 compared to vehicle-treated controls. Cell proliferation was significantly decreased after 96 h of treatment with cyclopamine and GANT61 in each cell line (Fig. 4B).
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
6 T. L. Gustafson et al.
Figure 3. Inhibition of HH signaling decreases expression of downstream targets. Expression of GLI1, GLI2 and PTCH1 in (A) K9TCC and (B) K9TCC-Sh cells after 96 h of treatment with cyclopamine 10 𝜇M or GANT61 10 𝜇M compared to vehicle-treated cells. RNA expression was evaluated by real time RT-PCR using HPRT1 as the internal standard. Bars represent the mean ΔΔCt ± SD of triplicate reactions. * indicates p < 0.05.
GANT61 increases apoptosis in K9TCC cells In addition to anti-proliferative effects, HH signaling may also activate growth factors and antiapoptotic factors in malignant cells.24 – 26 To determine the impact of HH inhibition on apoptosis in canine TCC, K9TCC and K9TCC-Sh cell lines were again treated with cyclopamine and GANT61 for 96 h. As shown in Fig. 5, treatment with GANT61 led to a significant increase in apoptosis in the K9TCC cell line. In K9TCC-Sh cells, however, an effect on apoptosis was not observed. Cyclopamine did not increase apoptosis in either cell line. Apoptosis was also evaluated after 48 h of drug treatment; however, no significant effect on apoptosis was present in either cell line (data not shown).
Discussion In this study we investigated the role of HH signaling in canine TCC. Although SHH could not be identified in any of the TCC cell lines, IHH was relatively abundant. IHH and Desert Hedgehog (DHH), along with SHH, have recently been suggested to have various roles in human cancers. Both IHH and SHH are highly expressed in human gastric cancer.27,28 DHH has prognostic value in clear cell renal cell carcinoma whereas IHH plays
a role in squamous cell carcinoma progression and metastasis.29,30 In human osteosarcoma cell lines, IHH has been found to be upregulated, and inhibition of signaling leads to decreased xenograft tumor size.31 HH gene expression is also known to vary in tissue specificity between species. For example, during development different patterns of expression of SHH are seen in the cerebellum between humans and mice,32 and SHH expression patterns differ between rats and mice during esophageal and tracheal development.33 Therefore, it is possible that IHH plays a predominant role in canine TCC, in contrast to the situation seen in urothelial carcinoma in humans, which is driven by SHH. To evaluate other genes in the HH pathway, we next examined expression of GLI1, GLI2 and PTCH1 in canine TCC cell lines. Different patterns of expression of HH mediators were exhibited in various cell lines. The K9TCC cell line displayed high levels of IHH and GLI1, but low GLI2 expression. The K9TCC-Sh cell line expressed high levels of PTCH1, GLI1 and GLI2, despite having low IHH expression. In human cancers, several mechanisms of HH pathway activation have been described, including ligand-dependent and ligand-independent means.5,34 In K9TCC cells, the high levels of IHH suggest that this ligand is important for signaling. However, in K9TCC-Sh
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
Hedgehog signaling in canine TCC
7
Figure 4. Inhibition of HH decreases cell proliferation. (A) Metabolic activity after 48 and 96 h of treatment with increasing concentrations of cyclopamine or GANT61 in K9TCC and K9TCC-Sh cell lines, assessed by alamarBlue assay. Bars represent the mean of five samples, and data are expressed as the mean ± SD. (B) Cell proliferation in K9TCC and K9TCC-Sh cells treated with 10 𝜇M cyclopamine, 10 𝜇M GANT61, or vehicle. Symbols represent the mean of triplicate samples, and data are expressed as the mean ± SD. * indicates p < 0.05.
cells there is perhaps a ligand-independent mechanism, such as PTCH1 mutation, driving expression of downstream targets. Further studies are needed to identify the presence and prevalence of PTCH1 mutations in canine TCC. Consistent with expression of IHH in canine TCC cell lines, IHH was also detectable in canine bladder tumor tissues. IHH protein was not found uniformly throughout the tumor tissues, however, but in small clusters representing 5–25% of the tumor cells. A minority of cells in these tumors appear to be involved in HH signaling, which may represent highly proliferating cells. The K9TCC cells, which express much greater levels of IHH, appeared more sensitive to cyclopamine based on a trend toward lower IC50
values compared to K9TCC-Sh cells. Inhibition of HH signaling with cyclopamine and GANT61 led to decreased cell proliferation in the K9TCC and K9TCC-Sh cell lines. This is expected based on the well-established role of HH in promoting proliferation during development and in several human cancers.4,7,10 HH signaling promotes proliferation rather than differentiation during development of the intestinal tract, brain and bone.7 In cancer models HH also upregulates cyclins, E2F and cyclin-dependent kinases.35 Further, inhibition of GLI slows progression through the G1/S checkpoint in human colon carcinoma cells, showing the direct role of HH signaling in proliferation.35 B-cell lymphoma-2 (BCL2) has also been shown to be a target of HH signaling through GLI2 in
