Experimental Parasitology 144 (2014) 44–51

Contents lists available at ScienceDirect

Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr

Heterogeneity of the internal transcribed spacer region in Leishmania tropica isolates from southern Iran Mohammad Amin Ghatee a, Iraj Sharifi b, Katrin Kuhls c, Zahra Kanannejad d, Majid Fasihi Harandi e, Marcos E. de Almeida f, Gholamreza Hatam g, Hossein Mirhendi h,⇑ a

Cellular and Molecular Research Center, Yasuj University of Medical Sciences, Yasuj, Iran Leishmaniasis Research Center, Kerman University of Medical Sciences, Kerman, Iran Division of Molecular Biotechnology and Functional Genomics, Technical University of Applied Sciences Wildau, Germany d Department of Immunology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran e Department of Parasitology and Mycology, School of Medicine, Kerman University of Medical Sciences, Kerman, Iran f Division of Parasitic Diseases and Malaria, Center for Global Health, Centers for Disease Control and Prevention, Public Health Service, U.S. Department of Health and Human Services, Atlanta, USA g Basic Sciences in Infectious Diseases Research Center, School of Medicine, University of Medical Sciences, Shiraz, Iran h Department of Parasitology and Mycology, School of Public Health, National Institute of Health Research, Tehran University of Medical Sciences, Tehran, Iran b c

h i g h l i g h t s

g r a p h i c a l a b s t r a c t

 Four haplotypes were identified

South Iran L. tropica isolates

among the south Iran L. tropica isolates.  All variations occurred in microsatellite regions and were due SNP.  Iranian L. tropica consists of at least two different populations.  The southeast Iranian L. tropica showed a homogeneous population structure.  The south Iranian population was phylogenetically closer to Indian isolates.

a r t i c l e

i n f o

Article history: Received 7 November 2013 Received in revised form 9 May 2014 Accepted 3 June 2014 Available online 14 June 2014 Keywords: Leishmania tropica ITS Heterogeneity Sequence analysis Iran

Bam district and the cies Kerman and Shiraz

ITS-PCR

Sequence analysis

(Species idenficaon)

Phylogenic analysis of sequences (comparison

of sequences to those of other World endemic regions)

Four sequence types among 61 L. tropica isolates Southeast L. tropica homogeneous populaon structure Phylogenecally closer to the Indian sequences than to isolates from other regions

a b s t r a c t Most of cutaneous leishmaniasis cases occur in only 7 countries, including Iran. Leishmania tropica is the main cause of anthroponotic cutaneous leishmaniasis in Iran. In order to study the heterogeneity and phylogeny of L. tropica in southern Iran, a total of 61 isolates were obtained from Bam district and the cities Kerman and Shiraz. The internal transcribed spacer (ITS) from the ribosomal DNA locus was amplified and then analysed by sequencing. Analysis of the ITS sequences showed four haplotypes in the isolates, including 3 haplotypes among the 58 isolates from the south eastern region, including Bam district and Kerman city, and 2 haplotypes among the 3 isolates from Shiraz city. The results showed a monophyletic structure for the south eastern population. In comparison to GenBank sequences of L. tropica from different countries, most of the southeast Iranian and Indian isolates are comprised in one cluster, while isolates from other countries and few other Iranian isolates group in a different cluster. Analysis of ITS sequences of south eastern L. tropica showed a homogeneous population which could be the basis for other molecular epidemiology studies using more discriminative markers and tracing possible changes in the population structure of L. tropica. Ó 2014 Published by Elsevier Inc.

⇑ Corresponding author. Fax: +98 2188951392. E-mail address: [email protected] (H. Mirhendi). http://dx.doi.org/10.1016/j.exppara.2014.06.003 0014-4894/Ó 2014 Published by Elsevier Inc.

