Proc. Natl. Acad. Sci. USA Vol. 89, pp. 7300-7304, August 1992 Biochemistry

Hepatocyte nuclear factor la is expressed in a hamster insulinoma line and transactivates the rat insulin I gene (insulin gene expression/transcription/tissue specificty)

LEISHA A. EMENS*, DIANE W. LANDERSt, AND LARRY GENE MOSS*tt Departments of *Cell Biology and tMedicine, Baylor College of Medicine, Houston, TX 77030

Communicated by Roger H. Unger, April 24, 1992

suggest that HNF1 itself or related factors may play a role in transcriptional regulation of the rat insulin I gene. HNFla was originally characterized as a liver-specific transcription factor that binds an A+T-rich sequence present in the promoters of many genes, including (3-fibrinogen, a1-antitrypsin, and albumin, transcribed primarily in the liver (3, 4). Subsequent work extended the tissue distribution of HNFla messenger RNA to include the kidney, intestine, and spleen (5). Two characteristics distinguish the protein from other homeodomain-containing transcription factors; it contains an additional 21-amino acid loop within the DNAbinding region (6) and dimerizes via an N-terminal domain (7). A related factor with similar dimerization and DNAbinding motifs, HNF1f3 (LF-B3, vHNF1), displays a tissue distribution distinct from, but overlapping with, that of HNFla (8-10). The two factors are thought to comprise part of a system that regulates the differentiation of specialized epithelia. Here we report the expression of HNFla in the pancreatic islet 3-cell-derived insulinoma cell line HIT.§ Furthermore, we show that HNFla specifically binds to and transactivates multimerized rat insulin I gene enhancers containing a natural HNF1 site. These observations define an unusual role for HNFla outside of the hepatocyte and suggest that it may be one of a complex array of factors that together maintain tissue-specific and physiologic regulation of insulin gene transcription.

ABSTRACT Systematic mutational analysis previously identified two primary regulatory elements within a minienhancer (-247 to -198) of the rat insulin I promoter that are critical for transcriptional activity. The Far box (-241 to -232) and the FLAT element (-222 to -208) synergistically upregulate transcription and, together, are sufficient to confer tissue-specific and glucose-responsive transcriptional activity on a heterologous promoter. Detailed analysis of the FLAT element further revealed that, in addition to the positive regulatory activity it mediates in tandem with the Far box, it is a site for negative regulatory control. A portion of the FLAT element bears considerable sequence imilarit to the consensus binding site for hepatocyte nuclear factor la (HNFla; LF-B1), a liver-enriched homeodomain-containing transcription factor. Here we show that the HNFl-like site within the FLAT element exhibited positive transcriptional activity in both HepG2 and HIT cells and bound similar, but distnguihable, nuclear protein complexes in the respective nuclear extracts. Screening of a hamster ulioma cDNA library with a PCR-derived probe encompassing the DNA-binding domain of rat HNFla resulted in isolation of a hmsIr HNFla (hHNFla) cDNA bomolog. Specific antiserum identified the HNFla protein as one component of a specific FLAT-binding complex in HIT nuclear extracts. Expression ofthe hHNFla cDNA in COS cells resulted in transactivation of reporter constructs containing multimerized segments ofthe rat insulin I minienhanr. Thus, HNFla, one component of a DNA-binding complex involved in transcriptional regulation of the rat insulln I gene, may play a significant role in nonhepatic as well as hepatic gene transcription.

MATERIALS AND METHODS Lsolation and Analysis of cDNA Clones. Rat liver poly(A)+ RNA was used to generate a reverse transcriptase PCRderived probe encompassing the homeodomain region of rat HNFla (LF-B1). This probe was used to screen 500,000 plaques from a hamster insulinoma cell (HIT-T15 M.2.2.2) Agtll cDNA library (11) at medium stringency (12). Three positive clones designated 2, 2.5, and 3.5 showed strong sequence similarity to the known sequence for rat HNFla. Sequence similarity for clone 2.5 was found to extend into both 5' and 3' untranslated regions; this cDNA insert was subcloned into pBluescript and bidirectionally sequenced by using a series of 5' and 3' exonuclease deletions (13). Phmid Constrcton. Multimers were constructed from oligonucleotides (see Table 1) synthesized with BamHI and Bgl II sites on opposite ends; oligonucleotides were annealed and incubated with T4 DNA ligase in the presence ofBamHI and Bgl II to produce unidirectional ligation and size fractionated. Five-copy multimers were subcloned into either the Bgl II site of pTE2Asn [-109 thymidine kinase chloramphenicol acetyltransferase (CAT)] (14) or the BamHI site of -36