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
8 T. L. Gustafson et al.
Figure 5. Apoptosis in K9TCC and K9TCC-Sh cells treated with HH inhibitors. (A) K9TCC and (B) K9TCC-Sh cells treated with 10 𝜇M cyclopamine or 10 𝜇M GANT61 for 96 h compared to vehicle-treated or untreated cells. Bars represent the mean of the sums of the percentages of Annexin V+/PI- and Annexin V+/PI+ cells. Data are expressed as the mean ± SD. * indicates p < 0.05. Table 2. IC50 values for K9TCC and K9TCC-Sh cell lines-treated with cyclopamine and GANT61 48 h Cell line + drug K9TCC + Cyclopamine K9TCC-Sh + Cyclopamine K9TCC + GANT61 K9TCC-Sh + GANT61
96 h
IC50 (95% CI)
R2
IC50 (95% CI)
R2
14 𝜇M (12–17) 19 𝜇M (16–22) 15 𝜇M (12–19) 13 𝜇M (9.7–19)
0.97 0.97 0.96 0.93
9.2 𝜇M (6.5–13) 13 𝜇M (10–16) 7.9 𝜇M (6.5–9.7) 8.0 𝜇M (5.7–11)
0.95 0.96 0.98 0.95
Cell metabolic activity data were fitted to a nonlinear regression model in order to determine the IC50 values for each cell line. 95% confidence interval is shown in parentheses. Correlation coefficients (R2 values) were evaluated to determine the goodness of fit of the derived values for each dose–response curve.
basal cell carcinoma.26 Therefore, HH could have a secondary role in preventing apoptosis in some cancers. Upon evaluation of apoptosis in the canine TCC cell lines, differential effects of the inhibitors were seen. A high background rate of apoptosis was also observed in both cell lines despite various harvesting methods and performing the assay at both the 48 and 96-h time points. This background may be due to a high sensitivity to anoikis in these cell lines. However, 96 h of treatment with GANT61 led to a modest but detectable increase in apoptosis in K9TCC cells whereas cyclopamine had no effect. Our findings are consistent with other studies in which differential effects of cyclopamine and GANT61 on proliferation and apoptosis have previously been reported in human biliary tract cancer.19 Together, these observations illustrate the potential need for a more personalized medicine
approach in dogs with certain cancers, targeting specific pathways utilized by tumor cells for survival, growth and metastasis. A limitation of this study is that the differential effects of cyclopamine and GANT61 on HH signaling in canine TCC may be the result of off target effects rather than being directly related to HH signaling mediators. Further experiments utilizing microarray analysis or RNA interference methodologies may help to elucidate any additional anti-tumor effects of these drugs. Another important limitation is that therapeutic use of cyclopamine is constrained by poor pharmacokinetic and physiochemical profiles as well as low potency.10 GANT61 has shown anti-neoplastic activity in vitro and in vivo, but has yet to be evaluated in human clinical trials.10 However, the SMO inhibitor vismodegib recently has been approved by the Food and Drug Administration for the treatment of metastatic and recurrent locally advanced
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
Hedgehog signaling in canine TCC
basal cell carcinoma and is currently being evaluated in a number of clinical studies.10 Our findings support further investigation of vismodegib and other HH inhibitors in canine TCC.
Acknowledgements The authors would like to thank Deborah Knapp for providing K9TCC cell lines, Brad Charles and EJ Ehrhart for assistance with immunohistochemistry techniques, Barbara Rose and Amanda Guth for their assistance with flow cytometry, and Dawn Duval for her assistance with real time RT-PCR and for cell line validation.