Kinetoplasd DNAPCR

M.A. Ghatee et al. / Experimental Parasitology 144 (2014) 44–51

1. Introduction Leishmania tropica is commonly known as the causative agent of anthroponotic cutaneous leishmaniasis (ACL) in the Old World; however, several studies revealed also zoonotic evidences for L. tropica from Africa and the Middle East (Sang et al., 1994; Jacobson et al., 2003; Talmi-Frank et al., 2010). This species was also found to be sporadically involved in causing visceral leishmaniasis (Magill et al., 1993; Sacks et al., 1995). The vast distribution area of L. tropica ranges from Greece (Zakynthos Island), North Africa (Morocco and Tunisia), and new foci in south Sahara (Kenya and Namibia) to the Middle East and Southwest Asia (Turkey, Syria, Iran, Iraq) and it is further reaching to the north-western states Punjab and Rajasthan of India (Jacobson, 2003). Phlebotomus sergenti is the most important vector of L. tropica, while Pipistrellus arabicus and Phlebotomus guggisbergi are the main vectors in western Middle East in the northern Galilee focus and in Kenya, respectively (Jacobson et al., 2003; Lawyer et al., 1991). In Iran ACL is found in large or medium-sized cities and their outskirts. It is estimated to be most prevalent in the Bam district of the Kerman province (Sharifi et al., 2012; Razmjou et al., 2009; Sharifi et al., 1998) and Bam city is a wellknown focus of ACL. Kerman and Shiraz are large cities of the southern provinces Kerman and Fars, respectively, which are also recognized as important foci of ACL (Sharifi et al., 1998; WHO, 2002). L. tropica is the dominant species in Bam district and Kerman city, since almost all CL cases were caused by this species (Sharifi et al., 2012). Several studies have been performed for a better understanding of population structure and phylogenetic differentiation of Leishmania within different species. Such studies provide a basis for tracing epidemiological changes and recognizing pattern of these changes. Most studies in the Old World were focussed on the Leishmania donovani complex and Leishmania major, while only a few contributed to investigation of polymorphisms of L. tropica (Schwenkenbecher et al., 2006; Schwenkenbecher et al., 2004; Schönian et al., 2001; Pratlong et al., 1991). The level of Leishmania intra-specific variation has been surveyed by different approaches. The gold standard for Leishmania typing is still multilocus enzyme electrophoresis (MLEE) (Rioux et al., 1990), and it has been applied in many different studies (Rioux et al., 1990; Pratlong et al., 1991; Oskam et al., 1998; Nimri et al. 2002). Nevertheless, MLEE needs mass cultivation of parasites and is considered as a time consuming method with restricted discriminatory power (Schönian et al., 2011). Other studies applied different DNA-based approaches to survey Leishmania isolates at different taxonomic levels, such as the intra-specific variation. Among these methods are analysis of restriction fragment length polymorphisms (RFLP) and sequencing of various targets (Cupolillo et al., 1995; Noyes et al., 1998; Schönian et al., 2001; Mauricio et al., 2001; Morales et al., 2001; Garcia et al., 2005; Laurent et al., 2007; El-Tai et al., 2001), random amplified polymorphic DNA (RAPD) analysis (Andersen et al., 1996; Zemanová et al., 2004), multilocus sequence typing (MLST) (Mauricio et al., 2006; Zemanová et al., 2007), and multilocus microsatellite typing (MLMT) (Bulle et al., 2002; Schwenkenbecher et al., 2004; Kuhls et al., 2008). Sequence analysis was used in our study because RAPD needs culturing of parasites due to the fact that short, non-specific primers can recognize both host and parasite sequences. Furthermore, the reproducibility of this technique is not reliable between different trials. Moreover, except for kDNA, RFLP has not enough discriminatory power for differentiation of close strains (Morales et al., 2001; Schönian et al., 2011). On the other hand, MLMT and MLST are strongly able to show the variation between the strains, but the

