Cell Biology International ISSN 1065-6995 doi: 10.1002/cbin.10227
RESEARCH ARTICLE
Hedgehog signalling is dispensable in the proliferation of stem cells from human exfoliated deciduous teeth Fatemeh Ejeian1, Hossein Baharvand2,3* and Mohammad Hossein Nasr-Esfahani1* 1 Department of Cellular Biotechnology at Cell Science Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran 2 Department of Stem Cells and Developmental Biology at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran 3 Department of Developmental Biology, University of Science and Culture, ACECR, Tehran, Iran
Abstract The hedgehog (Hh) signalling pathway is one of the key regulators in development with a dual role in cell fate specification, proliferation, and survival on different target cells. We have investigated the effect of recombinant sonic hedgehog (r-SHH) on extracted multipotent stem cells from human exfoliated deciduous teeth (SHED), which represent a potential stem cell population for therapeutic applications. Cell proliferation and cycle assays shown that r-SHH did not have a distinctive effect on cell cycle progression, nor did it increase cell number over a wide range of concentrations. Quantitative polymerase chain reaction (Q-PCR) also suggests that r-SHH treatment has no demonstrable influence on expression of proliferative genes (CCNE1 and KI67); in contrast, the anti-proliferative gene (CDKN1A) is overexpressed in response to SHH. Our findings have suggested the possibility that SHEDs demonstrate a different potential from human bone marrow mesenchymal stem cells (h-BMSCs) and dorsal neural progenitor in response to growth factors such as SHH. Keywords: neural progenitor; proliferation; SHED; sonic hedgehog
Introduction The hedgehog (Hh) gene family encodes highly conserved secreted signalling proteins characterised as critical regulators of growth, patterning and cell-fate determination during embryogenesis in several model systems (Fietz et al., 1994; Ingham and McMahon, 2001; Varjosalo et al., 2006; Rohatgi and Scott, 2007; Varjosalo and Taipale, 2008). Due to its vital roles, many of the key components of Hedgehog signalling pathway is evolutionary conserved in vertebrates (Varjosalo et al., 2006; Varjosalo and Taipale, 2008). Since their isolation in the early 1990s, diverse functions of hedgehog proteins in different target cells have been reported, and have raised numerous questions regarding their mode of operation. The ventrally secreted signalling molecule, sonic hedgehog (shh), is involved in different aspects of the development of the early CNS, working in opposition to the dorsally expressed bone morphogenetic proteins (BMPs) in patterning the early neural plate and neural tube (Echelard et al., 1993). Shh has a central role in the specification of five neuronal subtypes in ventral neural tube, termed V0, V1,
V2, V3 interneurons, and motor neurons (MNs); and nonneuronal floor plate (FP). These domains emerge progressively, in which higher concentrations and longer exposure to shh leads to more ventral fate (Dahmane et al., 2001; Ribes et al., 2010). At a later stage, shh has a strong effect in the development of the cerebellum by promoting proliferation of granule neuron precursors (GNPs) (Wechsler-Reya and Scott, 1999), to the extent that some investigators has envisaged a function for shh in brain tumour initiation from precursor cells. This pathway mainly regulates proliferation of dorsal brain progenitors during embryogenesis and also causes a dosedependent proliferative response in adult neural progenitors (Lai et al., 2002; Fuccillo et al., 2006). Substantial evidence also implicates shh as an essential factor in neural stem cell maintenance (Beachy et al., 2004; Ahn and Joyner, 2005; Balordi and Fishell, 2007). Shh signal transduction pathway serves to maintain dividing neural progenitors, without sharing common targets with any other general mitogenic pathways. It appears that shh upregulates the cyclin-retinoblastoma (RB) axis and
Corresponding author: e-mail: [email protected] (M.H.N.-E), [email protected] (H.B.)
480
Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
F. Ejeian et al.
promotes synthesis of intermediate proteins that accelerate G1 progression. In contrast to serum-derived factors that can recruit quiescent cells into the cell cycle following growth arrest as well as stimulating proliferation in growing cells, the former role has not been so far envisaged or proven for SHH (Kenney and Rowitch, 2000). Upon Hh binding, cells that respond to SHH upregulate the expression of the zinc-finger transcription factor GLI1, as a result of relieved Patched-mediated inhibition of Smoothened activity. Several studies have claimed that increased levels of activated protein kinase A (PKA) have antimitogenic and pro-differentiation effects on numerous cell types and can interfere with Shh-stimulated mitogenic signalling (Cai et al., 1999; Gagelin et al., 1999; Wallace, 1999). Mesenchymal stem cells (MSCs) have great appeal for tissue engineering and therapeutic applications because of their capacity for self-renewal and multilineage differentiation potential. Among many other MSC-like populations residing in specialised tissues, such as dental pulp stem cells (DPSCs) and human bone marrow mesenchymal stem cells (h-BMSCs), stem cells from human exfoliated deciduous teeth (SHED) show a significantly higher proliferation rate and potential for differentiation into many functional cell types (Miura et al., 2003; Papaccio et al., 2006; Nakamura et al., 2009; Chadipiralla et al., 2010; Sakai et al., 2010). Dental pulp tissue is probably derived from migrating cranial neuralcrest cells during development, as well as other skeletal and connective tissues of the head and neck (Chai et al., 2000). SHEDs are a heterogeneous population that co-express embryonic stem (ES) cells (Oct4, Nanog) and neural progenitor markers (Nestin, b-TubIII and GFAP), which may be related to the neural-crest cell origin of dental pulp. They also possess a greater propensity for neuronal differentiation under defined inductive conditions compared to other MSCs (Chai et al., 2000; Nosrat et al., 2001; Gronthos et al., 2002; Miura et al., 2003; Abbas and Sharpe, 2008; Nourbakhsh et al., 2011). This neurogenic potential of SHED cells, besides their accessibility, makes them a valuable source in neural regeneration. While the proliferative effects of shh on neural stem and progenitor cells have been extensively studied, the connection between hedgehog signalling and dental stem cells, as a cranial neural-crest-derived population, remains a unknown. We have investigated the potential role of r-SHH in regulating the proliferation of extracted SHEDs, and sought to determine its influence on neural differentiation. Since sonic hedgehog acts directly on cell cycle progression, we also investigated the SHED cell cycle distribution following exposure to r-SHH. The hedgehog pathway may have an important function during growth, patterning, and morphogenesis of vertebrates and insects. Although Hh signalling is well studied during Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
r-shh have no proliferative effect on SHEDs
embryo development, its connection with stem cells in the adult body is less well understood. Based on various responses of cells with different origins to Hedgehog signalling and considering the neural-crest origin of dental-derived stem cells, as neural like precursor cells, we have looked at the potential proliferative effect of r-SHH on SHEDs. Materials and methods
Cells and culture conditions SHEDs were prepared and characterised as previously described (Nourbakhsh et al., 2011). In brief, exfoliated deciduous incisor were obtained from patients, who were 7–8 years old and female. Extracted pulps were minced and digested in a solution of collagenase type I containing 5% fetal calf serum (FCS) for 1 h at 378C. Single-cell suspensions were obtained by passing the cells through a 70 mm strainer. SHEDs were grown in Dulbecco’s modified eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin–glutamine (Gibco). The cells were subcultured every 5 days and all experiments were conducted with cells between passages 10–15, based on the characterisation of the cells as before (Nourbakhsh et al., 2011). H-BMSCs were isolated and cultured in a-MEM medium that contained 10% FBS, 1% L-glutamine, 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco), at a temperature of 378C and air with 5% CO2. The Hh protein used in the current studies was a bacterially overexpressed amino-terminal human SHH that showed comparable potency to native SHH in the cell-based reporter assay (data not shown).
In vitro proliferative assay SHED proliferation was assessed using MTS-based assay at different serum concentrations (0–10%) over 2, 4, 6 and 8 days of growth under normal conditions (without treatment). We cultured the cells at 1,000 cells per well (on the basis of their growth rate) in 200 mL of medium in a 96-well plate. To test whether SHH showed a significant effect on cellular proliferation of SHEDs, after 24 h culture, the medium was replaced with complete and serum-reduced media in the presence of increasing concentrations of r-SHH (0, 0.1, 1, 5 and 10 mg/mL). Cells were incubated for 2, 3 and 6 days. Finally a cell proliferation assay was used by adding 20 mL MTS/PMS solution (Promega) in 100 mL serum-free medium and incubating the plates in the dark for 4 h at 378C. Absorbance was read at 450 nm with an ELISA reader (Awareness model). Data were normalised to cell-free controls with the same MTS/PMS concentration as samples. 481
F. Ejeian et al.
r-shh have no proliferative effect on SHEDs
Darzynkiewicz, 2004). PI fluorescence was determined using a FACSCalibur cytometer (Becton Dickinson, San Jose, CA, USA). ModFit LT 3.0 program software was used to quantify cell cycle phase distribution. A minimum of 50,000 events was collected per sample at a flow rate of 100 events per second. Prior to the experimental treatments, cells were allowed to rest for 1 h by incubation in DMEM without mitogens to allow the downregulation of serum-stimulated intracellular signalling pathways.