Supporting Information Additional Supporting Information may be found in the online version of this article: Figure S1. Efficiency calculations for real-time primers. Efficiency was calculated based on the slope of a standard curve generated by graphing Ct versus the log of the quantity of template cDNA. Serial dilutions of a mix of template cDNAs were used to add 1–100 ng template. Adequate efficiency to use ΔΔCt method analysis was judged to be between 90 and 110%. Figure S2. Restriction digests of IHH, GLI1 and GLI2 real time PCR products. IHH was digested with BccI (43 and 32 bp products) and BseRI (44 and 30 bp products). GLI2 was digested with ApaI (31 and 70 bp products) and XmaI (48 and 55 bp products). GLI1 was digested with BslI (70 and 46 bp products) and BstNI (21, 29 and 66 bp products). Expected bands were obtained with the two different digests for each product, verifying correct amplification.
References 1. Knapp DW, Glickman NW, Denicola DB, Bonney PL, Lin TL and Glickman LT. Naturally-occurring canine transitional cell carcinoma of the urinary bladder A relevant model of human invasive bladder cancer. Urologic Oncology 2000; 5: 47–59. 2. Glickman LT, Raghavan M, Knapp DW, Bonney PL and Dawson MH. Herbicide exposure and the risk of transitional cell carcinoma of the urinary bladder in Scottish Terriers. Journal of the American Veterinary Medical Association 2004; 224: 1290–1297.
9
3. Henry CJ, McCaw DL, Turnquist SE, Tyler JW, Bravo L, Sheafor S, et al. Clinical evaluation of mitoxantrone and piroxicam in a canine model of human invasive urinary bladder carcinoma. Clinical Cancer Research 2003; 9: 906–911. 4. Choudhry Z, Rikani AA, Choudhry AM, Tariq S, Zakaria F, Asghar MW, et al. Sonic hedgehog signalling pathway: a complex network. Annals of Neurosciences 2014; 21: 28–31. 5. Lin TL and Matsui W. Hedgehog pathway as a drug target: smoothened inhibitors in development. Onco Targets Ther 2012; 5: 47–58. 6. Fu X, Yang X and Zhao L. Indian hedgehog, a neglected member of hedgehog pathway, may offer a novel avenue for colorectal cancer therapy. Cancer Biotherapy & Radiopharmaceuticals 2009; 24: 733–735. 7. Lai LP and Mitchell J. Indian hedgehog: its roles and regulation in endochondral bone development. Journal of Cellular Biochemistry 2005; 96: 1163–1173. 8. Ramalho-Santos M, Melton DA and McMahon AP. Hedgehog signals regulate multiple aspects of gastrointestinal development. Development 2000; 127: 2763–2772. 9. Maye P, Becker S, Kasameyer E, Byrd N and Grabel L. Indian hedgehog signaling in extraembryonic endoderm and ectoderm differentiation in ES embryoid bodies. Mechanisms of Development 2000; 94: 117–132. 10. Yun JI, Kim HR, Park H, Kim SK and Lee J. Small molecule inhibitors of the hedgehog signaling pathway for the treatment of cancer. Archives of Pharmacal Research 2012; 35: 1317–1333. 11. Fei DL, Sanchez-Mejias A, Wang Z, Flaveny C, Long J, Singh S, et al. Hedgehog signaling regulates bladder cancer growth and tumorigenicity. Cancer Research 2012; 72: 4449–4458. 12. He HC, Chen JH, Chen XB, Qin GQ, Cai C, Liang YX, et al. Expression of hedgehog pathway components is associated with bladder cancer progression and clinical outcome. Pathology and Oncology Research 2012; 18: 349–355. 13. Mechlin CW, Tanner MJ, Chen M, Buttyan R, Levin RM and Mian BM. Gli2 expression and human bladder transitional carcinoma cell invasiveness. Journal of Urology 2010; 184: 344–351. 14. Pignot G, Vieillefond A, Vacher S, Zerbib M, Debre B, Lidereau R, et al. Hedgehog pathway activation in human transitional cell carcinoma of the bladder. British Journal of Cancer 2012; 106: 1177–1186. 15. Dhawan D, Ramos-Vara JA, Stewart JC, Zheng R and Knapp DW. Canine invasive transitional cell carcinoma cell lines: in vitro tools to complement a