The expression of the insulin gene in the adult mammal is specifically localized to (3 cells of the pancreatic islet and is tightly regulated by blood glucose concentration. Detailed studies have defined a small region (-247 to -198) in the promoter of the rat insulin I gene, the FF-minienhancer, capable of conferring both tissue-specific and glucoseresponsive transcriptional activity on a heterologous promoter (1). It is composed of two primary regulatory elements, the Far box (-241 to -232) and the FLAT element (-222 to -208), which interact to strongly upregulate transcription. Further analysis characterized the FLAT element as a cluster of several cis loci that mediates discrete positive and negative activities (2). The activity of a positive locus, FLAT-F, is revealed only upon mutation of the adjacent negative locus, FLAT-E. This functional complexity is reflected by its ability to specifically bind a number of DNA-binding proteins (2). Notably, the sequence of the FLAT-F element bears significant similarity to the consensus binding site for hepatocyte nuclear factor 1 (HNF1; LF-B1), a liver-enriched homeodomain-containing transcription factor. Such similarity could

Abbreviations: HNFla, hepatocyte nuclear factor la; hHNFla, hamster HNFla; CAT, chloramphenicol acetyltransferase. tTo whom reprint requests should be addressed. §The sequence reported in this paper has been deposited in the GenBank data base (accession no. M95297).

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

7300

Biochemistry: Emens et al. prolactin CAT (15) or S8AABam (-85 insulin CAT) (2). The pBShHNFla and pBJ5hHNFla plasmids were constructed by subcloning the 2.5-kilobase phage insert into the EcoRI site of pBluescript or the pBJ5 expression vector (16), respectively. The pBJ5 vector, designed for COS cell expression, contains the Simian virus 40 origin of replication and the SRa promoter (17). Electrophoretic Mobility-Shift Assays. Nuclear extracts (18, 19) were prepared from the hamster insulinoma line HIT-T15 M.2.2.2 (20), the human hepatoma line HepG2, and the fibroblast-derived line COS-1. Radioactive probes were prepared by labeling one strand in the presence of [.-32P]ATP and T4 DNA kinase, annealing it to an excess of the opposite strand, and resolving the reaction over G50 Sepharose columns. Gel mobility-shift assays were performed with 15 ktg of nuclear extract in a reaction mixture of 10 mM Hepes, pH 7.8/75 mM KCl/2.5 mM MgCl2/0.1 mM EDTA/1 mM dithiothreitol/3% Ficoll/2 ,ug of poly(dI-dC):poly(dI-dC) (2). Competitions included 100-fold molar excess of unlabeled probe, while antisera experiments incorporated 1 ,ul of either preimmune or HNFla-specific antiserum. In each case, reaction mixtures were preincubated at room temperature for 5 min before addition of labeled probe. After incubation of complete reaction mixtures at room temperature for 15 min, reactions were resolved on 4.5% polyacrylamide gels in 0.5x TBE (lx TBE = 90 mM Tris/64.6 mM boric acid/2.5 mM EDTA, pH 8.3) and autoradiographed. Cell Lines and Transfections. The HIT cell line was grown as described (14). HepG2 and COS-1 cell lines were grown in Dulbecco's modified Eagle's medium with 10%6 fetal calf serum. Cells at a density of 2 x 106 cells per 100-mm dish were cotransfected with 5 pg of test plasmid and 3 ug of cytomegalovirus P-galactosidase (CMVf8gal) (21) internal control plasmid by the calcium phosphate technique (22). Transactivation experiments were similarly performed with 2 pg of test plasmid, 5 jg of pBJ5hHNFla expression vector or control DNA [pUC18 or pBJ5 with hamster HNFla (hHNF1a) in the antisense orientation], and 3 pg of CMVBgal plasmid. CAT activity of extracts prepared 48 hr after transfection (22) is expressed in arbitrary units of relative CAT activity normalized to assayed (-galactosidase activity. Data are given as means of three independent determinations.

RESULTS HepG2 and HIT Cells Contain Similar HNFl-like Binding Activities. The A+T-rich FLAT element in the 5' flanking region of the rat insulin I gene bears significant sequence similarity to the consensus binding site for the liver-enriched transcription factor HNF1 (Table 1). To examine the potential relationship between HNF1-related factors and proteins involved in FLAT-mediated rat insulin I gene transcription, Table 1. Sequence comparison of HNF1 sites and rat insulin I FLAT elements f3}Fibrinogen* GATCTGTCAAATATTAACTAAAGGG GATCTTGGTTAATATTCACCG al-Antitrypsint Albumint GATCTTGGTTAGTAATTACTAAG HNF1 consensus TGGTTAATNATTAACAA Rat insulin I FLAT§ GATCTTGTTAATAATCTAATTACCG Rat insulin I FLAT-F§ GATCTTGTTAATAATCGACTGACCG Rat insulin I FLAT-E§ GATCTTGGT M AATCTAATTACCG Rat insulin I FLAT-M§ GATCTTGGTU&AATCGAQTfACCG *Rat *-fibrinogen HNF1 site at position -84 (3). tHuman ai-antitrypsin HNF1 site at position -63 (23, 24). tHuman albumin HNF1 site at position -358 (25). §Rat insulin I FLAT element at position -222 (2). Mutated nucleotides are underlined. Sequences of the FLAT element derivatives are shown. FLAT-M designates the FLAT element with both F and E sites mutated.

