Molecular Imntunology,
Vol.
21. No. 5, pp. 443449,
0161.5890/90 $3.00+0.00
1990
Pergamon Press plc
Printed in Great Britain.
HEPATITIS B SURFACE ANTIGEN PARTICLES WITH ALL FOUR SUBTYPIC DETERMINANTS: POINT MUTATIONS OF HEPATITIS B VIRUS DNA INDUCING PHENOTYPIC CHANGES OR DOUBLE INFECTION WITH VIRUSES OF DIFFERENT SUBTYPES TARO YAMANAKA,*
YOSHIHIRO AKAHANE,*
HIROAKI OKAMOTO,? and
HIROSHI SUZUKI,*
FUMIO TSUDA,~ Yuzo
MIYAKAWA~
MAKOTO MAYUMItr
*The First Department of Internal Medicine, Yamanashi Medical College, Yamanashi-Ken 409-38, Japan; tlmmunology Division, Jichi Medical School, Tochigi-Ken 329-04, Japan; ISection of Immunology, the Kitasato Institute, Tokyo 108, Japan: SMita Institute, Tokyo 108. Japan (First received
19 Sepremher 1989; accepted 25 October 1989)
Abstract-Hepatitis B surface antigen (HBsAg) particles carry the common determinant, LI, as well as d or y and M’or r subtype determinants, and are classified into the four major subtypes, i.e., adw, adr, UJW and ayr. Rare sera contain HBsAg particles with all four subtype determinants (adywr). Target sequences (nucleotides 388550) in the S gene of hepatitis B virus (HBV) DNA in two such sera were amplified by the polymerase chain reaction. Individual amplification products were cloned in an Ml3 phage vector. The HBV DNA clones obtained were subtyped by determining the second letters of codon 122 and 160 for lysine (AAA/AAG) or arginine (AGA/AGG), which specify the d or y and M’or r determinants, respectively. From one serum (S-63), two adw,, IO adr and 58 clt~ clones were obtained. When the two adw clones and two representatives each of the adr and air clones were compared against each other, for the sequence of 235 base pairs representing nucleotides 295-529 in the S gene, they differed only by 0.4-2.1% (average 1.2%). These results indicated multiple point mutations of a single HBV strain of subtype ayr and co-infection of hepatocytes with the original HBV strain and its mutant of subtype udw as the mechanism for the production of HBsAg/adynsr particles. From the other serum (K-45), 1 adw, 73 adr and 4 ayrr clones were obtained. The adv clone and two representative udr clones differed only by O&l.7% in the S gene sequences, but they differed by 8.5% or greater from two representative aq’u~clones, HBsAg/adynr particles in this serum. therefore, could be explained by double infection of hepatocytes with two HBV strains of different subtypes (adr and Unix).
INTRODUCTION B surface
Hepatitis protein
of hepatitis
antigen
(HBsAg)
B virus
(HBV),
is the envelope
and also occurs particles in the circu-
abundantly as small, non-viral lation of hosts. HBsAg has a common determinant named a, and in addition, one or other member from each of two pairs of mutually exclusive subtype determinants called d and y (Le Bouvier, 1971), and w and r (Bancroft et al., 1972). As a result, four major subtypes uyr.
of HBsAg
HBsAg
subtypes
are created, have
i.e. a&,
distinct
adr, ayw and
geographical
dis-
et al.,
1974; Courouct-Pauty et al., 1983), and help in tracing the route of HBV infection (Mayumi and Nakajima, 1973; Yamashita et al., 1975; Okada et al., 1976). There are exceptions to the four major subtypes. Rare HBsAg particles display three subtypic determitributions
(Mazzur
BAuthor to whom correspondence should be addressed. Abbreviations: HBV, hepatitis B virus; HBsAg, hepatitis B surface antigen; PCR, polymerase base pair(s); nt. nucleotide(s).
chain
reaction;
bp,
443
nants including both subtypic determinants in an allele (U&W, adyr, adwr and UWW), or even all four subtypic determinants (adywr). Nordenfeh and Le Bouvier (1973174) as well as Mazzur et al. (1975) were the first to note such “compound” HBsAg particles with excessive subtype determinants. Among sera from 5082 asymptomatic carriers in Japan, HBsAg particles with three subtype determinants were found in 70, and those with four determinants in four (Tachibana et al.. 1989). HBsAg particles, with an estimated mol. wt of 3 x 106, are made of the products of the pre-S 1, pre-S2 regions and the S gene of HBV DNA (Tiollais et al., 1985). A single amino acid substitution in the S gene product, composed of 226 amino acids, specifies the d or j’, as well as the u’ or r determinant (Peterson et al., 1984; Okamoto et al., 1987~). HBV DNA clones propagated from sera containing HBsAg with the d determinant have codon 122 for lysine, while those with the _r determinant have that for arginine. Similarly, u’ and r determinants are specified by codon 160 for lysine and arginine, respectively.
TAR0 YAMANAKA et
444
These amino acid changes are attributed, in turn, to a single nucleotide substitution from A to G, resulting in conversion of the codon for lysine (AAA or AAG) to arginine (AGA or AGG). Such nucleotide substitutions naturally occur in persistently infected hosts as the results of an A-to-G or G-to-A point mutation (Okamoto et al., 1987c), and can be artificially induced by site-directed mutagenesis (Okamoto et al., 19873). In essence, therefore, nucleotide (nt) 365 of A or G specifies the d or y determinant, and nt 479 of A or G w or r. HBsAg particles in a very exceptional serum had codon 160 for asparagine (AAC), despite nt 479 of A, and did not express either the w or r determinant (Okamoto et al., 1989). HBsAg particles with three subtype determinants are formed by the phenotypic mixing of two S gene products in hepatocytes infected with two HBV strains of different subtypes (Paul et al., 1986; Okamoto et al., 1987~). In order that HBsAg particles with all four subtypic determinants are produced, hepatocytes would have to be infected with at least two HBV strains that cover the four subtypic determinants of HBsAg. With the advent of the polymerase chain reaction [PCR (Saiki et al., 1988)], HBV DNA clones were propagated from two sera containing HBsAg/a&wr particles, and subtyped at the nucleotide level. Diversions in a part of the S gene sequence [235 base pairs (bp) representing nt 29555291 were evaluated, among HBV DNA clones obtained from each serum, to see if there were any genotypic differences by the criteria of Okamoto et al. (1988). MATERIALS
AND METHODS
Serum samples Rare serum samples were found which contained HBsAg with all four subtypic determinants on the same particles and subtyped as adywr. One of them (S-63) was from an asymptomatic carrier of HBsAg who donated a blood unit at a regional center of Japan Red Cross Association, and the other (K-45) was from a Kenyan blood donor. Subtypic determinants of HBsAg were detected by enzyme immunoassay with monoclonal antibodies (HBsAg Subtype EIA, Institute of Immunology Co. Ltd., Tokyo, Japan). Both sera contained HBV DNA detectable by dot blot hybridization (Scotto et al., 1983) with use of a radiolabeled HBV DNA probe (Okamoto et al., 1986). Separation of‘ HBsAg particles of various subtypes by afinity columns of monoclonal antibodies Four subtypic determinants detected in both indicated a possibility for HBsAg particles of different subtypes. They were the four regular types with two subtypic determinants (adw, aJw and ayr). and five “compound” subtypes
sera nine subadr, with
al.