RNA isolation and quantitative polymerase chain reaction (Q-PCR) analysis After overnight culture in serum-containing medium, SHEDs were treated for 4, 8, 16, 24 and 48 h in the presence of 0.5% or 10% FBS with or without r-SHH. Quantitative polymerase chain reaction (Q-PCR) was used to measure the expression of a number of genes related to the Hh pathway, proliferation or neural differentiation at each time-point. Oligonucleotide primers were designed using Beacon Designer 7 software, their sequences being given in Table 1. For all the required samples, total RNA was isolated using an RNeasy Mini Kit (Qiagen). Isolated RNAs were pretreated with DNaseI (Fermentas), allowing the selective removal of genomic DNA. cDNA was synthesised from 1 mg RNA using the RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas) and random hexamer primers. Q-PCR was performed using SYBR Premix Ex Taq II (TaKaRa) on an ABI Step One Real-Time PCR System (Applied Biosystems, Foster City, CA), applying a 3-step standard protocol with the annealing temperatures given in Table 1. Melting curve analysis was used to confirm the specificity of product amplifications. Relative quantification of transcript expression was estimated using the 2DDCt method. GAPDH housekeeping gene was used to normalise the data.
Statistical analyses All experiments were performed at least in triplicate and histograms are presented as means SEM. Analysis of variance was used with a significance of a ¼ 0.05 for data processing. Statistical significance was determined by one-way analysis (ANOVA) followed by the Tukey post-hoc test with the SPSS statistical software (version 16; SPSS, Inc., Chicago, IL). Results
Recombinant Sonic hedgehog (r-SHH) dose-dependently induces proliferation of human bone marrow mesenchymal stem cells (h-BMSCs) h-BMSCs initially proliferate in response to Hh stimulation (Warzecha et al., 2006; Cai et al., 2012). To verify the function of r-SHH, cellular DNA content and analysis of the cell cycle by flow cytometry were used to investigate the proliferative effect of SHH on h-BMSCs. After 24 h of culture in the presence of 1 and 5 mg/mL r-SHH, 3.13 and 6.76% of the cells moved into the S/G2/M (division phase), respectively (Figure 1a).
Flow cytometry for cell cycle analysis To analyse the cell cycle position of r-SHH or vehicle-treated cells, cells were collected and fixed in 70% ethanol. They were stained the cells with propidium iodide (10 mg/mL; PI) (Gagelin et al., 1999) in the presence of 100 mg/mL DNase-free RNase and 0.1% (v/v) Triton X-100 (Pozarowski and Table 1 Primer pair sequences, used for Q-PCR. Genes
Primer sequence (50 !30 )
GLI1
F: CCAACTCCACAGGCATACAG R: TCATACACAGATTCAGGCTCAC F: TGGAGAGGCGGCTAAGGTGT R: CCGCTGTTGCTGGTGTAGAC‘ F: CAGAGCGGTAAGAAGCAGAG R: GCAACAGACAGAAGAGAACG F: CTGTTATTGATGAGCCTGTA R: GTTGACTTCCTTCCATTCTG F: AGCGACCTTCCTCATCCAC R: GCCTCTACTGCCACCATCTT F: AGCAAACAGGTGAATGG R: TGAACGACGGGATAACA F: AAGATTCTTTGCCGCTACCA R: CACAGTGCTTCGGTCACAGT F: CGATATTGTCAGCCGTCTTCTAA R: TGCCACCAGTTGTCAGAA F: CGACTCATCTTTCCTTCTCTAA R: CGCACTTACCTCATCATTG
HES1 CCNE1 (CYCLINE E1) KI67 CNKN1A (P21) ATOH1 PAX7 NKX2.2 OLIG2
482
Annealing temp. (8C)
Accession no.
64
NM_001167609.1
62
NM_005524.2
58
NM_001238.2
58
NM_002417.4
58
NM_001220778.1
56
NM_005172.1
62
NM_002584
60
NM_002509
60
NM_005806
Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
F. Ejeian et al.
r-shh have no proliferative effect on SHEDs
cell cycle distribution (%)
100 13.34 2.02 80
15.61
17.42
2.83
4.31
60
G2/M phase S phase
40
84.52
77.76
81.39
G1/G0 phase
Absorbance (450 nm)
A
120
2.5
Normal Growth
- FBS
2
+ 0.5% FBS
1.5
+10% FBS
1 0.5
20
0 0 0
1
day 2
5
day 3
shh concentration (µg/ml)
The normal growth pattern of SHEDs by followed with the standard MTS assay at different time-points and different concentrations of FBS. The cells grew exponentially during the first 6 days of culture in complete and serum-reduced media (Figure 2A). However, as expected, prolonged culture in serum-deprived medium impaired their ability to survive and proliferate. Hence, further experiments were undertaken during the first 6 days of culture.
Sonic hedgehog (SHH) did not act as a mitogen for stem cells from human exfoliated deciduous teeth (SHED)
Absorbance (450 nm)
Growth characteristics
B
day 8
2
day 2
0.5% FBS
day 3 1.5 day 6 1
*
0.5
*
0 0
C Absorbance (450 nm)
Figure 1 Effect of sonic hedgehog (r-SHH) on human bone marrow mesenchymal stem cells (h-BMSCs) proliferation and cell cycle distribution. Propidium iodide (PI) staining and flow cytometry were used to determine h-BMSCs cell cycle distribution after 24 h treatment with increasing concentrations of SHH in reduced serum-containing medium [0.5% FBS].
day 6
Days of cultivation
2
0.1 1 5 shh concentration (µg/ml)
10
day 2
10% FBS
day 3 1.5 day 6
*
1
0.5
0
The effect of r-SHH on SHEDs proliferation by exposing cells to increasing concentrations of r-SHH (0.1, 1, 5 and 10 mg/ mL) for 2, 3 and 6 days in DMEM medium that contained 10% serum was examined. Viability in comparison of the treated and untreated cells on days 2, 3 and 6 showed that rSHH had no significant effect on proliferation in the presence of serum, even at the 5 mg/mL concentration (P < 0.05, Figure 2C). A moderate increase in cell viability was observed after 3 days of culture in 10 mg/mL r-SHH. Medium supplemented with a lower level of serum (0.5%) also showed a similar response to r-SHH treatment (Figure 2B).
Activation of sonic hedgehog (shh) pathway in stem cells from human exfoliated deciduous teeth (SHEDs) in response to r-SHH treatment The expression patterns of the GLI1 and HES1 genes, as two direct target genes of the shh pathway at 4, 8, 16, 24 and 48 h after treatment, were studied. In response to r-SHH, GLI1 Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
0
0.1 1 5 shh concentration (µg/ml)
10
Figure 2 Effect of different concentrations of recombinant sonic hedgehog (r-SHH) on proliferation of stem cells from human exfoliated deciduous teeth (SHEDs). (A) Cells were plated in 96-well plates (1,000 cells/well) and their normal growth at various serum concentrations were assessed during 8 days. (B) Cells were treated with increasing concentrations of r-SHH for 2, 3 and 6 days in the presence of 0.5% fetal bovine serum (FBS), and (C) in normal culture conditions (10% FBS). MTS assays were performed for determination of total viable cells. Values are presented as mean SD of three independent experiments; Significant difference from control (0 mg/mL r-SHH) at P < 0.05.
expression was significantly and markedly upregulated after 4 and 16 h, despite downregulation after 8 h (Figure 3D). Serum reduction resulted in a similar, but insignificant, pattern of expression. However, the opposite expression pattern was observed with HES1, which increased after 8 h, particularly notable in 0.5% serum-containing medium 483
F. Ejeian et al.
B
CCNE1
50
20 15 10
bdeg
30 20 10 0
0 control
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
abcde
3
HES1 2.5
e
b
2
control
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
4h
c
1.5
8h
a 1
d
Relative Fold Expression
acef
40
g
0.5
GLI1
50
f
gj
fi
de
1
60
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
cd
2
kl
D
ab
ejl bf
cg
dhk
a hi
2.5
abc
Relative Fold Expression
CDKN1A
3
control
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
Relative Fold Expression
control
E
k l
0
0
1.5
j
5
cel
25
i
0.2
30
adegh
0.4
35
g h
0.6
40
abc
a bd
ce
0.8
Relative Fold Expression
de
1
C 3.5
KI67
45
1.2
a bc
Relative Fold Expression
A 1.4
bdfij
r-shh have no proliferative effect on SHEDs
16 h
0.5
0 control
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
Figure 3 Real-time PCR analysis of proliferation-related genes (A) CCNE1, (B) Ki67, and (C) CDKN1A as an anti-proliferative gene, as well as shh pathway target genes (D) Gli1 and (E) Hes1. Gene expressions were assessed after 4, 8 and 16 h of treatment with or without 100 ng/mL sonic hedgehog (r-SHH) in 10% FBS and reduced serum medium (0.5% FBS). Data were normalised to gene expression in the normal culture condition (DMEM þ 10% FBS), as the control. Values are presented as mean SD of 3 independent experiments. Bars with common letters were significantly different using the least significant difference (P ¼ 0.05).