45

methods are not simple to perform (Schönian et al., 2008) and need separate PCR setup for each primer pairs. The ITS region of ribosomal DNA has been targeted in several studies in order to evaluate the genetic differences of Leishmania (El-Tai et al., 2000; Schönian et al., 2000; Schönian et al., 2001; Cupolillo et al., 2003; Kuhls et al., 2005; Almedia et al., 2011). The multi-copy nature of ITS makes it suitable for direct amplification from the clinical samples. Therefore, the present study aims to apply the sequence analysis of the ITS region to evaluate the heterogeneity of L. tropica in clinical samples obtained from patients in southern Iran. The main goal of the study is to survey the genetic heterogeneity of L. tropica in different regions of the Bam district and to compare it with two other foci of the disease in the south of Iran. 2. Materials and methods 2.1. Samples (strains) and study area A total of 150 smear preparations were obtained from the patients referring to cutaneous leishmaniasis control centres in Bam and Kerman cities (Kerman province), and Shiraz city (Fars province) (Fig. 1). Because ACL is most prevalent in the Bam district we collected most samples from different regions of this district. The other samples were from the cities Kerman and Shiraz. The samples were taken by scraping the internal border of the skin lesions with a surgical blade, transferred to glass slides and stained by Giemsa stain. The slides were microscopically examined and grouped into five categories according to the numbers of amastigotes (negative, trace, 1+, 2+, and 3+). The 2+ and 3+ slides were selected for further evaluation. Finally, 48, 10, and 3 samples were obtained from Bam district, and the cities Kerman and Shiraz, respectively (Table 1). Thirty-one CL samples were primarily collected in Shiraz, however only few of them were identified as L. tropica. The origin of the samples are presented in Table 1 and illustrated in geospatial maps (Fig. 1) which were provided by ESRI- ArcMap 9.3 software from ArcGis software’s package (copyright 1999–2008 ESRI Inc). 2.2. DNA extraction Skin tissue smears were scratched and collected in 1.5 ml microtubes containing lysis buffer (Tris 100 mM, EDTA 10 mM, NaCl 100 mM, SDS 1%, Triton X100 2%). Then, 10 lg/ml Proteinase K was added and the samples were incubated at 56 °C for one hour and then extracted once with phenol/chloroform (25:24 v/v) and once again with chloroform. DNA was precipitated with equal volumes of iso-propanol and also one tenth volume of 3 M NaAc, washed with 70% ethanol, dried, and suspended in 50 ll ultrapure water. 2.3. Kinetoplastid DNA PCR Kinetoplastid DNA (kDNA) of all the samples was amplified by using the primers 13Z (50 -ACT GGG GGT TGG GTG TAA AAT AG-30 ) and LiR (50 -TCG CAG AAC GCC CCT-30 ) (Noyes et al., 1998) for species identification. The PCR mixture consisted of 12.5 ll of 2 premix (Ampliqon, Denmark), 20 pmol of each primer, 5 ll of template DNA, and water up to 25 ll. The cycling PCR conditions were 95 °C for 5 min followed by 35 cycles of 94 °C for 45 s, 55 °C for 60 s, and 72 °C for 90 s in an Applied Biosystems thermocycler. The PCR products were subjected to 1.2% agarose gel electrophoresis with 0.5 lg/ml ethidium bromide for 90 min at 80 V in TBE buffer and visualized by a transiluminator. A 100 bp DNA ladder was used in each run as size standard.

46

M.A. Ghatee et al. / Experimental Parasitology 144 (2014) 44–51

Fig. 1. (A) Map showing the two provinces Kerman and Fars included in the present study, as well as the position of the Bam district in Kerman province. (B) Map of the Bam district and the surrounding counties. The villages and cities which patients came from were presented by triangles.