three (adyw, adyr, adwr and aywr) or four subtypic determinants (adywr). Nine kinds of HBsAg particles with different subtypes were separated from each other by chromatography on affinity columns in which monoclonal antibodies to subtypic determinants were immobilized. Monoclonal antibody against the d determinant (anti-d, monoclonal No. 3423) monoclonal anti-l, (No. 3457), anti-w (No. 4111) and anti-r (No. 313) were employed (Usuda et al., 1986). The strategy for separating HBsAg particles of different subtypes is shown in Fig. 1. At each step of affinity chromatography, HBsAg particles retained by the column were eluted with 4 M MgClz and dialyzed against Tris-HCl buffer (10 mM, pH 7.6) containing 0.15 M NaCl and supplemented with 1% (v/v) fetal calf serum (Flow Laboratories, Virginia, U.S.A.). The retained and then eluted fraction, as well as the passed fraction, were processed successively to another affinity column, and fractions expected to contain HBsAg particles of nine different subtypes were finally obtained. Each fraction was assayed for the common determinant, a, as well as for d, _y. $1’and r subtype determinants, and different subtypes were confirmed. Further, the presence of subtype determinants on the same particles was ascertained by sandwiching them between monoclonal antibodies of different specificities. The percentage distribution of HBsAg particles of nine different subtypes was calculated based on the common determinant a. Isolation of DNA from serum Serum (100 p 1) was mixed with 300 p 1of Tris-HCl buffer (13.3 mM, pH 8.0) containing 6.7 mM EDTA, 0.67% (w/v) sodium dodecyl sulfate and 133 pgjml of proteinase K. The mixture was incubated for 3 hr at 70 C, and DNA was extracted with phenol-chloroform, and precipitated with ethanol in the presence of carrier tRNA (10 pg/ml). The precipitate was dissolved in 20 ~1 of Tris-HCl buffer (10 mM, pH 8.0) containing 1 mM EDTA (hereafter referred to as TE buffer). Amplification
qf HBV
DNA by PCR
Oligonucleotide primers, specific for the S gene sequence, were synthesized on a 380B DNA synthesizer (Applied Biosystems Japan, Tokyo, Japan). Primer Sl had a sequence of S’-TCGTGTTACAGGCGGGGTTT-3’, representing nt 38-57 in the S gene, and primer S2 was sequenced as 5’-CGAACCACTGAACAAATGGC-3’ representing nt 53 I-550 of the complementary strand. These primers were capable of amplifying a target sequence of 5 I3 base pairs (bp) in the S gene (nt 38-550) that included nt 365 and 479 forming a part of codon 122 and 160. respectively, for either lysine or arginine. Amplification with Tuy polymerase was carried out by the procedure described by Kogan et al. (1987) and Saiki et al. (1988) with a slight modification. Briefly, 10 ~1 of the solution containing HBV DNA
HBsAg particles with all four subtypic determinants
445
I
I
retained
,
J
passed
,
anti-w
retained
,
1
1
passed
anti-d
,
,
retained
1 4’” pissed
passed
anti-:
,
F-r
retained
“r passed
anti-r
retained
passed
S-63
2%
-
K-45
11%
-
Aretained
passed
10% 6%
-
64%
1%
5%
16%
-
1%
-
62%
Fig. 1. Separation of HBsAg particles of various subtypes by affinity column chromatography. Sera containing HBsAg particles with all four subtypic determinants (S-63 and K-45) were subjected to an affinity column to which monoclonal antibody against y determinant (anti-y) was conjugated. HBsAg particles retained by the column were eluted and, along with those passed by it, were applied to an anti-w column. Retained and passed fractions were applied to affinity columns of anti-d and anti-r successively. Finally obtained fractions were tested for the common determinant, a, by enzyme immunoassay and the percentage distribution of HBsAg of nine different subtypes was estimated. Fractions indicated by minuses contained less than 0.005% of the total HBsAg particles recovered. were heated at 95°C for 7 min to denature proteases in the sample. The reaction mixture was spun in a microcentrifuge for 5 set, and allowed to cool off at room temp. Target sequences (nt 38-550) were amplified in a 100-p 1 reaction volume containing heat-denatured HBV DNA, 1.5 mM each of the four dNTPs, 50 pM each of oligonucleotide primers (Sl and S2), 10% (v/v) dimethyl sulfoxide, 2.5 units of Taq polymerase (New England Biolabs, Massachusetts, U.S.A.) in a reaction buffer [67 mM Tris-HCl (pH 8.8) 16.6 mM 6.7 mM MgCl,, 10 mM 2-mercap(NH,)>SO,, toethanol. 6.7pLM EDTA and 170pg/ml of bovine serum albumin]. The reaction was performed for 25 cycles in a programmable DNA thermal cycler (PerkinElmer Cetus, Connecticut, U.S.A.). In each cycle, samples were heated at 94°C for 1 min, cooled and kept at 55’C for 1.5 min, and incubated at 72°C for 3 min. The reaction at 72-C was continued for 10 min in the last cycle to ensure the complete DNA extension. Sequencing of the amplified S-gene fragment Samples (50 ~1) containing amplified HBV DNA were digested with XbaI and SpeI (Takara Biochemicals, Kyoto, Japan). The XbaI-SpeI fragments of 437 bp were cloned into the XbaI site of the Ml3 mpl I phage vector (Amersham, Buckinghamshire, U.K.). The nucleotide sequence of 235 bp, representing nt 295-529 in the S gene, was determined by the dideoxy chain termination method (Sanger et al., 1977) using a synthetic oligonucleotide primer with a
sequence of 5’-CTGCGGCGTTTTATCAT-3’ (nt 229-245). The regular, four-track sequencing for A, G, C and T, as well as a single-track sequencing for A, was performed. RESULTS
HBsAg particles with various subtypes in the two sera The two sera containing HBsAg with the expression of all four subtypic determinants were subjected to chromatography on affinity columns of monoclonal antibodies against each subtypic determinant. The percentage distribution of HBsAg particles of nine different subtypes is indicated at the bottom of Fig. 1. HBsAg/adywr particles were found in 2% in the Japanese serum (S-63), and in 11% in the Kenyan serum (K-45). As regards the four regular subtypes, S-63 contained HBsAg particles of subtypes adw (So/,), adr (18%) and ayr (64%); HBsAg/ayw particles were not detected. These results indicated the infection of the Japanese donor with three HBV strains of different subtypes. Only two regular subtypes were seen in HBsAg of the Kenyan donor, i.e. adr (82%) and ayw (6%). The S gene sequences of HBV DNA clones,from the Japanese donor (S-63) From S-63, 70 recombinant Ml3 vectors containing a part of the S gene (437 bp representing nt 93-529) were propagated. They were subjected to
446
Tauo
YAMANAKA et al.
single-track sequencing for A. and subtyped by the presence or absence of A at nt 365 and 479; A( +) stood for d and A( -) for J’ at nt 365, and A( +) stood for u’ and A(-) for r at nt 479 (Okamoto ef (II., 1987~). HBV DNA of subtype adrr was identified in two clones (3%). adr in IO clones (14%) and clyr in the remaining 58 clones (83%). Nucleotide sequences (nt 2955529) of the two HBV DNA clones of subtype adw, and two representatives each from the udr and uyr clones were determined (Fig. 2). Clones with A at nt 365 and 479 had codons 122 and 160 for lysine (AAA or AAG), while clones without A at respective nucleotides had those codons for arginine (AGA or AGG). and subtypes were verified at the codon level. The S gene Kenyan
sequences
donor
of HBV
DNA
clones ,fivtn the
Nucleotide
dioergences subtypes
in
propuguted
HBV
DNA
,fktn
S-63
clones and
of
K-45
The six HBV DNA clones of three different subtypes propagated from the Japanese serum (S-63) were compared against each other for the divergence Clones
DISCUSSION
(K-45)
From K-45,78 HBV DNA clones containing a part of the S gene (nt 933529) were propagated. By singletrack sequencing for A, HBV DNA of subtype adw was identified in only one clone (I %), adr in 73 clones (94%) and U~M:in the remaining four clones (5%). Nucleotide sequences (nt 2955529) of the adw clone and two representatives each of the udr and u_r~’ clones were determined (Fig. 3). Amino acids deduced from codons 122 and 160 confirmed the results of subtyping by the single-track sequencing for A.
different
in the S gene sequence (nt 295-529), and the results were expressed as a percentage as listed in Table I. Similarly, percentage divergences were obtained for the five HBV DNA clones of three different subtypes from the Kenyan serum (K-45) as shown in Table 2. The six HBV DNA clones from S-63 were similar in the S gene sequence (nt 295-529) differing only by 0.4-2.1% with an average of 1.2%. In contrast, the five HBV DNA clones from K-45 were classified into two groups on the basis of sequence divergence. The rrdil*clone (No. 277) and two representative adr clones (Nos 207 and 253) were similar, differing only by f&1.7%. They were different from two representative a~,,‘ clones by 8.5-8.9%, however. The two u~r+ clones differed by only 0.4%.
300
310
320
330
HBsAg particles with both subtypic determinants in an allele, d and ,r or u’ and r, are produced by phenotypic mixing of the S gene products encoded by HBV DNAs of different subtypes infecting the same hepatocytes (Paul et al., 1986; Okamoto et al., 1987~). The subtype determinant dory is specified by lysine or arginine at codon 122 of the S gene, respectively, and u’ or r by lysine or arginine at codon 160 (Okamoto et al., 1987b, c). At the nucleotide level, these amino acid conversions are ascribed to nt 365 and nt 479 in the S gene of A or G, respectively. We previously reported the mechanism of HBsAg particles with excessive subtypic determinants (Okamoto et al., 1987~). When HBV DNA clones were propagated from serum containing HBsAg/a@r, and their S gene sequences of 678 bp 340
350
360
370
380
460
470
* * * * l l l * (Nohubtype) l + 15iadw GACTACCAAGGTATGTTGCCCGTTTGTCCTCTACTTCCAGGAACATCAACTACCAGCACGGGACCATGCAAGACCTGCACGATTCC 28/a&,, ____________________-_______________________-_____--__________G----___-_--____________ __________________________---___________________________-____________----____---______ 30/adr G__-_---___-_____________________---_--_----___--__--____--____---___-_--_-______~--~ 65ladr ____________________--____-----_--__________-_____-_____----_-______~~ G____---_-___--Ollayr G-_____-_-______ __________________________---___-_-_____________________-_--_-_____-__ 08layr
(122) 390
460 15
28 30 65 01 08
400
410
420
430
490
500
510
520
440
450
TTTCGCAAt\;\TTCCTATGG~AGTGGGCCT~AGTCCGTTT~TCCTGGCTC~GTTTACTAG _______________________----___-____-_-_____--___--_______-_-_-___-G-__---_______-_______-----___--____--______-__________---G________--_--__-_-__---___-_--___--_-___-__--___-_____---G__--_-__--_____-_-_--_____-_-____--____--_-_____-_---___-G-__-_--__---_-________-_--T_-_-____________-______ (160)
Fig. 2. Nucleotide sequences nt 295-529 in the S gene is clones (Nos 30 and 65) and second letters
of the six HBV DNA clones from S-63. The sequence of 235 bp representing shown for the two ads clones (Nos 15 and 28), two each representative a& cr~r clones (Nos 01 and 08). The positions of nt 365 and 479, forming the of codons 122 and 160, respectively, are indicated by arrows.