(Figure 3E). Thus activation of the Hedgehog pathway occurred in response to administration of r-SHH protein under these culture conditions.
Hh signalling did not influence expression of proliferative genes in stem cells from human exfoliated deciduous teeth (SHEDs) Expression of CCNE1 and KI67, as markers of proliferative activity, remained significantly unchanged in response to r-SHH treatment compared with the controls (Figures 3A and 3B), whereas the expression of GLI1 increased in the treated cells. However, cyclin E1 (CCNE1) was expressed at 484
lower levels in serum-reduced medium, both with and without r-SHH treatment (Figure 3A). KI67 showed a transient expression 4 h after treatment with r-SHH (Figure 3B). To corroborate these results, we examined the expression of CDKN1A (P21), as a proliferation inhibitor, in response to rSHH. Figure 3C shows a gene expression profile that resembles the expression pattern of GLI1, which significantly increased after 4 and 16 h and displayed cyclic gene expression. There was no significant differences in expression of these genes comparing untreated controls to cells exposed to r-SHH for 24 and 48 h (data not shown). Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
F. Ejeian et al.
Cell Cycle Distribution (%)
To examine the possible role of Hh pathway in inducing neuronal differentiation in SHEDs, we assayed four transcription factors, ATOH1, PAX7, MNR2 and NKX2.2, whose expressions are differentially sensitive to the SHH protein in response to r-SHH at the mentioned time-points. There was no detectable change in expression of these genes in either untreated or treated cells; however, significant expression was observed in the positive controls (data not shown).
A
Discussion The hedgehog pathway does not have a distinct proliferative effect on MSC-like SHEDs, which was adopted as a progenitor population originating from neural-crest cells (Abbas and Sharpe, 2008; Nourbakhsh et al., 2011). These findings were not contradictory to other investigations, indicating that SHH, as a major mitogen, acts on a variety of neural progenitor and stem cells (Lai et al., 2002). As proof of principle for the efficiency of the recombinant protein used in this study, our findings have confirmed previous observations that r-SHH dose-dependently induces strong proliferation of h-BMSCs (Warzecha et al., 2006; Cai et al., 2012). The results have shown that, along with increased SHH concentrations, there was no significant effect on the growth rate of SHED Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
24h treatment
100 80
12.3
12.3
16.17
16
71.03
70.9
3.98 3.17
4.23 2.35
92.84
93.42
60 40 20
10% FBS -shh
B
Hh signalling does not alter cell cycle distribution of stem cells from human exfoliated deciduous teeth (SHED) cells
120
10% FBS +shh
0.5% FBS -shh
0.5% FBS +shh
48h treatment
100
3.6 2.2
3.88 2.3
2.4 0.99
93.83
96.6
2.3 0.8
80 60 94.19
96.905
40 20 0 10% FBS -shh
C
10% FBS +shh
0.5% FBS -shh
0.5% FBS +shh
120 100
Cell Cycle Distribution (%)
Flow cytometric analysis of PI fluorescence was used to identify the effect of SHH on the cell cycle phase distribution of SHEDs at 24 (Figure 4A) and 48 h (Figure 4B). No significance differences were found at 24 and 48 h in the proportion of cells cultured in complete medium in G0/G1 and S/G2/M (division phase) between r-SHH treated and untreated cells. In assessing the effect of r-SHH under reduced serum conditions (0.5% FBS) in cultured cells, replacement of 10% serum with 1 mg of the biologically active N-terminal fragment of SHH per mL resulted in a cell cycle distribution similar to that obtained with the vehicle alone after 24 and 48 h (Figures 4A and 4B), however the division phase significantly decreased as a result of serum reduction irrespective of r-SHH treatment. To determine whether the Hh agonist could elicit this response, we exposed cells to increasing concentrations of Smoothened Agonist (SAG). Cell cycle analysis showed that SHEDs responded identically to different concentrations of SAG as to r-SHH (Figure 4C).
120
0
Cell Cycle Distribution (%)
Sonic hedgehog (SHH) did not move stem cells from human exfoliated deciduous teeth (SHEDs) toward neural differentiation in the short-term
r-shh have no proliferative effect on SHEDs
3.9 4.4
2.5 5.5
6 4.98
2.9 6.6
5.1 6
80
G2/M phase
60
S phase
40
89
91.8
92
88.9
90.4
G1/G0 phase
20 0 0
10
100
200
500
SAG concentration (nM)
Figure 4 Analysis of SHEDs cell cycle distribution in response to activation of shh pathway. (A) PI staining and flow cytometry were used to determine SHEDs cell cycle distribution after either 24 (B) or 48 h of treatment in the presence or absence of 1 mg/mL in normal growth medium that contained 10% fetal bovine serum (FBS) and reduced serum medium (0.5% FBS). (C) Cells were also exposed to increasing concentrations of Smoothened Agonist (SAG) for 24 h and their cell cycle distribution was evaluated by PI staining. Values are presented as mean SD of three independent experiments.
cells except for a mild increase with 10 mg/mL of r-SHH. This was a mild increment for a very high level of SHH, regarding the concentrations used by different researchers (Wilson and Maden, 2005). Therefore, our data suggest that SHH cannot induce proliferation of SHEDs. This observation was supported by cell cycle analysis, which showed that SHH treatment, in addition to exposing the cells to SAG, did not result in any significant change in the proportion of cells within the division phase. These studies are disparate with regard to the previously reported mitogenic effects of SHH on granule neural progenitors and some types of MSCs (Fu et al., 2004; Warzecha et al., 2006; Cai et al., 2012). However, MSCs isolated from various organs have distinctive intrinsic program and therefore respond differently to environmental signals (Jeong et al., 2004; Dupin and Sommer, 2012). 485
F. Ejeian et al.
r-shh have no proliferative effect on SHEDs
Further complications for comparative analysis of various investigations arise when MSCs are obtained from donors of different age and sex, and they are also influenced by different extraction and cultivation methods. While there is some conflicting evidence, most findings show a significant decrease in the proliferation and differentiation potential of MSCs with increasing age (Baxter et al., 2004; Stolzing et al., 2008). Another has also shown a sex-related effect on the osteogenic differentiation capacity of dental stem cells, which may be a case of different estrogen levels (Wang et al., 2013). Indeed, such a variety of responses to shh can be explained by differences in MSC’s intrinsic program, like genetic and epigenetic variations, and their extrinsic conditions, for example, culture media and substrates. This field of study should open new avenues in our understanding of the complexities of these cells and their environmental interactions. One major challenge of this study is that r-SHH induced molecular profile did not increase the expression of cell cycle progressing genes (CCNE1 and KI67); however, it showed a significant upregulation of a known post-mitotic gene (CDKNA1), apart from transient expression of KI67 after 4 h of SHEDs exposure to r-SHH. We have no clear explanation for this observation. While SHH can restore the expression of cell cycle promoting genes, such as cyclin D1 and cyclin E1, in cerebellar granule neuron progenitors (CGNPs) after serum withdrawal (Kenney and Rowitch, 2000), we found that the expression of cyclin E1 (CCNE1) decreased in SHEDs in response to serum reduction. Furthermore, the periodic expression of GLI1 and HES1 supported the findings by Ribes and Briscoe (2009) who asserted that the extracellular concentration of shh convert into intracellular periods of signal transduction. Although we did not detect any neural differentiation, it is not possible by just addition of Shh to conclude whether r-SHH serve to direct SHEDs to a neural destination or not. Normal patterning of neurons in ventral neural tube, during embryogenesis, occurs in response to higher concentrations of SHH; so that in vitro neural differentiation might require long-term treatment and/or higher concentrations of r-SHH (Warzecha et al., 2006; Dessaud et al., 2007; Ribes and Briscoe, 2009; Cai et al., 2012). Finally, our evidence indicates that hedgehog signalling cannot modulate proliferation in SHEDs. This raises the possibility that the cranial neural-crest origin of dentalderived stem cells may support its surprising potential to respond to hedgehog signalling. This specific characteristic proposes that SHEDs are more comparable to neural ventral progenitors rather than to dorsal brain precursors. Acknowledgments and funding Authors would like to thank Royan Institute for the financial support of this project. Furthermore, the SHED cells used in 486