Table 1 Samples of Leishmania tropica used in this study. Southern Iranian foci

Province

District

Southeast

Kerman

Bam district

Middle

East

West South

Southwest Total

Fars

Kerman district Shiraz district

2.4. ITS- PCR The ITS region of the ribosomal DNA, including ITS1, 5.8SrDNA and partial ITS2, was amplified by applying the primers LITSR (50 -CTG GAT CAT TTT CCG ATG-30 ) (El-Tai et al., 2000) and LITS MG (50 -ATG GCC AAC GCG AAG TTG-30 ) (Ghatee et al., 2013). The

Villages/cities

Number of samples

Bam city Baravat Pakam Baghchamak Bidaran-Kohneh Khajeasqar Ghaleh-shahid Badrabad Kamranieh Mohammadabad-Sheikh Mohammadabad-Moshk Toranj Azizabad-Dehno Fahraj (Fahraj county) Tarz Dehbakri Chehel-tanan

21 4 1 1 1 1 6 1 1 1 1 1 1 2 2 1 1 1

Mohammadabad (Rigan county) Kerman city Shiraz city

10 3 61

PCR mixture consisted of 25 ll of 2 premix (Ampliqon, Denmark), 20 pmol of each primer, 10 ll of template DNA, and water up to 50 ll reaction volume. The cycling program included a primary step of 95 °C for 5 min followed by 35 cycles of 94 °C for 45s, 57 °C for 60s, and 72 °C for 90 s. Electrophoresis and visualizing were performed under the same conditions as described above.

47

M.A. Ghatee et al. / Experimental Parasitology 144 (2014) 44–51

2.5. Sequence analysis The PCR bands were excised from the gel and purified by Bioneer gel purification kit (cat. No. K-3035) according to the manufacturer’s instructions. The yielded products were submitted to Bioneer Company (Korea) for sequence analysis. Sequencing was carried out by an Applied Biosystems 3730 XL automated DNA sequencer. 2.6. Phylogenetic analysis of sequences Species identification of the samples were reconfirmed by comparison with published ITS sequences by searching the GenBank database using the BLAST (Basic local alignment search tool) software (http://www.ncbi.nlm.nih.gov). The obtained sequences were analysed by Geneious Pro 5.5.6 software (Drummond et al., 2011, available from http://www.geneious.com). Phylogenetic trees were inferred by using representatives of our sequences as well as all 22 relevant L. tropica ITS sequences which have been deposited in GenBank. Neighbour Joining (NJ) trees were inferred from distances calculated using the Kimura 2 parameter model, and most parsimonious trees using the character based Maximum Parsimony (MP) method, after trimming all sequences at both ends. Tree construction was performed by MEGA 4 (Tamura et al., 2007). Bootstrap values for the NJ and MP methods were based on 1000 replicates. Nucleotide distance between L. tropica ITS-sequences were showed by BioEdit software (version 7.0.5.3) (Hall 1999). 3. Results With kDNA-PCR all the samples collected from Bam district and Kerman city were identified as L. tropica based on the speciesspecific size (750 bp) of the PCR product (Noyes et al., 1998). However, of the 31 smears collected from patients from different regions in Shiraz and its suburbs, only 9 cases (29%) were L. tropica of which only 3 preparation slides could be selected regarding the parasite load. The other 22 samples (71%) were identified as L. major (560 bp). All isolates primary typed by kDNA-PCR as L. tropica were finally reconfirmed based on their ITS sequences as L. tropica by comparison with ITS sequences deposited in the GenBank database using BLAST. A total of 48 L. tropica samples were sequenced from the Bam district. Of these, forty-five were from patients living in the east,

Table 2 Age distribution of the patients. Age (years)