HBsAg ClOW3S (No.isubtype) 277/a&v 207iadr 253ladr 225Iayw 227iayw
420
410
400
350
340
380
370
360
430
440
460
450
470
TGCTCACGG~AACTCTATG;TTCCCTCAT~TTGCTGTAC* -_____A__________________--_____--__-_______---____T_____-______-__--_--__-___~_--________ ______A______-__________--_____--__--__-____--_____T_____-_____--____--__-____~_--___~____ ______A__A_C________A____-_C____--__-________-T____T_____C_____-___-__-___-___~__-__C_____ ____--A__ACC-__-____A_--___C__-______--___--__T-__-T___--C--_--___~__________~-____~C~__~~
490
480 277 207 253 225 227
330
447
determinants
GATT*~CAAGGTATG~TGCCCGTTT*GTCCTCTA*T~CCAGGATCC~CAACAACCA*GTACC~TGCA~*ACCfC _____C____-__________-_______-______-____--______-___-_____-_____-____________________ ___-_C____-__________-______--__________---______-__________-__-__-___-_____--________ __C-_____--_________--_____-___-___-____--__TT__-_C_-___C__-_____A____G_T~~_____~~~_~~ _-~____--_______-__-__--_-_______-___---____~~_-__~_-__-~--__~~_-~__~~~~~~~~___~~-~~~-
390 277 207 253 225 227
with all four subtypic
320
310
300
particles
510
500
520
TTTCGCAA~*ATACCTATGG~AGTGGGCCT~AGTCCGTTT~TCTTGGCTC*AGTTTACTAG ________G_______________________-___-____-________________________G__________-___-______-___--_________~~___~~-_~~~-_____G_____T____________--______C___-___---________~~___~-_____G_____T_______-___--____---C_--____-__________--___--(160)
Fig. 3. Nucleotide sequences of the five HBV DNA clones from K-45. The sequence of 235 bp representing nt 295-529 of the S gene is shown for the a& clone (No. 277) two each representative adr clones (Nos 207 and 253) and ay\v clones (Nos 225 and 227). The positions of nt 365 and 479, forming the second letters of codons 122 and 160, respectively, are indicated by arrows.
were determined, they were grouped into adr and ayr clones differing in nt 365 of A or G. Similarly, HBV DNA clones from another serum containing HBsAg/aduu disclosed adw and adr clones differing in nt 479 of A or G. NIH 3T3 cells co-transfected with an HBV DNA clone of subtype adw and another clone of subtype adr produced and secreted HBsAg/adn,r into the culture medium. These results indicated an A-to-G point mutation at nt 365 or 479, and the simultaneous infection of hepatocytes with parent and mutant strains of different subtypes, as the mechanism for the production of HBsAg particles of “compound” subtypes. With these backgrounds, we attempted to sort out the mechanism for the production of HBsAg particles with all four subtypic determinants (adyw). HBV DNA clones were propagated from two sera containing HBsAg with the expression of all four determinants on the same particles. HBV DNA clones of different subtypes were reasonably postulated in these sera. and some of them would account for only a minor population of HBV contained in them. A
Table I. Two-by-two analysis for percentage divergence in the S gene sequence among six HBV DNA clones from the Japanese serum (S-63) containing HBsAg of subtype ar1.v~” HBV DNA clones (No.) Clones No. No. No. No. No. No.
I5 28 30 65 01 08
Subtype rrrht, UltM odr o& qYqr
15 0.4 0.4 0.9 1.3 1.7
28 ~ 0.9 1.3 1.7 2.1
30
0.4 0.9 1.3
65
1.3 1.7
01 ~_
1.3
substantial number of HBV DNA clones, therefore, had to be propagated in order not to miss minor HBV populations. PCR with an ability to amplify DNA sequences by more than lo’-fold (Saiki et al., 1988) was useful for propagating a number of HBV DNA clones from small amounts available for sera containing HBsAg of a rare subtype. For an impartial amplification of HBV DNA clones, it is required to use ohgonucleotide primers with sequences commonly possessed by them. The two primers used were a 20-mer representing nt 38-57 in the S gene and another 20-mer representing nt 531-550 of the complementary strand. These sequences are shared by all 23 HBV DNA clones for which the entire nucleotide sequences are reported (Galibert et al., 1979; Valenzuela et al., 1980; Fujiyama et al., 1983; Ono et al., 1983; Kobayashi and Koike, 1984; Bichko et al., 1985; Sastrosoewignjo et al., 1987; Okamoto et al., 1986, 1987a, 1988; Gan et al., 1987; Estacio et al., 1988; Vaudin et al., 1988). The ubiquity of primer sequences employed would insure indifferent amplification of HBV DNA in the original sera. Table 2. Two-by-two analysis for percentage divergence in the S gene sequence among five HBV DNA clones from the Kenya” serum (K-45) containing HBsAg of subtype adywP HBV DNA clones (No.)
08 Clones
-
“The SIX HBV DNA clones of three different subtypes were compared against each other for the sequence of 235 bp representing nt 295-529 in the S gene. Nucleotide divergences within this region between two clones are expressed as a percentage.
No. No. No. No. No.
277 207 253 225 227
Subtype
277
207
253
22s
227
O~IM adr adr UW UJ’M
1.7 1.7 8.5 8.9
0 8.5 8.9
8.5 8.9
0.4
-
“The five HBV DNA clones were compared against each other for the sequence of 235 bp representing nt 295-529 in the S gene. Nucleotide divergences are expressed as a percentage, and those greater than 8.0% are indicated in boldface.
448
TAno
YA~~.~NAKAc~~
HBV DNA clones of three different subtypes were propagated from the Japanese serum (S-63). Among 70 HBV DNA clones, subtype a& was identified in two (3%), adr in 10 (14%) and uyr in the remaining 58 (83%) by the single-track sequencing for A. Distribution of HBV DNA clones of the three subtypes was roughly in parallel with that of HBsAg particles of subtypes ud~., udr and c1J.rin the original serum at 5%, 18% and 64%, respectively. The S gene sequences (235 bp spanning nt 295-529) of two ad&t clones and two each representatives from udr and q’r clones were determined. and codons 122 and 160, for either lysine or arginine, were confirmed in correlation with the four subtypes (Okamoto et al., 1987~). It may be worth noting that these six HBV DNA clones displayed a divergence of only 0.4-2.1% (average 1.2%) within nt 295-529 (235 bp) in the S gene sequence. We have proposed four genotypes of HBV based on pair-wise comparison of the entire nucleotide sequences of I8 HBV DNA clones derived from different sera (Okamoto et al.. 1988). The four groups, designated A, B, C and D, display an intragroup difference of 5.6% or less, and an inter-group difference of 8.0% or greater. The intra- and intergroup differences in the entire sequence are applicable to the C gene and S gene sequences also (Okamoto et al., 1988). Furthermore, the percentage differences in the entire sequence. within and among the four genotypes, hold in a part of the S gene sequence of 235 bp representing nt 295-529 (unpublished observations). HBsAg/udykrr particles in the Japanese serum (S63) would have been produced by hepatocytes simultaneously infected with at ieast two HBV strains of different subtypes (uyr and odn~). Small differences (0.4-2.1%) in the S-gene sequence, exhibited by the six representative HBV DNA clones from S-63, indicate that HBV strains of different subtypes would have arisen by point mutations of a single predecessor strain, probably HBV/clyr most prevalent at the time of cloning (83%). Despite three different subtypes, all the six HBV DNA clones were categorized in Group C. a finding in favor of a single origin for them. Some HBV/UJY would have undergone to G-to-A point mutation at nt 365 in the S gene to produce an HBV mutant of subtype air. HBV/ud\c. would have been given rise to by either a single G-to-A point mutation of HBV/udr at nt 479 in the S gene, or double G-to-A point mutations of HBV/uyr at nt 365 and 479. Multiple point mutations of a single strain, is postulated as the mechanism for therefore, the production of HBsAg/uc/j,,t,r particles in S-63. HBsAgludrr or HBsAg;‘udnxr. found contemporaneously in S-63. would have been produced by hepatocytes simultaneously infected with HBV/ud! and HBV/uyr or with HBV,‘trd~cx and HBViudr. respectively. From the Kenyan serum containing HBsAgjad_\‘bvr (K-45). in contrast, HBV DNA clones with two
01.