this study were gifted from a common project between Royan institute and Torabinejad dental research center. References Abbas DI, Sharpe P (2008) Neural crest origin of dental stem cells. Pan European Federation of the International Association for Dental Research (PEF IADR) Seq. Ahn S, Joyner AL (2005) In vivo analysis of quiescent adult neural stem cells responding to Sonic hedgehog. Nature 437: 894–97. Balordi F, Fishell G (2007) Mosaic removal of hedgehog signaling in the adult SVZ reveals that the residual wild-type stem cells have a limited capacity for self-renewal. J Neurosci 27: 14248–59. Baxter MA, Wynn RF, Jowitt SN, Wraith J, Fairbairn LJ, Bellantuono I (2004) Study of telomere length reveals rapid aging of human marrow stromal cells following in vitro expansion. Stem Cells 22: 675–82. Beachy PA, Karhadkar SS, Berman DM (2004) Tissue repair and stem cell renewal in carcinogenesis. Nature 432: 324–31. Cai D, Shen Y, De Bellard M, Tang S, Filbin MT (1999) Prior exposure to neurotrophins blocks inhibition of axonal regeneration by MAG and myelin via a cAMP-dependent mechanism. Neuron 22: 89–101. Cai JQ, Huang YZ, Chen XH, Xie HL, Zhu HM, Tang L, Yang ZM, Huang YC, Deng L (2012) Sonic hedgehog enhances the proliferation and osteogenic differentiation of bone marrowderived mesenchymal stem cells. Cell Biol Int 36: 349–55. Chadipiralla K, Yochim JM, Bahuleyan B, Huang CYC, GarciaGodoy F, Murray PE, Stelnicki EJ (2010) Osteogenic differentiation of stem cells derived from human periodontal ligaments and pulp of human exfoliated deciduous teeth. Cell Tissue Res 340: 323–33. Chai Y, Jiang X, Ito Y, Bringas P, Han J, Rowitch DH, Soriano P, McMahon AP, Sucov HM (2000) Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development 127: 1671–79. Dahmane N, Sánchez P, Gitton Y, Palma V, Sun T, Beyna M, Weiner H, i Altaba AR (2001) The Sonic Hedgehog-Gli pathway regulates dorsal brain growth and tumorigenesis. Development 128: 5201–12. Dessaud E, Yang LL, Hill K, Cox B, Ulloa F, Ribeiro A, Mynett A, Novitch BG, Briscoe J (2007) Interpretation of the sonic hedgehog morphogen gradient by a temporal adaptation mechanism. Nature 450: 717–20. Dupin E, Sommer L (2012) Neural crest progenitors and stem cells: from early development to adulthood. Dev Biol 366: 83– 95. Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA, McMahon AP (1993) Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75: 1417–30. Fietz MJ, Concordet JP, Barbosa R, Johnson R, Krauss S, McMahon AP, Tabin C, Ingham PW (1994) The hedgehog gene family in Drosophila and vertebrate development. Development 1994: 43–51.
Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
F. Ejeian et al.
Fu M, Lui VCH, Sham MH, Pachnis V, Tam PKH (2004) Sonic hedgehog regulates the proliferation, differentiation, and migration of enteric neural crest cells in gut. J Cell Biol 166: 673–84. Fuccillo M, Joyner AL, Fishell G (2006) Morphogen to mitogen: the multiple roles of hedgehog signalling in vertebrate neural development. Nat Rev Neurosci 7: 772–83. Gagelin C, Toru-Delbauffe D, Gavaret JM, Pierre M (1999) Effects of cyclic AMP on components of the cell cycle machinery regulating DNA synthesis in cultured astrocytes. J Neurochem 73: 1799–805. Gronthos S, Brahim J, Li W, Fisher L, Cherman N, Boyde A, DenBesten P, Robey PG, Shi S (2002) Stem cell properties of human dental pulp stem cells. J Dent Res 81: 531–35. Ingham PW, McMahon AP (2001) Hedgehog signaling in animal development: paradigms and principles. Genes Dev 15: 3059– 87. Jeong J, Mao J, Tenzen T, Kottmann AH, McMahon AP (2004) Hedgehog signaling in the neural crest cells regulates the patterning and growth of facial primordia. Genes Dev 18: 937– 51. Kenney AM, Rowitch DH (2000) Sonic hedgehog promotes G1 cyclin expression and sustained cell cycle progression in mammalian neuronal precursors. Mol Cell Biol 20: 9055–67. Lai K, Kaspar BK, Gage FH, Schaffer DV (2002) Sonic hedgehog regulates adult neural progenitor proliferation in vitro and in vivo. Nat Neurosci 6: 21–7. Miura M, Gronthos S, Zhao M, Lu B, Fisher LW, Robey PG, Shi S (2003) SHED: stem cells from human exfoliated deciduous teeth. Proc Natl Acad Sci 100: 5807–12. Nakamura S, Yamada Y, Katagiri W, Sugito T, Ito K, Ueda M (2009) Stem cell proliferation pathways comparison between human exfoliated deciduous teeth and dental pulp stem cells by gene expression profile from promising dental pulp. J Endod 35: 1536–42. Nosrat IV, Widenfalk J, Olson L, Nosrat CA (2001) Dental pulp cells produce neurotrophic factors, interact with trigeminal neurons in vitro, and rescue motoneurons after spinal cord injury. Dev Biol 238: 120–32. Nourbakhsh N, Soleimani M, Taghipour Z, Karbalaie K, Mousavi S, Talebi A, Nadali F, Tanhaei S, Kiyani A, Nematollahi M, Rabiei F, Mardani M, Bahramiyan H, Torabinejad M, Nasr-Esfahani MH, Baharvand H (2011) Induced in vitro differentiation of neural-like cells from human exfoliated deciduous teethderived stem cells. Int J Dev Biol 55: 189–95. Papaccio G, Graziano A, d’Aquino R, Graziano MF, Pirozzi G, Menditti D, De Rosa A, Carinci F, Laino G (2006) Long-term cryopreservation of dental pulp stem cells (SBP-DPSCs) and
Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
r-shh have no proliferative effect on SHEDs
their differentiated osteoblasts: a cell source for tissue repair. J Cell Physiol 208: 319–25. Pozarowski P, Darzynkiewicz Z (2004) Analysis of cell cycle by flow cytometry. In: Axel H. Schönthal, Ed. Checkpoint Controls and Cancer, Vol. 2: Activation and Regulation Protocols (Methods in Molecular Biology, Vol. 281). New York: Humana Press. pp. 301–311. Ribes V, Balaskas N, Sasai N, Cruz C, Dessaud E, Cayuso J, Tozer S, Yang LL, Novitch B, Marti E (2010) Distinct Sonic Hedgehog signaling dynamics specify floor plate and ventral neuronal progenitors in the vertebrate neural tube. Genes Dev 24: 1186–200. Ribes V, Briscoe J (2009) Establishing and interpreting graded Sonic Hedgehog signaling during vertebrate neural tube patterning: the role of negative feedback. Cold Spring Harb Perspect Biol 1(2): a002014. Rohatgi R, Scott MP (2007) Patching the gaps in Hedgehog signalling. Nat Cell Biol 9: 1005–9. Sakai V, Zhang Z, Dong Z, Neiva K, Machado M, Shi S, Santos C, Nör J (2010) SHED differentiate into functional odontoblasts and endothelium. J Dent Res 89: 791–96. Stolzing A, Jones E, McGonagle D, Scutt A (2008) Age-related changes in human bone marrow-derived mesenchymal stem cells: consequences for cell therapies. Mech Ageing Dev 129: 163–73. Varjosalo M, Li S.-P, Taipale J (2006) Divergence of hedgehog signal transduction mechanism between Drosophila and Mammals. Dev Cell 10: 177–86. Varjosalo M, Taipale J (2008) Hedgehog: functions and mechanisms. Genes Dev 22: 2454–72. Wallace VA (1999) Purkinje-cell-derived Sonic hedgehog regulates granule neuron precursor cell proliferation in the developing mouse cerebellum. Curr Biol 9: 445–48. Wang Y, Yan M, Yu Y, Wu J, Yu J, Fan Z (2013) Estrogen deficiency inhibits the odonto/osteogenic differentiation of dental pulp stem cells via activation of the NF-kB pathway. Cell Tissue Res 352(3): 551–559. Warzecha J, Göttig S, Brüning C, Lindhorst E, Arabmothlagh M, Kurth A (2006) Sonic hedgehog protein promotes proliferation and chondrogenic differentiation of bone marrow-derived mesenchymal stem cells in vitro. J Orthop Sci 11: 491–96. Wechsler-Reya RJ, Scott MP (1999) Control of neuronal precursor proliferation in the cerebellum by Sonic Hedgehog. Neuron 22: 103–14. Wilson L, Maden M (2005) The mechanisms of dorsoventral patterning in the vertebrate neural tube. Dev Biol 282: 1–13. Received 13 August 2013; accepted 13 November 2013. Final version published online 21 January 2014 .