Proc. Natl. Acad. Sci. USA 89 (1992)

7301

we screened nuclear extracts from hepatoma (HepG2), in-

sulinoma (HIT-T15 M.2.2.2), and fibroblast-derived (COS-1) cell lines by gel mobility-shift analysis (Fig. 1). Probes included the wild-type FLAT element, the two subelements FLAT-F (E-site mutant) and FLAT-E (F-site mutant), and a probe with both the FLAT-F and FLAT-E sites mutated, FLAT-M (Table 1). The quality of the nuclear extracts was demonstrated by their ability to bind a CCAAT sequence previously shown to interact with proteins from a variety of cell types (Fig. 1A Left) (26, 27). HepG2 and HIT extracts contained activities (bands I and II) that bound known HNF1 sites in the *-fibrinogen, al-antitrypsin, and albumin genes (Fig. 1A Middle). The factors in HepG2 cells were less abundant or had lower binding affinities for the probes than proteins in HIT nuclear extracts. These complexes also had slightly altered migration rates compared to those in HIT cells (bands I and II), suggesting that the two cell types may contain distinct protein complexes that exhibit similar binding specificities. The rat insulin I FLAT element also bound proteins (bands III and IV) present in HepG2 and HIT nuclear extracts (Fig. 1A Right). Interestingly, while the complex previously defined as representing the FLAT-F activity in HIT nuclear extracts (band III) (2) was not detected in HepG2 when probed with the wild-type FLAT site, the specific FLAT-F probe revealed a binding pattern similar to those seen in HepG2 extracts with probes containing known HNF1 sites. This observation lends further support to the hypothesis that HepG2 and HIT cells may contain factors that display similar but subtly distinct binding specificities. Little binding activity was present in COS cell nuclear extracts. We examined potential differences in binding specificity by competition with excess unlabeled probe (Fig. 1B). Binding of proteins to the (3-fibrinogen probe in both HepG2 (bands I and II) and HIT (band III) nuclear extracts was blocked by competition with the 3-fibrinogen HNF1 site, the wild-type FLAT element, and the FLAT-F site, but not by the FLAT-E element or the FLAT-M probe (Fig. 1B Left). A complex in HepG2 extracts binding to the wild-type FLAT element (which comigrates with band V present in HIT extracts) was blocked by competition with the ,3-fibrinogen probe and all FLAT region probes except the double-mutant probe FLAT-M. Taken together, these data define the rat insulin I FLAT element as a specific HNF1-binding site and identify HNF1-like binding activity in insulinoma cell nuclear extracts. All binding to the wild-type FLAT element in HIT extracts was blocked by competition with the f-fibrinogen HNF1 site; competition using probes derived from the FLAT element reproduced previous data defining distinct specificities for the FLAT-F (band IV) and FLAT-E (band V) binding complexes (2) (Fig. 1B Right). These data extend those findings by suggesting that the band present in HepG2 nuclear extracts that comigrates with band V may represent a factor related to the HIT cell FLAT-E repressor (band V). The FLAT-M probe was unable to compete for any binding activity in HIT nuclear extracts. An unusual binding activity (band VI) appeared with competition using both f-fibrinogen sites and FLAT element probes in HepG2, but not HIT, nuclear extracts. Although it is unclear what this complex represents, its binding was unaltered by the addition of antiserum specific for HNFla (8) to the reaction mixture, suggesting that HNFla was not a part of the complex (data not shown). The (-Fibrinogen and FLAT-F Elements Are Transcriptionally Active in HepG2 and HIT Cells. The rat insulin I gene is normally transcribed only in (3 islet cells and insulinoma cell lines, a specificity recapitulated by the ability of the natural insulin promoter to upregulate reporter gene activity in HIT cells (14) but not HepG2 or COS cells (data not shown). Linker scanning mutational analysis identified the FLAT

liA

_~.0

Proc. Natl. Acad. Sci. USA 89 (1992)

Biochemistry: Emens et al.

7302

PROBE

3FIB

CCAAT

ax

AT

0

NUCLEAR

0D

n

n

I) I

EXTRACT

ALB

0

)

1 a

C)

I in

*

.0

:,.;t

B

A..

NUCLEAR EXTRACT

0

,n I

= 110 1 I .... _

_

0.

_

_

nv-bor VW

0

n

co

m

_

.

a FIG. 1. HepG2 and HIT nuclear extracts contain factors that bind

-

rat insulin I FLAT element

1 site

E

°

HIT

HepG2

HIT

II 0h

O &LX

D-

= 10

m-11-u

-

c-

C

COMPETITOR

0

I

0

(

---

'--

1*

a

HepG2 0

0

cn

FLAT-M

FLAT-E

.*

Pfibrinogen HNF

PROBE

FLAT-F

Tl~~~ or--

I

)

a

W

FLAT

I

- r

1!

'I tam

cm

I~~~LFL

0

FL

LL IL.

c

Fe