Frequency

Percent

0–10 10–20 20–30 30–40 40–50 50–60 >60 Total

20 12 13 7 2 1 6 61

32.8 19.7 21.3 11.5 3.3 1.6 9.8 100

south, west, and centre of the Bam district and 3 patients came from neighbouring eastern and southeastern counties who had referred to the Bam Leishmaniasis control centre. All the sequenced L. tropica samples from Kerman (n = 10) and Shiraz (n = 3) belonged to patients living in those cities. Overall, 57.4% of the patients (35 cases) were female and 42.6% (26 cases) were male. Of the Bam samples 60.4% of cases were female and 39.6% were male. The frequencies of infected patients according to their age are given in Table 2. The majority of cases were children in the age between 1 day and 10 years and most cases were among 7 years old patients. The smallest number of cases was observed in the age group of 50–60 years. The most frequent lesion sites were respectively the face (32.8%), the left hand (26.2%), the right hand (18%), both hands (8.2%), the left leg (6.6%), the right leg (5%), the neck (1.6%) and both hands and left leg (1.6%). Amplification of the ITSMG amplicon resulted in bands of about 800 bp for all isolates. The results showed four different sequence types among the 61 studied isolates. Among them, 56 isolates belong to haplotype A which was found in all different foci including Bam district, Kerman and Shiraz cities. Three isolates, of which two were obtained from Bam district (one from Bam city and another from Baravat city) and the other from Kerman city, belong to haplotype B. Haplotype C was specific for Shiraz city and was found only in a single isolate. Haplotype D was found for one isolate from Kerman city. The distribution and the respective frequencies of the four haplotypes according to the three studied sampling sites are shown in Table 3. Sequence types A, B and D differed in only a single position each in comparison to each other with all of them in the ITS1, sequence type C showed differences in two positions, one in ITS1 and the other in the partial ITS2 (Fig. 2). To evaluate the general sequence variability of the ITS region within L. tropica from different endemic regions of the world and to establish the phylogenetic position of the south Iranian strains in relation to other endemic regions, all available respective sequences were retrieved from Genbank and used for phylogenetic tree inference. The strains used as representatives for each of the four sequence types found in south Iran as well as their accession numbers are shown in Table 4. The overall comparison of nucleotide variation between sequences of L. tropica from different regions of the world with south Iranian isolates and also comparison of the intra country or region variation is shown in Table 5. The unrooted Maximum Parsimony tree (Fig. 3) showed two main clades I and II. Clade I included the south Iranian (Bam, Kerman, and Shiraz) samples together with previously described Indian isolates (de Almeida et al., 2011). Except for the haplotype C (isolate 44) from Shiraz, all south Iranian isolates were accumulated in a single subclade within clade I. In addition, some sequences from India evolved as a sister group within this subclade of haplotypes A, B, D. Isolate 44 from Shiraz (haplotype C) formed a basal branch to the above-mentioned subclade. Other sequences of Indian strains formed a second subclade within clade I. Clade II included isolates from Africa (Tunisia, Namibia, Kenya), former Soviet Union, Afghanistan, and Pakistan. There were also several isolates from unspecified origin in Iran in this clade II. The isolate from Tunisia was the most distantly related one to all other ones, that were comprised in a single subclade. The distance

Table 3 The distribution and the respective frequencies of the four haplotypes according to the three studied sampling sites. Origin

Overall number of isolates

Haplotype A

Haplotype B

Bam (district) Kerman (city) Shiraz (city)

48 10 3

46 8 2

2 1

Haplotype C

Haplotype D 1

1

48

M.A. Ghatee et al. / Experimental Parasitology 144 (2014) 44–51

Haplotype Haplotype Haplotype Haplotype

A B C D

(Bam) (Bam) (Shiraz) (Kerman)

10 20 30 40 50 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CTTGTGGGGGGTTTTTTTTT-GTATATGTTTTGAGCCCCTCCGGATAATATATGTAATATCCGGAAAGGGTGTATGTGTCGTTTGAAAATATGAGCTTCA ....................T............................................................................... ......T.............-............................................................................... ....................-......................T........................................................

Haplotype Haplotype Haplotype Haplotype

A B C D

(Bam) (Bam) (Shiraz) (Kerman)

650 660 670 680 690 700 710 720 730 740 .|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|.... AGAAAGAGAGAGGTAAAAGAGAGGAGAAAAAAGTAGTTTTTTCCCCCTCTCTTTTTTCTCCCTCTTTTTTTCCCCCAGCTCCCTCTCCGACACTGGTCCTA ..................................................................................................... ...........................................................................................-......... .....................................................................................................

Fig. 2. The SNP positions in the south Iranian L. tropica ITS locus. Four haplotypes were identified.