different genotypic configurations were propagated. Two of the five clones were of subtype U-PM‘, as judged by the S gene sequence (nt 295-529), and categorized in Group D (Okamoto et al., 1988). The remaining three, one U&J and two adr clones, belonged to Group A, however. The dominance of HBV DNA clones of subtype udr, accounting for 73 (94%) of 78 clones obtained, would indicate that the Kenyan donor was originally infected with HBV/udr. HBVjudbv would have arisen from the parent HBV/udr by a G-to-A point mutation at nt 479 in the S gene. HBV,ludr and HBV/udk, would have been able to co-infect hepatocytes for the production of HBsAg/udwr. Hence, there would be hepatocytes which were doubly infected with a strain of HBV/udr in Group A and another strain of HBV/uybv in Group D. The observed difference of 8.5% or greater between HBV/udr and HBV/U~I~ clones was too great to be explained by point mutations of one HBV strain to make the other. When an individual carrying HBV of a particular subtype is infected with HBV of a different subtype, antibodies against subtype determinants of HBsAg, not shared by predecessor HBsAg, are usually elicited and the newcomer HBV is rejected (Koziol et ul., 1976; Le Bouvier et al., 1976; Sasaki et nl., 1976). A rare case of double infection with HBV strains of different subtypes is reported, however (van Kooten Kok-Doorschodt et al., 1972). Infection with HBV of a different subtype might be introduced to HBV carriers in early ages while immune responses are immature. or to those with hereditary or acquired immune disorders. REFERENCES
Bancroft W. H., Mundon
F. K. and Russell P. K. (1972) Detection of additional antigenic determinants of hepatitis B antigen. .I. Immun. 109, 842-848. Bichko V.. Pushko P., Dreilina D., Pumpen P. and Gren E. (1985) Subtype ayw variant of hepatitis B virus. DNA primary structure analysis. FE&S Left. 185, 20% 212. Courouc&Pauty A.-M., PlanGon A. and Soulier J. P. (1983) Distribution of HBsAg subtypes in the world. VOXSmp. 44, 197~211. Estacio R. C.. Chavez C. C., Okamoto H., Lingao A. L.. Reyes M. T.. Domingo E. and Mayumi M. (1988) Nucleotide sequence of a hepatitis B virus genome of subtype adw isolated from a Philippmo: comparison with the reported three genomes of the same subtype. J. Gusrroenterol. Hepta~ol. 3, 2 15%222. Fujiyama A.. Miyanohara A., Nozaki C., Yoneyama T.. Ohtomo N. and Matsubara K. (1983) Cloning and structural analyses of hepatitis B virus IjNAs. subtype rrdr. Nucl. Acids Res. 11, 46014610. Galibert F., Mandart E., Fitoussi F., Tiollais P. and Charnay P. (I 979) Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. co/i. Nature 281, 646450. Can R., Chu M.. Shen L., Qian S. and Li Z. (1987) The complete nucleotide sequence of the cloned DNA of hepatitis B virus subtype adr in pADR- I. Scienh Siniccr 30, 507 -52 1. Kobayashi M. and Koike K. (1984) Complete nucleotide sequence of hepatitis B virus DNA of subtype adr and its conserved gene organization. Gene 30, 227 -232.
HBsAg
particles
with all four subtypic
Kogan S. C.. Doherty M. and Gitschier J. (1987) An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences. Application to hemophilia A. IV. Engl. J. Med. 317, 985-990. Koziol D. E., Alter H. J., Kirchner J. P. and Holland P. V. (1976) The development of HBsAg-positive hepatitis despite the previous existence of antibody to HBsAg. J. Immun. 117, 2260-2262. Le Bouvier G. L. (1971) The heterogeneity of Australia antigen. J. ir!fecr. Dis. 123, 671475. Le Bouvier G. L., Capper R. A., Williams A. E., Pelletier M. and Katz A. J. (1976) Concurrently circulating hepatitis B surface antigen and heterotypic anti-HBs antibody. J. Immun. 117, 2262-2264. Mayumi M. and Nakajima M. (1973) Ergasteric hepatitis from tissue with Australia antigen. Ann. intern. Med. 79, 606. Mazzur S.. Burgert S. and Blumberg B. S. (1974) Geographical distribution of Australia antigen determinants d, y. and w. Nature 247, 38-40. Mazzur S.. Bureert S. and Le Bouvier G. (1975) Compound d+ y + particks of Australia antigen.‘ 1. immutt~ 114, 1510-1512. Nordenfelt E. and Le Bouvier G. (1973/74) Hepatitis B antigen with both d and y specificities on the same pa&es. Intervirology 2, 65-74: Okada K.. Kamivama I.. Inomata M.. Imai M., Miyakawa Y. and May&i M. (1976) e antigen and anti-d in the serum of asymptomatic carrier mothers as indicators of positive and negative transmission of hepatitis B virus to their infants. N. Engl. J. Med. 294, 746-749. Okamoto H., Imai M.. Shimozaki M., Hoshi Y., Iizuka H., Gotanda T., Tsuda F., Miyakawa Y. and Mayumi M. (1986) Nucleotide sequence of a cloned hepatitis B virus genome. subtype aJ>r: comparison with genomes of the other three subtypes. /. gen. Viral. 67, 2305-2314. Okamoto H., Imai M.. Kametani M., Nakamura T. and Mayumi M. (1987~) Genomic heterogeneity of hepatitis B virus in a 54-year-old woman who contracted the infection through materno-fetal transmission. Jap. J. exp. Med. 57, 231-236. Okamoto H., Imai M., Miyakawa Y. and Mayumi M. (19876) Site-directed mutagenesis of hepatitis B surface antigen sequence at codon 160 from arginine to lysine for conversion of subtypic determinant from r to w. Biochem. Biophys. Res. Commun. 148, 5OOG504. Okamoto H., Imai M., Tsuda F., Tanaka T., Miyakawa Y. and Mayumi M. (1987~) Point mutation in the S gene of hepatitis B virus for a d/y or w/r subtypic change in two blood donors carrying a surface antigen of compound subtype adyr or adwr. J. Viral. 61, 303Cb3034. Okamoto H., Tsuda F., Sakugawa H., Sastrosoewignjo R. I., Imai M., Miyakawa Y. and Mayumi M. (1988) Typing hepatitis B virus by homology in nucleotide sequence: comparison of surface antigen subtypes. J. gen. Viral. 69, 2575-2583. Okamoto H.. Omi S.. Wang Y., Itoh Y., Tsuda F., Tanaka T.. Akahane Y.. Miyakawa Y. and Mayumi M. (1989) The loss of subtypic determinants in alleles, d/y or w/r, on hepatitis B surface antigen. Molec. Immun. 26, 197-205. Ono Y., Onda H., Sasada R., Igarashi K., Sugino Y. and Nishioka K. (1983) The complete nucleotide sequences of
determinants
449
the cloned hepatitis B virus DNA; subtype adr and adw. Nucl. Acids Res. 11, 1747-1757. Paul D. A., Purcell R. H. and Peterson D. L. (1986) Use of monoclonal antibodies to determine if HBsAg of mixed subtype is one particle or two. J. Virol. Meth. 13, 43-53. Peterson D. L., Paul D. A., Lam J., Tribby I. I. E. and Achord D. T. (1984) Antigenic structure of hepatitis B surface antigen:‘identification of the “d” subtypeheterminant by chemical modification and use of monoclonal antibodies. J. Immun. 132, 920-927. Saiki R. K., Gelfand D. H., Stoffel S., Scharf S. J., Higuchi R., Horn G. T.. Mullis K. B. and Erlich H. A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-49 1. Sanuer F.. Nicklen S. and Coulson A. R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. n&n. Acad. Sri. U.S.A. 74, 5463-5467. Sasaki T., Ohkubo Y.. Yamashita Y.. Imai M., Miyakawa Y. and Mayumi M. (1976) Co-occurrence of hepatitis B surface antigen of a particular subtype and antibody to a heterologous subtypic specificity in the same serum. J. Immun. 117, 2258-2259. Sastrosoewignjo R. I., Omi S., Okamoto H.. Mayumi M., Rustam M. and Sujudi (1987) The complete nucleotide sequence of HBV DNA clone of subtype adw (pMND122) from Manado in Sulawesi island. Indonesia. ICMR Ann. 7, 51-60. Scotto J., Hadchouel M., Hery C., Yvart J., Tiollais P. and Brechot C. (1983) Detection of hepatitis B virus DNA in serum by a simple spot hybridization technique: comparison with results for other viral markers. Hepafology 3, 279-284. Tachibana K., Tanaka T., Usuda S., Okamoto H., Tsuda F., Akahane Y.. Miyakawa Y. and Mayumi M. (1989) Hepatitis B surface antigen with an excess or deficiency in subtypic determinants in sera from asymptomatic carriers in Japan. Viral Immun. 2, 25 29. Tiollais P.. Pourcel C. and Deiean A. (1985) The hepatitis B virus. Nuture 317, 489495. Usuda S., Tsuda F., Gotanda T., Tachibana K., Nomura M., Okamoto H., Imai M., Nakamura T., Miyakawa Y. and Mayumi M. (1986) A solid-phase enzyme immunoassay for the common and subtypic determinants of hepatitis B surface antigen with monoclonal antibodies J. Immun. Me/h. 87, 203S210. Valenzuela P., Quiroga M., Zaldivar J., Gray P. and Rutter W. J. (1980) The nucleotide sequence of the hepatitis B viral genome and the identification of the major viral genes. In Animal Virus Genetics (Edited by Fields B. N., Jaenisch R. and Fox C. F.). pp. 57 70. Academic Press, New York. van Kooten Kok-Doorschodt H. J., van den Akker R. and Gispen R. (1972) Determination and distribution of two types of hepatitis-associated antigen. J. infecr. Dis. 126, 117-122. Vaudin M., Wolstenholme A. J.. Tsiquaye K. N., Zuckerman A. J. and Harrison T. J. (1988) The complete nucleotide sequence of the genome of a hepatitis B virus isolated from a naturally infected chimpanzee. J. gen. Viral. 69, 1383S1389. Yamashita Y., Kurashina S., Miyakawa Y. and Mayumi M. (1975) South-to-north gradient in distribution of the r determinant of hepatitis B surface antigen in Japan. J. i@cr. Dis. 131, 567-569.