487
RESEARCH ARTICLE
Hedgehog signalling is dispensable in the proliferation of stem cells from human exfoliated deciduous teeth Fatemeh Ejeian1, Hossein Baharvand2,3* and Mohammad Hossein Nasr-Esfahani1* 1 Department of Cellular Biotechnology at Cell Science Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran 2 Department of Stem Cells and Developmental Biology at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran 3 Department of Developmental Biology, University of Science and Culture, ACECR, Tehran, Iran
Abstract The hedgehog (Hh) signalling pathway is one of the key regulators in development with a dual role in cell fate specification, proliferation, and survival on different target cells. We have investigated the effect of recombinant sonic hedgehog (r-SHH) on extracted multipotent stem cells from human exfoliated deciduous teeth (SHED), which represent a potential stem cell population for therapeutic applications. Cell proliferation and cycle assays shown that r-SHH did not have a distinctive effect on cell cycle progression, nor did it increase cell number over a wide range of concentrations. Quantitative polymerase chain reaction (Q-PCR) also suggests that r-SHH treatment has no demonstrable influence on expression of proliferative genes (CCNE1 and KI67); in contrast, the anti-proliferative gene (CDKN1A) is overexpressed in response to SHH. Our findings have suggested the possibility that SHEDs demonstrate a different potential from human bone marrow mesenchymal stem cells (h-BMSCs) and dorsal neural progenitor in response to growth factors such as SHH. Keywords: neural progenitor; proliferation; SHED; sonic hedgehog
Introduction The hedgehog (Hh) gene family encodes highly conserved secreted signalling proteins characterised as critical regulators of growth, patterning and cell-fate determination during embryogenesis in several model systems (Fietz et al., 1994; Ingham and McMahon, 2001; Varjosalo et al., 2006; Rohatgi and Scott, 2007; Varjosalo and Taipale, 2008). Due to its vital roles, many of the key components of Hedgehog signalling pathway is evolutionary conserved in vertebrates (Varjosalo et al., 2006; Varjosalo and Taipale, 2008). Since their isolation in the early 1990s, diverse functions of hedgehog proteins in different target cells have been reported, and have raised numerous questions regarding their mode of operation. The ventrally secreted signalling molecule, sonic hedgehog (shh), is involved in different aspects of the development of the early CNS, working in opposition to the dorsally expressed bone morphogenetic proteins (BMPs) in patterning the early neural plate and neural tube (Echelard et al., 1993). Shh has a central role in the specification of five neuronal subtypes in ventral neural tube, termed V0, V1,
V2, V3 interneurons, and motor neurons (MNs); and nonneuronal floor plate (FP). These domains emerge progressively, in which higher concentrations and longer exposure to shh leads to more ventral fate (Dahmane et al., 2001; Ribes et al., 2010). At a later stage, shh has a strong effect in the development of the cerebellum by promoting proliferation of granule neuron precursors (GNPs) (Wechsler-Reya and Scott, 1999), to the extent that some investigators has envisaged a function for shh in brain tumour initiation from precursor cells. This pathway mainly regulates proliferation of dorsal brain progenitors during embryogenesis and also causes a dosedependent proliferative response in adult neural progenitors (Lai et al., 2002; Fuccillo et al., 2006). Substantial evidence also implicates shh as an essential factor in neural stem cell maintenance (Beachy et al., 2004; Ahn and Joyner, 2005; Balordi and Fishell, 2007). Shh signal transduction pathway serves to maintain dividing neural progenitors, without sharing common targets with any other general mitogenic pathways. It appears that shh upregulates the cyclin-retinoblastoma (RB) axis and
Corresponding author: e-mail: [email protected] (M.H.N.-E), [email protected] (H.B.)
480
Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
F. Ejeian et al.
promotes synthesis of intermediate proteins that accelerate G1 progression. In contrast to serum-derived factors that can recruit quiescent cells into the cell cycle following growth arrest as well as stimulating proliferation in growing cells, the former role has not been so far envisaged or proven for SHH (Kenney and Rowitch, 2000). Upon Hh binding, cells that respond to SHH upregulate the expression of the zinc-finger transcription factor GLI1, as a result of relieved Patched-mediated inhibition of Smoothened activity. Several studies have claimed that increased levels of activated protein kinase A (PKA) have antimitogenic and pro-differentiation effects on numerous cell types and can interfere with Shh-stimulated mitogenic signalling (Cai et al., 1999; Gagelin et al., 1999; Wallace, 1999). Mesenchymal stem cells (MSCs) have great appeal for tissue engineering and therapeutic applications because of their capacity for self-renewal and multilineage differentiation potential. Among many other MSC-like populations residing in specialised tissues, such as dental pulp stem cells (DPSCs) and human bone marrow mesenchymal stem cells (h-BMSCs), stem cells from human exfoliated deciduous teeth (SHED) show a significantly higher proliferation rate and potential for differentiation into many functional cell types (Miura et al., 2003; Papaccio et al., 2006; Nakamura et al., 2009; Chadipiralla et al., 2010; Sakai et al., 2010). Dental pulp tissue is probably derived from migrating cranial neuralcrest cells during development, as well as other skeletal and connective tissues of the head and neck (Chai et al., 2000). SHEDs are a heterogeneous population that co-express embryonic stem (ES) cells (Oct4, Nanog) and neural progenitor markers (Nestin, b-TubIII and GFAP), which may be related to the neural-crest cell origin of dental pulp. They also possess a greater propensity for neuronal differentiation under defined inductive conditions compared to other MSCs (Chai et al., 2000; Nosrat et al., 2001; Gronthos et al., 2002; Miura et al., 2003; Abbas and Sharpe, 2008; Nourbakhsh et al., 2011). This neurogenic potential of SHED cells, besides their accessibility, makes them a valuable source in neural regeneration. While the proliferative effects of shh on neural stem and progenitor cells have been extensively studied, the connection between hedgehog signalling and dental stem cells, as a cranial neural-crest-derived population, remains a unknown. We have investigated the potential role of r-SHH in regulating the proliferation of extracted SHEDs, and sought to determine its influence on neural differentiation. Since sonic hedgehog acts directly on cell cycle progression, we also investigated the SHED cell cycle distribution following exposure to r-SHH. The hedgehog pathway may have an important function during growth, patterning, and morphogenesis of vertebrates and insects. Although Hh signalling is well studied during Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
r-shh have no proliferative effect on SHEDs
embryo development, its connection with stem cells in the adult body is less well understood. Based on various responses of cells with different origins to Hedgehog signalling and considering the neural-crest origin of dental-derived stem cells, as neural like precursor cells, we have looked at the potential proliferative effect of r-SHH on SHEDs. Materials and methods
Cells and culture conditions SHEDs were prepared and characterised as previously described (Nourbakhsh et al., 2011). In brief, exfoliated deciduous incisor were obtained from patients, who were 7–8 years old and female. Extracted pulps were minced and digested in a solution of collagenase type I containing 5% fetal calf serum (FCS) for 1 h at 378C. Single-cell suspensions were obtained by passing the cells through a 70 mm strainer. SHEDs were grown in Dulbecco’s modified eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin–glutamine (Gibco). The cells were subcultured every 5 days and all experiments were conducted with cells between passages 10–15, based on the characterisation of the cells as before (Nourbakhsh et al., 2011). H-BMSCs were isolated and cultured in a-MEM medium that contained 10% FBS, 1% L-glutamine, 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco), at a temperature of 378C and air with 5% CO2. The Hh protein used in the current studies was a bacterially overexpressed amino-terminal human SHH that showed comparable potency to native SHH in the cell-based reporter assay (data not shown).
In vitro proliferative assay SHED proliferation was assessed using MTS-based assay at different serum concentrations (0–10%) over 2, 4, 6 and 8 days of growth under normal conditions (without treatment). We cultured the cells at 1,000 cells per well (on the basis of their growth rate) in 200 mL of medium in a 96-well plate. To test whether SHH showed a significant effect on cellular proliferation of SHEDs, after 24 h culture, the medium was replaced with complete and serum-reduced media in the presence of increasing concentrations of r-SHH (0, 0.1, 1, 5 and 10 mg/mL). Cells were incubated for 2, 3 and 6 days. Finally a cell proliferation assay was used by adding 20 mL MTS/PMS solution (Promega) in 100 mL serum-free medium and incubating the plates in the dark for 4 h at 378C. Absorbance was read at 450 nm with an ELISA reader (Awareness model). Data were normalised to cell-free controls with the same MTS/PMS concentration as samples. 481
F. Ejeian et al.
r-shh have no proliferative effect on SHEDs
Darzynkiewicz, 2004). PI fluorescence was determined using a FACSCalibur cytometer (Becton Dickinson, San Jose, CA, USA). ModFit LT 3.0 program software was used to quantify cell cycle phase distribution. A minimum of 50,000 events was collected per sample at a flow rate of 100 events per second. Prior to the experimental treatments, cells were allowed to rest for 1 h by incubation in DMEM without mitogens to allow the downregulation of serum-stimulated intracellular signalling pathways.