Table 4 Representatives of studied isolates for each of the four haplotypes found in south Iran. Accession number

Sample number

Haplotype

Origin

JX560475 JX560479 JX560481 JX560476 JX560477 JX560480 JX560482 JX560478

Isolate Isolate Isolate Isolate Isolate Isolate Isolate Isolate

A A A B B B C D

Bam city Kerman city Shiraz city Bam district-Baravat Bam city Kerman city Shiraz city Kerman city

28 57 45 22 21 51 44 60

Table 5 Number of nucleotide variations among sequences that were used in the tree construction. A L. major ITS sequence from Iran (used as outgroup) showed much more variations in comparison to all L. tropica sequences. Origin

Nucleotides [bp] variation to south Iranian L. tropica

Intra country or region variations [bp]

Kenyan Namibian Tunisian Russian (S.U.) Pakistani Afghan Other Iranian Indian South Iranian Iranian L. major

43–44 43–44 43–44 41–45 44–46 44–47 41–45 3–11 0 134–137

– – – 2–4 4 6 2–8 1–10 1–3

between our haplotypes ranged from 0.0000 to 0.0018 and the greatest distance was between haplotypes C and D. The distance between the sequences of the studied south Iranian strains and the other L. tropica sequences deposited in GenBank used in this study ranged from 0.0018 to 0.0129. The NJ (not shown) and MP trees had nearly identical topologies.

4. Discussion The ITS as a marker for differentiation of Leishmania at species and strain level has been used in different studies (El Tai et al., 2001; Schönian et al., 2001; Berzunza-Cruz et al., 2002; Schönian et al., 2003; Kuhls et al., 2005; Pandey et al., 2007; de Almeida et al., 2011; Raju et al., 2012) including several studies in Iran (Tashakori et al., 2006; Parvizi et al., 2005, 2008, 2012; Dabirzadeh et al., 2012; Ghatee et al., 2013). Only few studies were performed using ITS sequence analysis to compare L. tropica isolates from different origins (Schönian et al., 2001; Khanra et al., 2011; Talmi-Frank et al., 2010; Bousslimi et al., 2012). In our study four haplotypes were identified among the 61 samples collected in the main ACL foci in the south of Iran. Similar as observed for the L. donovani complex (Kuhls et al., 2005), in the present L. tropica sequence haplotypes all variations occurred in microsatellite

regions and were due to single nucleotide polymorphisms (SNP). The dominant haplotype in the three foci Bam district, Kerman city in southeast and Shiraz city in southwest was haplotype A. Other haplotypes were rare in comparison to haplotype A although haplotype B was reported from both southeastern foci Bam district and Kerman city. Haplotype D and C as the rarest haplotypes were merely reported from Kerman city and Shiraz city, respectively. Comparison of each of the four to those from other countries and regions showed that A is the most similar one to the Indian sequences in the clade I, while C and B were the most different to those Indian sequences. B was the most different one in comparison to the sequences of strains from Middle East, Africa, former S.U. and other unspecified Iranian regions. Table 4 shows that the degree of nucleotide variation of sequences of strains from different regions of the world in comparison to the south Iranian sequence types was very high in comparison to the Indian strains. The topology of the phylogenetic tree revealed two distinct clades. Clade I included isolates from south Iran and India. The tree topology showed that all isolates of Bam, Kerman, and Shiraz representing haplotypes A, B and D were members of the same subclade, except a single sample from Shiraz (haplotype C) which branched as an independent taxon. The tree showed a homogeneous structure of the southeastern Iranian L. tropica population. However, since we found two divergent haplotypes among the three isolates from Shiraz, more extensive studies on the degree of heterogeneity of L. tropica from southwest Iran would be necessary. Interestingly, the tree also showed that a group of Indian strains was more closely related to south Iranian isolates than haplotype C from Iran, while other Indian isolates were comprised in an independent subclade that had a basal position in clade I. Traditional cultural and economic relationships both from land routes and sea which have established between old Iran and the Indian subcontinent especially through the southeast region of Iran may explain the similarity of L. tropica populations in these regions of the world. The second clade was comprised of African L. tropica, including the East, South and North African isolates and Asian L. tropica, including those from the Middle East including Iranian sequences from other unspecified regions and from the former Soviet Union. The Iranian strains found in clade II were more similar to L. tropica strains from the eastern and northern neighbour countries of Iran than to the south and especially southeastern Iranian isolates, indicating that there might exist at least two genetically distinct L. tropica populations in Iran. So far only three sequences from other Iranian sites were available in GenBank, therefore a comprehensive study with samples from all endemic foci of Iran is urgently needed to prove this hypothesis. The probable existence of two genetically divergent populations of L. tropica in Iran could perhaps be linked with biogeographical differences in the respective parts of the country. The southeastern endemic region is surrounded by deserts with a specific adapted flora and fauna. The north and west Iran is in contrast covered by the Alborz and Zagros mountain chains that have green nature and high animal and plant diversity and density. Restricted