Vol.
21. No. 5, pp. 443449,
0161.5890/90 $3.00+0.00
1990
Pergamon Press plc
Printed in Great Britain.
HEPATITIS B SURFACE ANTIGEN PARTICLES WITH ALL FOUR SUBTYPIC DETERMINANTS: POINT MUTATIONS OF HEPATITIS B VIRUS DNA INDUCING PHENOTYPIC CHANGES OR DOUBLE INFECTION WITH VIRUSES OF DIFFERENT SUBTYPES TARO YAMANAKA,*
YOSHIHIRO AKAHANE,*
HIROAKI OKAMOTO,? and
HIROSHI SUZUKI,*
FUMIO TSUDA,~ Yuzo
MIYAKAWA~
MAKOTO MAYUMItr
*The First Department of Internal Medicine, Yamanashi Medical College, Yamanashi-Ken 409-38, Japan; tlmmunology Division, Jichi Medical School, Tochigi-Ken 329-04, Japan; ISection of Immunology, the Kitasato Institute, Tokyo 108, Japan: SMita Institute, Tokyo 108. Japan (First received
19 Sepremher 1989; accepted 25 October 1989)
Abstract-Hepatitis B surface antigen (HBsAg) particles carry the common determinant, LI, as well as d or y and M’or r subtype determinants, and are classified into the four major subtypes, i.e., adw, adr, UJW and ayr. Rare sera contain HBsAg particles with all four subtype determinants (adywr). Target sequences (nucleotides 388550) in the S gene of hepatitis B virus (HBV) DNA in two such sera were amplified by the polymerase chain reaction. Individual amplification products were cloned in an Ml3 phage vector. The HBV DNA clones obtained were subtyped by determining the second letters of codon 122 and 160 for lysine (AAA/AAG) or arginine (AGA/AGG), which specify the d or y and M’or r determinants, respectively. From one serum (S-63), two adw,, IO adr and 58 clt~ clones were obtained. When the two adw clones and two representatives each of the adr and air clones were compared against each other, for the sequence of 235 base pairs representing nucleotides 295-529 in the S gene, they differed only by 0.4-2.1% (average 1.2%). These results indicated multiple point mutations of a single HBV strain of subtype ayr and co-infection of hepatocytes with the original HBV strain and its mutant of subtype udw as the mechanism for the production of HBsAg/adynsr particles. From the other serum (K-45), 1 adw, 73 adr and 4 ayrr clones were obtained. The adv clone and two representative udr clones differed only by O&l.7% in the S gene sequences, but they differed by 8.5% or greater from two representative aq’u~clones, HBsAg/adynr particles in this serum. therefore, could be explained by double infection of hepatocytes with two HBV strains of different subtypes (adr and Unix).
INTRODUCTION B surface
Hepatitis protein
of hepatitis
antigen
(HBsAg)
B virus
(HBV),
is the envelope
and also occurs particles in the circu-
abundantly as small, non-viral lation of hosts. HBsAg has a common determinant named a, and in addition, one or other member from each of two pairs of mutually exclusive subtype determinants called d and y (Le Bouvier, 1971), and w and r (Bancroft et al., 1972). As a result, four major subtypes uyr.
of HBsAg
HBsAg
subtypes
are created, have
i.e. a&,
distinct
adr, ayw and
geographical
dis-
et al.,
1974; Courouct-Pauty et al., 1983), and help in tracing the route of HBV infection (Mayumi and Nakajima, 1973; Yamashita et al., 1975; Okada et al., 1976). There are exceptions to the four major subtypes. Rare HBsAg particles display three subtypic determitributions
(Mazzur
BAuthor to whom correspondence should be addressed. Abbreviations: HBV, hepatitis B virus; HBsAg, hepatitis B surface antigen; PCR, polymerase base pair(s); nt. nucleotide(s).
chain
reaction;
bp,
443
nants including both subtypic determinants in an allele (U&W, adyr, adwr and UWW), or even all four subtypic determinants (adywr). Nordenfeh and Le Bouvier (1973174) as well as Mazzur et al. (1975) were the first to note such “compound” HBsAg particles with excessive subtype determinants. Among sera from 5082 asymptomatic carriers in Japan, HBsAg particles with three subtype determinants were found in 70, and those with four determinants in four (Tachibana et al.. 1989). HBsAg particles, with an estimated mol. wt of 3 x 106, are made of the products of the pre-S 1, pre-S2 regions and the S gene of HBV DNA (Tiollais et al., 1985). A single amino acid substitution in the S gene product, composed of 226 amino acids, specifies the d or j’, as well as the u’ or r determinant (Peterson et al., 1984; Okamoto et al., 1987~). HBV DNA clones propagated from sera containing HBsAg with the d determinant have codon 122 for lysine, while those with the _r determinant have that for arginine. Similarly, u’ and r determinants are specified by codon 160 for lysine and arginine, respectively.
TAR0 YAMANAKA et
444
These amino acid changes are attributed, in turn, to a single nucleotide substitution from A to G, resulting in conversion of the codon for lysine (AAA or AAG) to arginine (AGA or AGG). Such nucleotide substitutions naturally occur in persistently infected hosts as the results of an A-to-G or G-to-A point mutation (Okamoto et al., 1987c), and can be artificially induced by site-directed mutagenesis (Okamoto et al., 19873). In essence, therefore, nucleotide (nt) 365 of A or G specifies the d or y determinant, and nt 479 of A or G w or r. HBsAg particles in a very exceptional serum had codon 160 for asparagine (AAC), despite nt 479 of A, and did not express either the w or r determinant (Okamoto et al., 1989). HBsAg particles with three subtype determinants are formed by the phenotypic mixing of two S gene products in hepatocytes infected with two HBV strains of different subtypes (Paul et al., 1986; Okamoto et al., 1987~). In order that HBsAg particles with all four subtypic determinants are produced, hepatocytes would have to be infected with at least two HBV strains that cover the four subtypic determinants of HBsAg. With the advent of the polymerase chain reaction [PCR (Saiki et al., 1988)], HBV DNA clones were propagated from two sera containing HBsAg/a&wr particles, and subtyped at the nucleotide level. Diversions in a part of the S gene sequence [235 base pairs (bp) representing nt 29555291 were evaluated, among HBV DNA clones obtained from each serum, to see if there were any genotypic differences by the criteria of Okamoto et al. (1988). MATERIALS
AND METHODS
Serum samples Rare serum samples were found which contained HBsAg with all four subtypic determinants on the same particles and subtyped as adywr. One of them (S-63) was from an asymptomatic carrier of HBsAg who donated a blood unit at a regional center of Japan Red Cross Association, and the other (K-45) was from a Kenyan blood donor. Subtypic determinants of HBsAg were detected by enzyme immunoassay with monoclonal antibodies (HBsAg Subtype EIA, Institute of Immunology Co. Ltd., Tokyo, Japan). Both sera contained HBV DNA detectable by dot blot hybridization (Scotto et al., 1983) with use of a radiolabeled HBV DNA probe (Okamoto et al., 1986). Separation of‘ HBsAg particles of various subtypes by afinity columns of monoclonal antibodies Four subtypic determinants detected in both indicated a possibility for HBsAg particles of different subtypes. They were the four regular types with two subtypic determinants (adw, aJw and ayr). and five “compound” subtypes
sera nine subadr, with
al.