RNA isolation and quantitative polymerase chain reaction (Q-PCR) analysis After overnight culture in serum-containing medium, SHEDs were treated for 4, 8, 16, 24 and 48 h in the presence of 0.5% or 10% FBS with or without r-SHH. Quantitative polymerase chain reaction (Q-PCR) was used to measure the expression of a number of genes related to the Hh pathway, proliferation or neural differentiation at each time-point. Oligonucleotide primers were designed using Beacon Designer 7 software, their sequences being given in Table 1. For all the required samples, total RNA was isolated using an RNeasy Mini Kit (Qiagen). Isolated RNAs were pretreated with DNaseI (Fermentas), allowing the selective removal of genomic DNA. cDNA was synthesised from 1 mg RNA using the RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas) and random hexamer primers. Q-PCR was performed using SYBR Premix Ex Taq II (TaKaRa) on an ABI Step One Real-Time PCR System (Applied Biosystems, Foster City, CA), applying a 3-step standard protocol with the annealing temperatures given in Table 1. Melting curve analysis was used to confirm the specificity of product amplifications. Relative quantification of transcript expression was estimated using the 2DDCt method. GAPDH housekeeping gene was used to normalise the data.
Statistical analyses All experiments were performed at least in triplicate and histograms are presented as means SEM. Analysis of variance was used with a significance of a ¼ 0.05 for data processing. Statistical significance was determined by one-way analysis (ANOVA) followed by the Tukey post-hoc test with the SPSS statistical software (version 16; SPSS, Inc., Chicago, IL). Results
Recombinant Sonic hedgehog (r-SHH) dose-dependently induces proliferation of human bone marrow mesenchymal stem cells (h-BMSCs) h-BMSCs initially proliferate in response to Hh stimulation (Warzecha et al., 2006; Cai et al., 2012). To verify the function of r-SHH, cellular DNA content and analysis of the cell cycle by flow cytometry were used to investigate the proliferative effect of SHH on h-BMSCs. After 24 h of culture in the presence of 1 and 5 mg/mL r-SHH, 3.13 and 6.76% of the cells moved into the S/G2/M (division phase), respectively (Figure 1a).
Flow cytometry for cell cycle analysis To analyse the cell cycle position of r-SHH or vehicle-treated cells, cells were collected and fixed in 70% ethanol. They were stained the cells with propidium iodide (10 mg/mL; PI) (Gagelin et al., 1999) in the presence of 100 mg/mL DNase-free RNase and 0.1% (v/v) Triton X-100 (Pozarowski and Table 1 Primer pair sequences, used for Q-PCR. Genes
Primer sequence (50 !30 )
GLI1
F: CCAACTCCACAGGCATACAG R: TCATACACAGATTCAGGCTCAC F: TGGAGAGGCGGCTAAGGTGT R: CCGCTGTTGCTGGTGTAGAC‘ F: CAGAGCGGTAAGAAGCAGAG R: GCAACAGACAGAAGAGAACG F: CTGTTATTGATGAGCCTGTA R: GTTGACTTCCTTCCATTCTG F: AGCGACCTTCCTCATCCAC R: GCCTCTACTGCCACCATCTT F: AGCAAACAGGTGAATGG R: TGAACGACGGGATAACA F: AAGATTCTTTGCCGCTACCA R: CACAGTGCTTCGGTCACAGT F: CGATATTGTCAGCCGTCTTCTAA R: TGCCACCAGTTGTCAGAA F: CGACTCATCTTTCCTTCTCTAA R: CGCACTTACCTCATCATTG
HES1 CCNE1 (CYCLINE E1) KI67 CNKN1A (P21) ATOH1 PAX7 NKX2.2 OLIG2
482
Annealing temp. (8C)
Accession no.
64
NM_001167609.1
62
NM_005524.2
58
NM_001238.2
58
NM_002417.4
58
NM_001220778.1
56
NM_005172.1
62
NM_002584
60
NM_002509
60
NM_005806
Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
F. Ejeian et al.
r-shh have no proliferative effect on SHEDs
cell cycle distribution (%)
100 13.34 2.02 80
15.61
17.42
2.83
4.31
60
G2/M phase S phase
40
84.52
77.76
81.39
G1/G0 phase
Absorbance (450 nm)
A
120
2.5
Normal Growth
- FBS
2
+ 0.5% FBS
1.5
+10% FBS
1 0.5
20
0 0 0
1
day 2
5
day 3
shh concentration (µg/ml)
The normal growth pattern of SHEDs by followed with the standard MTS assay at different time-points and different concentrations of FBS. The cells grew exponentially during the first 6 days of culture in complete and serum-reduced media (Figure 2A). However, as expected, prolonged culture in serum-deprived medium impaired their ability to survive and proliferate. Hence, further experiments were undertaken during the first 6 days of culture.
Sonic hedgehog (SHH) did not act as a mitogen for stem cells from human exfoliated deciduous teeth (SHED)
Absorbance (450 nm)
Growth characteristics
B
day 8
2
day 2
0.5% FBS
day 3 1.5 day 6 1
*
0.5
*
0 0
C Absorbance (450 nm)
Figure 1 Effect of sonic hedgehog (r-SHH) on human bone marrow mesenchymal stem cells (h-BMSCs) proliferation and cell cycle distribution. Propidium iodide (PI) staining and flow cytometry were used to determine h-BMSCs cell cycle distribution after 24 h treatment with increasing concentrations of SHH in reduced serum-containing medium [0.5% FBS].
day 6
Days of cultivation
2
0.1 1 5 shh concentration (µg/ml)
10
day 2
10% FBS
day 3 1.5 day 6
*
1
0.5
0
The effect of r-SHH on SHEDs proliferation by exposing cells to increasing concentrations of r-SHH (0.1, 1, 5 and 10 mg/ mL) for 2, 3 and 6 days in DMEM medium that contained 10% serum was examined. Viability in comparison of the treated and untreated cells on days 2, 3 and 6 showed that rSHH had no significant effect on proliferation in the presence of serum, even at the 5 mg/mL concentration (P < 0.05, Figure 2C). A moderate increase in cell viability was observed after 3 days of culture in 10 mg/mL r-SHH. Medium supplemented with a lower level of serum (0.5%) also showed a similar response to r-SHH treatment (Figure 2B).
Activation of sonic hedgehog (shh) pathway in stem cells from human exfoliated deciduous teeth (SHEDs) in response to r-SHH treatment The expression patterns of the GLI1 and HES1 genes, as two direct target genes of the shh pathway at 4, 8, 16, 24 and 48 h after treatment, were studied. In response to r-SHH, GLI1 Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
0
0.1 1 5 shh concentration (µg/ml)
10
Figure 2 Effect of different concentrations of recombinant sonic hedgehog (r-SHH) on proliferation of stem cells from human exfoliated deciduous teeth (SHEDs). (A) Cells were plated in 96-well plates (1,000 cells/well) and their normal growth at various serum concentrations were assessed during 8 days. (B) Cells were treated with increasing concentrations of r-SHH for 2, 3 and 6 days in the presence of 0.5% fetal bovine serum (FBS), and (C) in normal culture conditions (10% FBS). MTS assays were performed for determination of total viable cells. Values are presented as mean SD of three independent experiments; Significant difference from control (0 mg/mL r-SHH) at P < 0.05.
expression was significantly and markedly upregulated after 4 and 16 h, despite downregulation after 8 h (Figure 3D). Serum reduction resulted in a similar, but insignificant, pattern of expression. However, the opposite expression pattern was observed with HES1, which increased after 8 h, particularly notable in 0.5% serum-containing medium 483
F. Ejeian et al.
B
CCNE1
50
20 15 10
bdeg
30 20 10 0
0 control
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
abcde
3
HES1 2.5
e
b
2
control
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
4h
c
1.5
8h
a 1
d
Relative Fold Expression
acef
40
g
0.5
GLI1
50
f
gj
fi
de
1
60
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
cd
2
kl
D
ab
ejl bf
cg
dhk
a hi
2.5
abc
Relative Fold Expression
CDKN1A
3
control
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
Relative Fold Expression
control
E
k l
0
0
1.5
j
5
cel
25
i
0.2
30
adegh
0.4
35
g h
0.6
40
abc
a bd
ce
0.8
Relative Fold Expression
de
1
C 3.5
KI67
45
1.2
a bc
Relative Fold Expression
A 1.4
bdfij
r-shh have no proliferative effect on SHEDs
16 h
0.5
0 control
0.5% FBS -shh 10% FBS +shh 0.5% FBS +shh
Figure 3 Real-time PCR analysis of proliferation-related genes (A) CCNE1, (B) Ki67, and (C) CDKN1A as an anti-proliferative gene, as well as shh pathway target genes (D) Gli1 and (E) Hes1. Gene expressions were assessed after 4, 8 and 16 h of treatment with or without 100 ng/mL sonic hedgehog (r-SHH) in 10% FBS and reduced serum medium (0.5% FBS). Data were normalised to gene expression in the normal culture condition (DMEM þ 10% FBS), as the control. Values are presented as mean SD of 3 independent experiments. Bars with common letters were significantly different using the least significant difference (P ¼ 0.05).