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
10
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
T. L. Gustafson et al.
relevant animal model of invasive urinary bladder cancer. Urologic Oncology 2009; 27: 284–292. O’Donoghue LE, Rivest JP and Duval DL. Polymerase chain reaction-based species verification and microsatellite analysis for canine cell line validation. Journal of Veterinary Diagnostic Investigation 2011; 23: 780–785. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry 2009; 55: 611–622. Fan L, Pepicelli CV, Dibble CC, Catbagan W, Zarycki JL, Laciak R, et al. Hedgehog signaling promotes prostate xenograft tumor growth. Endocrinology 2004; 145: 3961–3970. Kiesslich T, Mayr C, Wachter J, Bach D, Fuereder J, Wagner A, et al. Activated hedgehog pathway is a potential target for pharmacological intervention in biliary tract cancer. Mol Cell Biochem 2014; 396: 257–268. Samarzija I and Beard P. Hedgehog pathway regulators influence cervical cancer cell proliferation, survival and migration. Biochemical and Biophysical Research Communications 2012; 425: 64–69. Liu VWS, Chiu PM, Yao KM, Chan DW, Cheung ANY, Hui CC, et al. Study of hedgehog signaling in cervical cancer. AACR Meet Abstr 2005; 2005: 44-b. Sacedon R, Varas A, Hernandez-Lopez C, Gutierrez-deFrias C, Crompton T, Zapata AG, et al. Expression of hedgehog proteins in the human thymus. J Histochem Cytochem 2003; 51: 1557–1566. Outram SV, Hager-Theodorides AL, Shah DK, Rowbotham NJ, Drakopoulou E, Ross SE, et al. Indian hedgehog (Ihh) both promotes and restricts thymocyte differentiation. Blood 2009; 113: 2217–2228. Merchant AA and Matsui W. Targeting Hedgehog – a cancer stem cell pathway. Clinical Cancer Research 2010; 16: 3130–3140. Duman-Scheel M, Weng L, Xin S and Du W. Hedgehog regulates cell growth and proliferation by inducing Cyclin D and Cyclin E. Nature 2002; 417: 299–304.
26. Regl G, Kasper M, Schnidar H, Eichberger T, Neill GW, Philpott MP, et al. Activation of the BCL2 promoter in response to Hedgehog/GLI signal transduction is predominantly mediated by GLI2. Cancer Research 2004; 64: 7724–7731. 27. Saqui-Salces M and Merchant JL. Hedgehog signaling and gastrointestinal cancer. Biochimica et Biophysica Acta 1803; 2010: 786–795. 28. Ohta H, Aoyagi K, Fukaya M, Danjoh I, Ohta A, Isohata N, et al. Cross talk between hedgehog and epithelial-mesenchymal transition pathways in gastric pit cells and in diffuse-type gastric cancers. British Journal of Cancer 2009; 100: 389–398. 29. Kakanj P, Reuter K, Sequaris G, Wodtke C, Schettina P, Frances D, et al. Indian hedgehog controls proliferation and differentiation in skin tumorigenesis and protects against malignant progression. Cell Reports 2013; 4: 340–351. 30. Jager W, Thomas C, Fazli L, Hurtado-Coll A, Li E, Janssen C, et al. DHH is an independent prognosticator of oncologic outcome in clear cell renal cell carcinoma. Journal of Urology 2014; 192: 1842–1848. 31. Lo WW, Wunder JS, Dickson BC, Campbell V, McGovern K, Alman BA, et al. Involvement and targeted intervention of dysregulated Hedgehog signaling in osteosarcoma. Cancer 2014; 120: 537–547. 32. Haldipur P, Bharti U, Govindan S, Sarkar C, Iyengar S, Gressens P, et al. Expression of Sonic hedgehog during cell proliferation in the human cerebellum. Stem Cells and Development 2012; 21: 1059–1068. 33. Ioannides AS, Henderson DJ, Spitz L and Copp AJ. Role of Sonic hedgehog in the development of the trachea and oesophagus. Journal of Pediatric Surgery 2003; 38: 29–36. 34. Gonnissen A, Isebaert S and Haustermans K. Hedgehog signaling in prostate cancer and its therapeutic implication. International Journal of Molecular Sciences 2013; 14: 13979–14007. 35. Shi T, Mazumdar T, Devecchio J, Duan ZH, Agyeman A, Aziz M, et al. cDNA microarray gene expression profiling of hedgehog signaling pathway inhibition in human colon cancer cells. PLoS One 2010; 5: 1–23.
© 2015 John Wiley & Sons Ltd, Veterinary and Comparative Oncology, doi: 10.1111/vco.12149