three (adyw, adyr, adwr and aywr) or four subtypic determinants (adywr). Nine kinds of HBsAg particles with different subtypes were separated from each other by chromatography on affinity columns in which monoclonal antibodies to subtypic determinants were immobilized. Monoclonal antibody against the d determinant (anti-d, monoclonal No. 3423) monoclonal anti-l, (No. 3457), anti-w (No. 4111) and anti-r (No. 313) were employed (Usuda et al., 1986). The strategy for separating HBsAg particles of different subtypes is shown in Fig. 1. At each step of affinity chromatography, HBsAg particles retained by the column were eluted with 4 M MgClz and dialyzed against Tris-HCl buffer (10 mM, pH 7.6) containing 0.15 M NaCl and supplemented with 1% (v/v) fetal calf serum (Flow Laboratories, Virginia, U.S.A.). The retained and then eluted fraction, as well as the passed fraction, were processed successively to another affinity column, and fractions expected to contain HBsAg particles of nine different subtypes were finally obtained. Each fraction was assayed for the common determinant, a, as well as for d, _y. $1’and r subtype determinants, and different subtypes were confirmed. Further, the presence of subtype determinants on the same particles was ascertained by sandwiching them between monoclonal antibodies of different specificities. The percentage distribution of HBsAg particles of nine different subtypes was calculated based on the common determinant a. Isolation of DNA from serum Serum (100 p 1) was mixed with 300 p 1of Tris-HCl buffer (13.3 mM, pH 8.0) containing 6.7 mM EDTA, 0.67% (w/v) sodium dodecyl sulfate and 133 pgjml of proteinase K. The mixture was incubated for 3 hr at 70 C, and DNA was extracted with phenol-chloroform, and precipitated with ethanol in the presence of carrier tRNA (10 pg/ml). The precipitate was dissolved in 20 ~1 of Tris-HCl buffer (10 mM, pH 8.0) containing 1 mM EDTA (hereafter referred to as TE buffer). Amplification
qf HBV
DNA by PCR
Oligonucleotide primers, specific for the S gene sequence, were synthesized on a 380B DNA synthesizer (Applied Biosystems Japan, Tokyo, Japan). Primer Sl had a sequence of S’-TCGTGTTACAGGCGGGGTTT-3’, representing nt 38-57 in the S gene, and primer S2 was sequenced as 5’-CGAACCACTGAACAAATGGC-3’ representing nt 53 I-550 of the complementary strand. These primers were capable of amplifying a target sequence of 5 I3 base pairs (bp) in the S gene (nt 38-550) that included nt 365 and 479 forming a part of codon 122 and 160. respectively, for either lysine or arginine. Amplification with Tuy polymerase was carried out by the procedure described by Kogan et al. (1987) and Saiki et al. (1988) with a slight modification. Briefly, 10 ~1 of the solution containing HBV DNA
HBsAg particles with all four subtypic determinants
445
I
I
retained
,
J
passed
,
anti-w
retained
,
1
1
passed
anti-d
,
,
retained
1 4’” pissed
passed
anti-:
,
F-r
retained
“r passed
anti-r
retained
passed
S-63
2%
-
K-45
11%
-
Aretained
passed
10% 6%
-
64%
1%
5%
16%
-
1%
-
62%
Fig. 1. Separation of HBsAg particles of various subtypes by affinity column chromatography. Sera containing HBsAg particles with all four subtypic determinants (S-63 and K-45) were subjected to an affinity column to which monoclonal antibody against y determinant (anti-y) was conjugated. HBsAg particles retained by the column were eluted and, along with those passed by it, were applied to an anti-w column. Retained and passed fractions were applied to affinity columns of anti-d and anti-r successively. Finally obtained fractions were tested for the common determinant, a, by enzyme immunoassay and the percentage distribution of HBsAg of nine different subtypes was estimated. Fractions indicated by minuses contained less than 0.005% of the total HBsAg particles recovered. were heated at 95°C for 7 min to denature proteases in the sample. The reaction mixture was spun in a microcentrifuge for 5 set, and allowed to cool off at room temp. Target sequences (nt 38-550) were amplified in a 100-p 1 reaction volume containing heat-denatured HBV DNA, 1.5 mM each of the four dNTPs, 50 pM each of oligonucleotide primers (Sl and S2), 10% (v/v) dimethyl sulfoxide, 2.5 units of Taq polymerase (New England Biolabs, Massachusetts, U.S.A.) in a reaction buffer [67 mM Tris-HCl (pH 8.8) 16.6 mM 6.7 mM MgCl,, 10 mM 2-mercap(NH,)>SO,, toethanol. 6.7pLM EDTA and 170pg/ml of bovine serum albumin]. The reaction was performed for 25 cycles in a programmable DNA thermal cycler (PerkinElmer Cetus, Connecticut, U.S.A.). In each cycle, samples were heated at 94°C for 1 min, cooled and kept at 55’C for 1.5 min, and incubated at 72°C for 3 min. The reaction at 72-C was continued for 10 min in the last cycle to ensure the complete DNA extension. Sequencing of the amplified S-gene fragment Samples (50 ~1) containing amplified HBV DNA were digested with XbaI and SpeI (Takara Biochemicals, Kyoto, Japan). The XbaI-SpeI fragments of 437 bp were cloned into the XbaI site of the Ml3 mpl I phage vector (Amersham, Buckinghamshire, U.K.). The nucleotide sequence of 235 bp, representing nt 295-529 in the S gene, was determined by the dideoxy chain termination method (Sanger et al., 1977) using a synthetic oligonucleotide primer with a
sequence of 5’-CTGCGGCGTTTTATCAT-3’ (nt 229-245). The regular, four-track sequencing for A, G, C and T, as well as a single-track sequencing for A, was performed. RESULTS
HBsAg particles with various subtypes in the two sera The two sera containing HBsAg with the expression of all four subtypic determinants were subjected to chromatography on affinity columns of monoclonal antibodies against each subtypic determinant. The percentage distribution of HBsAg particles of nine different subtypes is indicated at the bottom of Fig. 1. HBsAg/adywr particles were found in 2% in the Japanese serum (S-63), and in 11% in the Kenyan serum (K-45). As regards the four regular subtypes, S-63 contained HBsAg particles of subtypes adw (So/,), adr (18%) and ayr (64%); HBsAg/ayw particles were not detected. These results indicated the infection of the Japanese donor with three HBV strains of different subtypes. Only two regular subtypes were seen in HBsAg of the Kenyan donor, i.e. adr (82%) and ayw (6%). The S gene sequences of HBV DNA clones,from the Japanese donor (S-63) From S-63, 70 recombinant Ml3 vectors containing a part of the S gene (437 bp representing nt 93-529) were propagated. They were subjected to
446
Tauo
YAMANAKA et al.
single-track sequencing for A. and subtyped by the presence or absence of A at nt 365 and 479; A( +) stood for d and A( -) for J’ at nt 365, and A( +) stood for u’ and A(-) for r at nt 479 (Okamoto ef (II., 1987~). HBV DNA of subtype adrr was identified in two clones (3%). adr in IO clones (14%) and clyr in the remaining 58 clones (83%). Nucleotide sequences (nt 2955529) of the two HBV DNA clones of subtype adw, and two representatives each from the udr and uyr clones were determined (Fig. 2). Clones with A at nt 365 and 479 had codons 122 and 160 for lysine (AAA or AAG), while clones without A at respective nucleotides had those codons for arginine (AGA or AGG). and subtypes were verified at the codon level. The S gene Kenyan
sequences
donor
of HBV
DNA
clones ,fivtn the
Nucleotide
dioergences subtypes
in
propuguted
HBV
DNA
,fktn
S-63
clones and
of
K-45
The six HBV DNA clones of three different subtypes propagated from the Japanese serum (S-63) were compared against each other for the divergence Clones
DISCUSSION
(K-45)
From K-45,78 HBV DNA clones containing a part of the S gene (nt 933529) were propagated. By singletrack sequencing for A, HBV DNA of subtype adw was identified in only one clone (I %), adr in 73 clones (94%) and U~M:in the remaining four clones (5%). Nucleotide sequences (nt 2955529) of the adw clone and two representatives each of the udr and u_r~’ clones were determined (Fig. 3). Amino acids deduced from codons 122 and 160 confirmed the results of subtyping by the single-track sequencing for A.
different
in the S gene sequence (nt 295-529), and the results were expressed as a percentage as listed in Table I. Similarly, percentage divergences were obtained for the five HBV DNA clones of three different subtypes from the Kenyan serum (K-45) as shown in Table 2. The six HBV DNA clones from S-63 were similar in the S gene sequence (nt 295-529) differing only by 0.4-2.1% with an average of 1.2%. In contrast, the five HBV DNA clones from K-45 were classified into two groups on the basis of sequence divergence. The rrdil*clone (No. 277) and two representative adr clones (Nos 207 and 253) were similar, differing only by f&1.7%. They were different from two representative a~,,‘ clones by 8.5-8.9%, however. The two u~r+ clones differed by only 0.4%.
300
310
320
330
HBsAg particles with both subtypic determinants in an allele, d and ,r or u’ and r, are produced by phenotypic mixing of the S gene products encoded by HBV DNAs of different subtypes infecting the same hepatocytes (Paul et al., 1986; Okamoto et al., 1987~). The subtype determinant dory is specified by lysine or arginine at codon 122 of the S gene, respectively, and u’ or r by lysine or arginine at codon 160 (Okamoto et al., 1987b, c). At the nucleotide level, these amino acid conversions are ascribed to nt 365 and nt 479 in the S gene of A or G, respectively. We previously reported the mechanism of HBsAg particles with excessive subtypic determinants (Okamoto et al., 1987~). When HBV DNA clones were propagated from serum containing HBsAg/a@r, and their S gene sequences of 678 bp 340
350
360
370
380
460
470
* * * * l l l * (Nohubtype) l + 15iadw GACTACCAAGGTATGTTGCCCGTTTGTCCTCTACTTCCAGGAACATCAACTACCAGCACGGGACCATGCAAGACCTGCACGATTCC 28/a&,, ____________________-_______________________-_____--__________G----___-_--____________ __________________________---___________________________-____________----____---______ 30/adr G__-_---___-_____________________---_--_----___--__--____--____---___-_--_-______~--~ 65ladr ____________________--____-----_--__________-_____-_____----_-______~~ G____---_-___--Ollayr G-_____-_-______ __________________________---___-_-_____________________-_--_-_____-__ 08layr
(122) 390
460 15
28 30 65 01 08
400
410
420
430
490
500
510
520
440
450
TTTCGCAAt\;\TTCCTATGG~AGTGGGCCT~AGTCCGTTT~TCCTGGCTC~GTTTACTAG _______________________----___-____-_-_____--___--_______-_-_-___-G-__---_______-_______-----___--____--______-__________---G________--_--__-_-__---___-_--___--_-___-__--___-_____---G__--_-__--_____-_-_--_____-_-____--____--_-_____-_---___-G-__-_--__---_-________-_--T_-_-____________-______ (160)
Fig. 2. Nucleotide sequences nt 295-529 in the S gene is clones (Nos 30 and 65) and second letters
of the six HBV DNA clones from S-63. The sequence of 235 bp representing shown for the two ads clones (Nos 15 and 28), two each representative a& cr~r clones (Nos 01 and 08). The positions of nt 365 and 479, forming the of codons 122 and 160, respectively, are indicated by arrows.