(Figure 3E). Thus activation of the Hedgehog pathway occurred in response to administration of r-SHH protein under these culture conditions.
Hh signalling did not influence expression of proliferative genes in stem cells from human exfoliated deciduous teeth (SHEDs) Expression of CCNE1 and KI67, as markers of proliferative activity, remained significantly unchanged in response to r-SHH treatment compared with the controls (Figures 3A and 3B), whereas the expression of GLI1 increased in the treated cells. However, cyclin E1 (CCNE1) was expressed at 484
lower levels in serum-reduced medium, both with and without r-SHH treatment (Figure 3A). KI67 showed a transient expression 4 h after treatment with r-SHH (Figure 3B). To corroborate these results, we examined the expression of CDKN1A (P21), as a proliferation inhibitor, in response to rSHH. Figure 3C shows a gene expression profile that resembles the expression pattern of GLI1, which significantly increased after 4 and 16 h and displayed cyclic gene expression. There was no significant differences in expression of these genes comparing untreated controls to cells exposed to r-SHH for 24 and 48 h (data not shown). Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
F. Ejeian et al.
Cell Cycle Distribution (%)
To examine the possible role of Hh pathway in inducing neuronal differentiation in SHEDs, we assayed four transcription factors, ATOH1, PAX7, MNR2 and NKX2.2, whose expressions are differentially sensitive to the SHH protein in response to r-SHH at the mentioned time-points. There was no detectable change in expression of these genes in either untreated or treated cells; however, significant expression was observed in the positive controls (data not shown).
A
Discussion The hedgehog pathway does not have a distinct proliferative effect on MSC-like SHEDs, which was adopted as a progenitor population originating from neural-crest cells (Abbas and Sharpe, 2008; Nourbakhsh et al., 2011). These findings were not contradictory to other investigations, indicating that SHH, as a major mitogen, acts on a variety of neural progenitor and stem cells (Lai et al., 2002). As proof of principle for the efficiency of the recombinant protein used in this study, our findings have confirmed previous observations that r-SHH dose-dependently induces strong proliferation of h-BMSCs (Warzecha et al., 2006; Cai et al., 2012). The results have shown that, along with increased SHH concentrations, there was no significant effect on the growth rate of SHED Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
24h treatment
100 80
12.3
12.3
16.17
16
71.03
70.9
3.98 3.17
4.23 2.35
92.84
93.42
60 40 20
10% FBS -shh
B
Hh signalling does not alter cell cycle distribution of stem cells from human exfoliated deciduous teeth (SHED) cells
120
10% FBS +shh
0.5% FBS -shh
0.5% FBS +shh
48h treatment
100
3.6 2.2
3.88 2.3
2.4 0.99
93.83
96.6
2.3 0.8
80 60 94.19
96.905
40 20 0 10% FBS -shh
C
10% FBS +shh
0.5% FBS -shh
0.5% FBS +shh
120 100
Cell Cycle Distribution (%)
Flow cytometric analysis of PI fluorescence was used to identify the effect of SHH on the cell cycle phase distribution of SHEDs at 24 (Figure 4A) and 48 h (Figure 4B). No significance differences were found at 24 and 48 h in the proportion of cells cultured in complete medium in G0/G1 and S/G2/M (division phase) between r-SHH treated and untreated cells. In assessing the effect of r-SHH under reduced serum conditions (0.5% FBS) in cultured cells, replacement of 10% serum with 1 mg of the biologically active N-terminal fragment of SHH per mL resulted in a cell cycle distribution similar to that obtained with the vehicle alone after 24 and 48 h (Figures 4A and 4B), however the division phase significantly decreased as a result of serum reduction irrespective of r-SHH treatment. To determine whether the Hh agonist could elicit this response, we exposed cells to increasing concentrations of Smoothened Agonist (SAG). Cell cycle analysis showed that SHEDs responded identically to different concentrations of SAG as to r-SHH (Figure 4C).
120
0
Cell Cycle Distribution (%)
Sonic hedgehog (SHH) did not move stem cells from human exfoliated deciduous teeth (SHEDs) toward neural differentiation in the short-term
r-shh have no proliferative effect on SHEDs
3.9 4.4
2.5 5.5
6 4.98
2.9 6.6
5.1 6
80
G2/M phase
60
S phase
40
89
91.8
92
88.9
90.4
G1/G0 phase
20 0 0
10
100
200
500
SAG concentration (nM)
Figure 4 Analysis of SHEDs cell cycle distribution in response to activation of shh pathway. (A) PI staining and flow cytometry were used to determine SHEDs cell cycle distribution after either 24 (B) or 48 h of treatment in the presence or absence of 1 mg/mL in normal growth medium that contained 10% fetal bovine serum (FBS) and reduced serum medium (0.5% FBS). (C) Cells were also exposed to increasing concentrations of Smoothened Agonist (SAG) for 24 h and their cell cycle distribution was evaluated by PI staining. Values are presented as mean SD of three independent experiments.
cells except for a mild increase with 10 mg/mL of r-SHH. This was a mild increment for a very high level of SHH, regarding the concentrations used by different researchers (Wilson and Maden, 2005). Therefore, our data suggest that SHH cannot induce proliferation of SHEDs. This observation was supported by cell cycle analysis, which showed that SHH treatment, in addition to exposing the cells to SAG, did not result in any significant change in the proportion of cells within the division phase. These studies are disparate with regard to the previously reported mitogenic effects of SHH on granule neural progenitors and some types of MSCs (Fu et al., 2004; Warzecha et al., 2006; Cai et al., 2012). However, MSCs isolated from various organs have distinctive intrinsic program and therefore respond differently to environmental signals (Jeong et al., 2004; Dupin and Sommer, 2012). 485
F. Ejeian et al.
r-shh have no proliferative effect on SHEDs
Further complications for comparative analysis of various investigations arise when MSCs are obtained from donors of different age and sex, and they are also influenced by different extraction and cultivation methods. While there is some conflicting evidence, most findings show a significant decrease in the proliferation and differentiation potential of MSCs with increasing age (Baxter et al., 2004; Stolzing et al., 2008). Another has also shown a sex-related effect on the osteogenic differentiation capacity of dental stem cells, which may be a case of different estrogen levels (Wang et al., 2013). Indeed, such a variety of responses to shh can be explained by differences in MSC’s intrinsic program, like genetic and epigenetic variations, and their extrinsic conditions, for example, culture media and substrates. This field of study should open new avenues in our understanding of the complexities of these cells and their environmental interactions. One major challenge of this study is that r-SHH induced molecular profile did not increase the expression of cell cycle progressing genes (CCNE1 and KI67); however, it showed a significant upregulation of a known post-mitotic gene (CDKNA1), apart from transient expression of KI67 after 4 h of SHEDs exposure to r-SHH. We have no clear explanation for this observation. While SHH can restore the expression of cell cycle promoting genes, such as cyclin D1 and cyclin E1, in cerebellar granule neuron progenitors (CGNPs) after serum withdrawal (Kenney and Rowitch, 2000), we found that the expression of cyclin E1 (CCNE1) decreased in SHEDs in response to serum reduction. Furthermore, the periodic expression of GLI1 and HES1 supported the findings by Ribes and Briscoe (2009) who asserted that the extracellular concentration of shh convert into intracellular periods of signal transduction. Although we did not detect any neural differentiation, it is not possible by just addition of Shh to conclude whether r-SHH serve to direct SHEDs to a neural destination or not. Normal patterning of neurons in ventral neural tube, during embryogenesis, occurs in response to higher concentrations of SHH; so that in vitro neural differentiation might require long-term treatment and/or higher concentrations of r-SHH (Warzecha et al., 2006; Dessaud et al., 2007; Ribes and Briscoe, 2009; Cai et al., 2012). Finally, our evidence indicates that hedgehog signalling cannot modulate proliferation in SHEDs. This raises the possibility that the cranial neural-crest origin of dentalderived stem cells may support its surprising potential to respond to hedgehog signalling. This specific characteristic proposes that SHEDs are more comparable to neural ventral progenitors rather than to dorsal brain precursors. Acknowledgments and funding Authors would like to thank Royan Institute for the financial support of this project. Furthermore, the SHED cells used in 486