HBsAg ClOW3S (No.isubtype) 277/a&v 207iadr 253ladr 225Iayw 227iayw
420
410
400
350
340
380
370
360
430
440
460
450
470
TGCTCACGG~AACTCTATG;TTCCCTCAT~TTGCTGTAC* -_____A__________________--_____--__-_______---____T_____-______-__--_--__-___~_--________ ______A______-__________--_____--__--__-____--_____T_____-_____--____--__-____~_--___~____ ______A__A_C________A____-_C____--__-________-T____T_____C_____-___-__-___-___~__-__C_____ ____--A__ACC-__-____A_--___C__-______--___--__T-__-T___--C--_--___~__________~-____~C~__~~
490
480 277 207 253 225 227
330
447
determinants
GATT*~CAAGGTATG~TGCCCGTTT*GTCCTCTA*T~CCAGGATCC~CAACAACCA*GTACC~TGCA~*ACCfC _____C____-__________-_______-______-____--______-___-_____-_____-____________________ ___-_C____-__________-______--__________---______-__________-__-__-___-_____--________ __C-_____--_________--_____-___-___-____--__TT__-_C_-___C__-_____A____G_T~~_____~~~_~~ _-~____--_______-__-__--_-_______-___---____~~_-__~_-__-~--__~~_-~__~~~~~~~~___~~-~~~-
390 277 207 253 225 227
with all four subtypic
320
310
300
particles
510
500
520
TTTCGCAA~*ATACCTATGG~AGTGGGCCT~AGTCCGTTT~TCTTGGCTC*AGTTTACTAG ________G_______________________-___-____-________________________G__________-___-______-___--_________~~___~~-_~~~-_____G_____T____________--______C___-___---________~~___~-_____G_____T_______-___--____---C_--____-__________--___--(160)
Fig. 3. Nucleotide sequences of the five HBV DNA clones from K-45. The sequence of 235 bp representing nt 295-529 of the S gene is shown for the a& clone (No. 277) two each representative adr clones (Nos 207 and 253) and ay\v clones (Nos 225 and 227). The positions of nt 365 and 479, forming the second letters of codons 122 and 160, respectively, are indicated by arrows.
were determined, they were grouped into adr and ayr clones differing in nt 365 of A or G. Similarly, HBV DNA clones from another serum containing HBsAg/aduu disclosed adw and adr clones differing in nt 479 of A or G. NIH 3T3 cells co-transfected with an HBV DNA clone of subtype adw and another clone of subtype adr produced and secreted HBsAg/adn,r into the culture medium. These results indicated an A-to-G point mutation at nt 365 or 479, and the simultaneous infection of hepatocytes with parent and mutant strains of different subtypes, as the mechanism for the production of HBsAg particles of “compound” subtypes. With these backgrounds, we attempted to sort out the mechanism for the production of HBsAg particles with all four subtypic determinants (adyw). HBV DNA clones were propagated from two sera containing HBsAg with the expression of all four determinants on the same particles. HBV DNA clones of different subtypes were reasonably postulated in these sera. and some of them would account for only a minor population of HBV contained in them. A
Table I. Two-by-two analysis for percentage divergence in the S gene sequence among six HBV DNA clones from the Japanese serum (S-63) containing HBsAg of subtype ar1.v~” HBV DNA clones (No.) Clones No. No. No. No. No. No.
I5 28 30 65 01 08
Subtype rrrht, UltM odr o& qYqr
15 0.4 0.4 0.9 1.3 1.7
28 ~ 0.9 1.3 1.7 2.1
30
0.4 0.9 1.3
65
1.3 1.7
01 ~_
1.3
substantial number of HBV DNA clones, therefore, had to be propagated in order not to miss minor HBV populations. PCR with an ability to amplify DNA sequences by more than lo’-fold (Saiki et al., 1988) was useful for propagating a number of HBV DNA clones from small amounts available for sera containing HBsAg of a rare subtype. For an impartial amplification of HBV DNA clones, it is required to use ohgonucleotide primers with sequences commonly possessed by them. The two primers used were a 20-mer representing nt 38-57 in the S gene and another 20-mer representing nt 531-550 of the complementary strand. These sequences are shared by all 23 HBV DNA clones for which the entire nucleotide sequences are reported (Galibert et al., 1979; Valenzuela et al., 1980; Fujiyama et al., 1983; Ono et al., 1983; Kobayashi and Koike, 1984; Bichko et al., 1985; Sastrosoewignjo et al., 1987; Okamoto et al., 1986, 1987a, 1988; Gan et al., 1987; Estacio et al., 1988; Vaudin et al., 1988). The ubiquity of primer sequences employed would insure indifferent amplification of HBV DNA in the original sera. Table 2. Two-by-two analysis for percentage divergence in the S gene sequence among five HBV DNA clones from the Kenya” serum (K-45) containing HBsAg of subtype adywP HBV DNA clones (No.)
08 Clones
-
“The SIX HBV DNA clones of three different subtypes were compared against each other for the sequence of 235 bp representing nt 295-529 in the S gene. Nucleotide divergences within this region between two clones are expressed as a percentage.
No. No. No. No. No.
277 207 253 225 227
Subtype
277
207
253
22s
227
O~IM adr adr UW UJ’M
1.7 1.7 8.5 8.9
0 8.5 8.9
8.5 8.9
0.4
-
“The five HBV DNA clones were compared against each other for the sequence of 235 bp representing nt 295-529 in the S gene. Nucleotide divergences are expressed as a percentage, and those greater than 8.0% are indicated in boldface.
448
TAno
YA~~.~NAKAc~~
HBV DNA clones of three different subtypes were propagated from the Japanese serum (S-63). Among 70 HBV DNA clones, subtype a& was identified in two (3%), adr in 10 (14%) and uyr in the remaining 58 (83%) by the single-track sequencing for A. Distribution of HBV DNA clones of the three subtypes was roughly in parallel with that of HBsAg particles of subtypes ud~., udr and c1J.rin the original serum at 5%, 18% and 64%, respectively. The S gene sequences (235 bp spanning nt 295-529) of two ad&t clones and two each representatives from udr and q’r clones were determined. and codons 122 and 160, for either lysine or arginine, were confirmed in correlation with the four subtypes (Okamoto et al., 1987~). It may be worth noting that these six HBV DNA clones displayed a divergence of only 0.4-2.1% (average 1.2%) within nt 295-529 (235 bp) in the S gene sequence. We have proposed four genotypes of HBV based on pair-wise comparison of the entire nucleotide sequences of I8 HBV DNA clones derived from different sera (Okamoto et al.. 1988). The four groups, designated A, B, C and D, display an intragroup difference of 5.6% or less, and an inter-group difference of 8.0% or greater. The intra- and intergroup differences in the entire sequence are applicable to the C gene and S gene sequences also (Okamoto et al., 1988). Furthermore, the percentage differences in the entire sequence. within and among the four genotypes, hold in a part of the S gene sequence of 235 bp representing nt 295-529 (unpublished observations). HBsAg/udykrr particles in the Japanese serum (S63) would have been produced by hepatocytes simultaneously infected with at ieast two HBV strains of different subtypes (uyr and odn~). Small differences (0.4-2.1%) in the S-gene sequence, exhibited by the six representative HBV DNA clones from S-63, indicate that HBV strains of different subtypes would have arisen by point mutations of a single predecessor strain, probably HBV/clyr most prevalent at the time of cloning (83%). Despite three different subtypes, all the six HBV DNA clones were categorized in Group C. a finding in favor of a single origin for them. Some HBV/UJY would have undergone to G-to-A point mutation at nt 365 in the S gene to produce an HBV mutant of subtype air. HBV/ud\c. would have been given rise to by either a single G-to-A point mutation of HBV/udr at nt 479 in the S gene, or double G-to-A point mutations of HBV/uyr at nt 365 and 479. Multiple point mutations of a single strain, is postulated as the mechanism for therefore, the production of HBsAg/uc/j,,t,r particles in S-63. HBsAgludrr or HBsAg;‘udnxr. found contemporaneously in S-63. would have been produced by hepatocytes simultaneously infected with HBV/ud! and HBV/uyr or with HBV,‘trd~cx and HBViudr. respectively. From the Kenyan serum containing HBsAgjad_\‘bvr (K-45). in contrast, HBV DNA clones with two
01.
different genotypic configurations were propagated. Two of the five clones were of subtype U-PM‘, as judged by the S gene sequence (nt 295-529), and categorized in Group D (Okamoto et al., 1988). The remaining three, one U&J and two adr clones, belonged to Group A, however. The dominance of HBV DNA clones of subtype udr, accounting for 73 (94%) of 78 clones obtained, would indicate that the Kenyan donor was originally infected with HBV/udr. HBVjudbv would have arisen from the parent HBV/udr by a G-to-A point mutation at nt 479 in the S gene. HBV,ludr and HBV/udk, would have been able to co-infect hepatocytes for the production of HBsAg/udwr. Hence, there would be hepatocytes which were doubly infected with a strain of HBV/udr in Group A and another strain of HBV/uybv in Group D. The observed difference of 8.5% or greater between HBV/udr and HBV/U~I~ clones was too great to be explained by point mutations of one HBV strain to make the other. When an individual carrying HBV of a particular subtype is infected with HBV of a different subtype, antibodies against subtype determinants of HBsAg, not shared by predecessor HBsAg, are usually elicited and the newcomer HBV is rejected (Koziol et ul., 1976; Le Bouvier et al., 1976; Sasaki et nl., 1976). A rare case of double infection with HBV strains of different subtypes is reported, however (van Kooten Kok-Doorschodt et al., 1972). Infection with HBV of a different subtype might be introduced to HBV carriers in early ages while immune responses are immature. or to those with hereditary or acquired immune disorders. REFERENCES
Bancroft W. H., Mundon
F. K. and Russell P. K. (1972) Detection of additional antigenic determinants of hepatitis B antigen. .I. Immun. 109, 842-848. Bichko V.. Pushko P., Dreilina D., Pumpen P. and Gren E. (1985) Subtype ayw variant of hepatitis B virus. DNA primary structure analysis. FE&S Left. 185, 20% 212. Courouc&Pauty A.-M., PlanGon A. and Soulier J. P. (1983) Distribution of HBsAg subtypes in the world. VOXSmp. 44, 197~211. Estacio R. C.. Chavez C. C., Okamoto H., Lingao A. L.. Reyes M. T.. Domingo E. and Mayumi M. (1988) Nucleotide sequence of a hepatitis B virus genome of subtype adw isolated from a Philippmo: comparison with the reported three genomes of the same subtype. J. Gusrroenterol. Hepta~ol. 3, 2 15%222. Fujiyama A.. Miyanohara A., Nozaki C., Yoneyama T.. Ohtomo N. and Matsubara K. (1983) Cloning and structural analyses of hepatitis B virus IjNAs. subtype rrdr. Nucl. Acids Res. 11, 46014610. Galibert F., Mandart E., Fitoussi F., Tiollais P. and Charnay P. (I 979) Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. co/i. Nature 281, 646450. Can R., Chu M.. Shen L., Qian S. and Li Z. (1987) The complete nucleotide sequence of the cloned DNA of hepatitis B virus subtype adr in pADR- I. Scienh Siniccr 30, 507 -52 1. Kobayashi M. and Koike K. (1984) Complete nucleotide sequence of hepatitis B virus DNA of subtype adr and its conserved gene organization. Gene 30, 227 -232.
HBsAg
particles
with all four subtypic
Kogan S. C.. Doherty M. and Gitschier J. (1987) An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences. Application to hemophilia A. IV. Engl. J. Med. 317, 985-990. Koziol D. E., Alter H. J., Kirchner J. P. and Holland P. V. (1976) The development of HBsAg-positive hepatitis despite the previous existence of antibody to HBsAg. J. Immun. 117, 2260-2262. Le Bouvier G. L. (1971) The heterogeneity of Australia antigen. J. ir!fecr. Dis. 123, 671475. Le Bouvier G. L., Capper R. A., Williams A. E., Pelletier M. and Katz A. J. (1976) Concurrently circulating hepatitis B surface antigen and heterotypic anti-HBs antibody. J. Immun. 117, 2262-2264. Mayumi M. and Nakajima M. (1973) Ergasteric hepatitis from tissue with Australia antigen. Ann. intern. Med. 79, 606. Mazzur S.. Burgert S. and Blumberg B. S. (1974) Geographical distribution of Australia antigen determinants d, y. and w. Nature 247, 38-40. Mazzur S.. Bureert S. and Le Bouvier G. (1975) Compound d+ y + particks of Australia antigen.‘ 1. immutt~ 114, 1510-1512. Nordenfelt E. and Le Bouvier G. (1973/74) Hepatitis B antigen with both d and y specificities on the same pa&es. Intervirology 2, 65-74: Okada K.. Kamivama I.. Inomata M.. Imai M., Miyakawa Y. and May&i M. (1976) e antigen and anti-d in the serum of asymptomatic carrier mothers as indicators of positive and negative transmission of hepatitis B virus to their infants. N. Engl. J. Med. 294, 746-749. Okamoto H., Imai M.. Shimozaki M., Hoshi Y., Iizuka H., Gotanda T., Tsuda F., Miyakawa Y. and Mayumi M. (1986) Nucleotide sequence of a cloned hepatitis B virus genome. subtype aJ>r: comparison with genomes of the other three subtypes. /. gen. Viral. 67, 2305-2314. Okamoto H., Imai M.. Kametani M., Nakamura T. and Mayumi M. (1987~) Genomic heterogeneity of hepatitis B virus in a 54-year-old woman who contracted the infection through materno-fetal transmission. Jap. J. exp. Med. 57, 231-236. Okamoto H., Imai M., Miyakawa Y. and Mayumi M. (19876) Site-directed mutagenesis of hepatitis B surface antigen sequence at codon 160 from arginine to lysine for conversion of subtypic determinant from r to w. Biochem. Biophys. Res. Commun. 148, 5OOG504. Okamoto H., Imai M., Tsuda F., Tanaka T., Miyakawa Y. and Mayumi M. (1987~) Point mutation in the S gene of hepatitis B virus for a d/y or w/r subtypic change in two blood donors carrying a surface antigen of compound subtype adyr or adwr. J. Viral. 61, 303Cb3034. Okamoto H., Tsuda F., Sakugawa H., Sastrosoewignjo R. I., Imai M., Miyakawa Y. and Mayumi M. (1988) Typing hepatitis B virus by homology in nucleotide sequence: comparison of surface antigen subtypes. J. gen. Viral. 69, 2575-2583. Okamoto H.. Omi S.. Wang Y., Itoh Y., Tsuda F., Tanaka T.. Akahane Y.. Miyakawa Y. and Mayumi M. (1989) The loss of subtypic determinants in alleles, d/y or w/r, on hepatitis B surface antigen. Molec. Immun. 26, 197-205. Ono Y., Onda H., Sasada R., Igarashi K., Sugino Y. and Nishioka K. (1983) The complete nucleotide sequences of
determinants
449
the cloned hepatitis B virus DNA; subtype adr and adw. Nucl. Acids Res. 11, 1747-1757. Paul D. A., Purcell R. H. and Peterson D. L. (1986) Use of monoclonal antibodies to determine if HBsAg of mixed subtype is one particle or two. J. Virol. Meth. 13, 43-53. Peterson D. L., Paul D. A., Lam J., Tribby I. I. E. and Achord D. T. (1984) Antigenic structure of hepatitis B surface antigen:‘identification of the “d” subtypeheterminant by chemical modification and use of monoclonal antibodies. J. Immun. 132, 920-927. Saiki R. K., Gelfand D. H., Stoffel S., Scharf S. J., Higuchi R., Horn G. T.. Mullis K. B. and Erlich H. A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-49 1. Sanuer F.. Nicklen S. and Coulson A. R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. n&n. Acad. Sri. U.S.A. 74, 5463-5467. Sasaki T., Ohkubo Y.. Yamashita Y.. Imai M., Miyakawa Y. and Mayumi M. (1976) Co-occurrence of hepatitis B surface antigen of a particular subtype and antibody to a heterologous subtypic specificity in the same serum. J. Immun. 117, 2258-2259. Sastrosoewignjo R. I., Omi S., Okamoto H.. Mayumi M., Rustam M. and Sujudi (1987) The complete nucleotide sequence of HBV DNA clone of subtype adw (pMND122) from Manado in Sulawesi island. Indonesia. ICMR Ann. 7, 51-60. Scotto J., Hadchouel M., Hery C., Yvart J., Tiollais P. and Brechot C. (1983) Detection of hepatitis B virus DNA in serum by a simple spot hybridization technique: comparison with results for other viral markers. Hepafology 3, 279-284. Tachibana K., Tanaka T., Usuda S., Okamoto H., Tsuda F., Akahane Y.. Miyakawa Y. and Mayumi M. (1989) Hepatitis B surface antigen with an excess or deficiency in subtypic determinants in sera from asymptomatic carriers in Japan. Viral Immun. 2, 25 29. Tiollais P.. Pourcel C. and Deiean A. (1985) The hepatitis B virus. Nuture 317, 489495. Usuda S., Tsuda F., Gotanda T., Tachibana K., Nomura M., Okamoto H., Imai M., Nakamura T., Miyakawa Y. and Mayumi M. (1986) A solid-phase enzyme immunoassay for the common and subtypic determinants of hepatitis B surface antigen with monoclonal antibodies J. Immun. Me/h. 87, 203S210. Valenzuela P., Quiroga M., Zaldivar J., Gray P. and Rutter W. J. (1980) The nucleotide sequence of the hepatitis B viral genome and the identification of the major viral genes. In Animal Virus Genetics (Edited by Fields B. N., Jaenisch R. and Fox C. F.). pp. 57 70. Academic Press, New York. van Kooten Kok-Doorschodt H. J., van den Akker R. and Gispen R. (1972) Determination and distribution of two types of hepatitis-associated antigen. J. infecr. Dis. 126, 117-122. Vaudin M., Wolstenholme A. J.. Tsiquaye K. N., Zuckerman A. J. and Harrison T. J. (1988) The complete nucleotide sequence of the genome of a hepatitis B virus isolated from a naturally infected chimpanzee. J. gen. Viral. 69, 1383S1389. Yamashita Y., Kurashina S., Miyakawa Y. and Mayumi M. (1975) South-to-north gradient in distribution of the r determinant of hepatitis B surface antigen in Japan. J. i@cr. Dis. 131, 567-569.