this study were gifted from a common project between Royan institute and Torabinejad dental research center. References Abbas DI, Sharpe P (2008) Neural crest origin of dental stem cells. Pan European Federation of the International Association for Dental Research (PEF IADR) Seq. Ahn S, Joyner AL (2005) In vivo analysis of quiescent adult neural stem cells responding to Sonic hedgehog. Nature 437: 894–97. Balordi F, Fishell G (2007) Mosaic removal of hedgehog signaling in the adult SVZ reveals that the residual wild-type stem cells have a limited capacity for self-renewal. J Neurosci 27: 14248–59. Baxter MA, Wynn RF, Jowitt SN, Wraith J, Fairbairn LJ, Bellantuono I (2004) Study of telomere length reveals rapid aging of human marrow stromal cells following in vitro expansion. Stem Cells 22: 675–82. Beachy PA, Karhadkar SS, Berman DM (2004) Tissue repair and stem cell renewal in carcinogenesis. Nature 432: 324–31. Cai D, Shen Y, De Bellard M, Tang S, Filbin MT (1999) Prior exposure to neurotrophins blocks inhibition of axonal regeneration by MAG and myelin via a cAMP-dependent mechanism. Neuron 22: 89–101. Cai JQ, Huang YZ, Chen XH, Xie HL, Zhu HM, Tang L, Yang ZM, Huang YC, Deng L (2012) Sonic hedgehog enhances the proliferation and osteogenic differentiation of bone marrowderived mesenchymal stem cells. Cell Biol Int 36: 349–55. Chadipiralla K, Yochim JM, Bahuleyan B, Huang CYC, GarciaGodoy F, Murray PE, Stelnicki EJ (2010) Osteogenic differentiation of stem cells derived from human periodontal ligaments and pulp of human exfoliated deciduous teeth. Cell Tissue Res 340: 323–33. Chai Y, Jiang X, Ito Y, Bringas P, Han J, Rowitch DH, Soriano P, McMahon AP, Sucov HM (2000) Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development 127: 1671–79. Dahmane N, Sánchez P, Gitton Y, Palma V, Sun T, Beyna M, Weiner H, i Altaba AR (2001) The Sonic Hedgehog-Gli pathway regulates dorsal brain growth and tumorigenesis. Development 128: 5201–12. Dessaud E, Yang LL, Hill K, Cox B, Ulloa F, Ribeiro A, Mynett A, Novitch BG, Briscoe J (2007) Interpretation of the sonic hedgehog morphogen gradient by a temporal adaptation mechanism. Nature 450: 717–20. Dupin E, Sommer L (2012) Neural crest progenitors and stem cells: from early development to adulthood. Dev Biol 366: 83– 95. Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA, McMahon AP (1993) Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75: 1417–30. Fietz MJ, Concordet JP, Barbosa R, Johnson R, Krauss S, McMahon AP, Tabin C, Ingham PW (1994) The hedgehog gene family in Drosophila and vertebrate development. Development 1994: 43–51.
Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
F. Ejeian et al.
Fu M, Lui VCH, Sham MH, Pachnis V, Tam PKH (2004) Sonic hedgehog regulates the proliferation, differentiation, and migration of enteric neural crest cells in gut. J Cell Biol 166: 673–84. Fuccillo M, Joyner AL, Fishell G (2006) Morphogen to mitogen: the multiple roles of hedgehog signalling in vertebrate neural development. Nat Rev Neurosci 7: 772–83. Gagelin C, Toru-Delbauffe D, Gavaret JM, Pierre M (1999) Effects of cyclic AMP on components of the cell cycle machinery regulating DNA synthesis in cultured astrocytes. J Neurochem 73: 1799–805. Gronthos S, Brahim J, Li W, Fisher L, Cherman N, Boyde A, DenBesten P, Robey PG, Shi S (2002) Stem cell properties of human dental pulp stem cells. J Dent Res 81: 531–35. Ingham PW, McMahon AP (2001) Hedgehog signaling in animal development: paradigms and principles. Genes Dev 15: 3059– 87. Jeong J, Mao J, Tenzen T, Kottmann AH, McMahon AP (2004) Hedgehog signaling in the neural crest cells regulates the patterning and growth of facial primordia. Genes Dev 18: 937– 51. Kenney AM, Rowitch DH (2000) Sonic hedgehog promotes G1 cyclin expression and sustained cell cycle progression in mammalian neuronal precursors. Mol Cell Biol 20: 9055–67. Lai K, Kaspar BK, Gage FH, Schaffer DV (2002) Sonic hedgehog regulates adult neural progenitor proliferation in vitro and in vivo. Nat Neurosci 6: 21–7. Miura M, Gronthos S, Zhao M, Lu B, Fisher LW, Robey PG, Shi S (2003) SHED: stem cells from human exfoliated deciduous teeth. Proc Natl Acad Sci 100: 5807–12. Nakamura S, Yamada Y, Katagiri W, Sugito T, Ito K, Ueda M (2009) Stem cell proliferation pathways comparison between human exfoliated deciduous teeth and dental pulp stem cells by gene expression profile from promising dental pulp. J Endod 35: 1536–42. Nosrat IV, Widenfalk J, Olson L, Nosrat CA (2001) Dental pulp cells produce neurotrophic factors, interact with trigeminal neurons in vitro, and rescue motoneurons after spinal cord injury. Dev Biol 238: 120–32. Nourbakhsh N, Soleimani M, Taghipour Z, Karbalaie K, Mousavi S, Talebi A, Nadali F, Tanhaei S, Kiyani A, Nematollahi M, Rabiei F, Mardani M, Bahramiyan H, Torabinejad M, Nasr-Esfahani MH, Baharvand H (2011) Induced in vitro differentiation of neural-like cells from human exfoliated deciduous teethderived stem cells. Int J Dev Biol 55: 189–95. Papaccio G, Graziano A, d’Aquino R, Graziano MF, Pirozzi G, Menditti D, De Rosa A, Carinci F, Laino G (2006) Long-term cryopreservation of dental pulp stem cells (SBP-DPSCs) and
Cell Biol Int 38 (2014) 480–487 ß 2013 International Federation for Cell Biology
r-shh have no proliferative effect on SHEDs
their differentiated osteoblasts: a cell source for tissue repair. J Cell Physiol 208: 319–25. Pozarowski P, Darzynkiewicz Z (2004) Analysis of cell cycle by flow cytometry. In: Axel H. Schönthal, Ed. Checkpoint Controls and Cancer, Vol. 2: Activation and Regulation Protocols (Methods in Molecular Biology, Vol. 281). New York: Humana Press. pp. 301–311. Ribes V, Balaskas N, Sasai N, Cruz C, Dessaud E, Cayuso J, Tozer S, Yang LL, Novitch B, Marti E (2010) Distinct Sonic Hedgehog signaling dynamics specify floor plate and ventral neuronal progenitors in the vertebrate neural tube. Genes Dev 24: 1186–200. Ribes V, Briscoe J (2009) Establishing and interpreting graded Sonic Hedgehog signaling during vertebrate neural tube patterning: the role of negative feedback. Cold Spring Harb Perspect Biol 1(2): a002014. Rohatgi R, Scott MP (2007) Patching the gaps in Hedgehog signalling. Nat Cell Biol 9: 1005–9. Sakai V, Zhang Z, Dong Z, Neiva K, Machado M, Shi S, Santos C, Nör J (2010) SHED differentiate into functional odontoblasts and endothelium. J Dent Res 89: 791–96. Stolzing A, Jones E, McGonagle D, Scutt A (2008) Age-related changes in human bone marrow-derived mesenchymal stem cells: consequences for cell therapies. Mech Ageing Dev 129: 163–73. Varjosalo M, Li S.-P, Taipale J (2006) Divergence of hedgehog signal transduction mechanism between Drosophila and Mammals. Dev Cell 10: 177–86. Varjosalo M, Taipale J (2008) Hedgehog: functions and mechanisms. Genes Dev 22: 2454–72. Wallace VA (1999) Purkinje-cell-derived Sonic hedgehog regulates granule neuron precursor cell proliferation in the developing mouse cerebellum. Curr Biol 9: 445–48. Wang Y, Yan M, Yu Y, Wu J, Yu J, Fan Z (2013) Estrogen deficiency inhibits the odonto/osteogenic differentiation of dental pulp stem cells via activation of the NF-kB pathway. Cell Tissue Res 352(3): 551–559. Warzecha J, Göttig S, Brüning C, Lindhorst E, Arabmothlagh M, Kurth A (2006) Sonic hedgehog protein promotes proliferation and chondrogenic differentiation of bone marrow-derived mesenchymal stem cells in vitro. J Orthop Sci 11: 491–96. Wechsler-Reya RJ, Scott MP (1999) Control of neuronal precursor proliferation in the cerebellum by Sonic Hedgehog. Neuron 22: 103–14. Wilson L, Maden M (2005) The mechanisms of dorsoventral patterning in the vertebrate neural tube. Dev Biol 282: 1–13. Received 13 August 2013; accepted 13 November 2013. Final version published online 21 January 2014 .
487