M.A. Ghatee et al. / Experimental Parasitology 144 (2014) 44–51

49

Fig. 3. Unrooted maximum parsimony tree (shown as phylogram) inferred from the ITS sequences of 8 representatives of the 61 samples from south Iran studied including all four haplotypes found and all 22 L. tropica sequences available in Genbank from different countries. Numbers above the branches indicate the bootstrap values for 1000 replicates.

bio-relationship might be cause of the difference of the L. tropica population in the southeast region in comparison to other parts of Iran. In summary, the study results showed that Iranian L. tropica consists of at least two different populations. The southeast Iranian L. tropica showed a homogeneous population structure. Haplotype A is the most frequent one in south Iran and haplotype B was the most different haplotype in comparison to L. tropica from other countries and also from other parts of Iran. Interestingly, the south Iranian population was phylogenetically closer to Indian isolates than to isolates which were obtained from other parts of Iran. South Iranian and Indian isolates were sufficiently divergent from the African and other existing Asian isolates, including those from other parts of Iran, to cause the formation of a unique clade. Although L. tropica has been believed to be the most heterogeneous species in the Old World, the degree of sequence variability in the ITS region within southern Iranian isolates is very low. The ITS region seems to be not enough variable at strain level in a confined region while it seems a more suitable marker for studies at this level including strains from very different endemic regions

and for species identification. Tashakori and colleagues also showed only five very similar genotypes among L. major isolates obtained from different Iranian endemic regions by sequence analysis of ITS1 and ITS2 (Tashakori et al., 2006). This is why more variable markers as the microsatellites should be used for further studies in Iran. Microsatellites are hypervariable co-dominant and non-coding markers that are distributed in the whole genome and MLMT was shown to be the most powerful method for intra-species population structure identification in Leishmania (Kuhls et al., 2008; Schönian et al., 2011). However, for MLMT a species-specific or species-complex-specific set of 14–21 markers has to be analysed for each strain (Schwenkenbecher et al., 2006; Ochsenreither et al., 2006; Kuhls et al., 2008; Schönian et al., 2011), which needs for large-scale samples considerable funds when carried out by capillary sequencers and fluorescence labelled primers or which is labor intensive and time consuming when carried out by conventional PAGE or metaphor agarose gel electrophoresis. This is one reason why single variable markers with lower resolution power such as ITS or kDNA are still used for intraspecies studies in developing countries (Dabirzadeh et al., 2012,

50

M.A. Ghatee et al. / Experimental Parasitology 144 (2014) 44–51

Subba Raju et al., 2012). So far there is a single study applying MLMT population structure inference of L. tropica (Schwenkenbecher et al., 2006), however no samples from Iran were included, The present study provides basic data on genetic diversity of L. tropica in the southern Iranian provinces Kerman and Fars, also in comparison to other endemic regions in Iran and other countries. These results will be used for further molecular epidemiology surveys applying hypervariable microsatellite markers and for recognition and following up epidemiological changes as well as for control measures. Acknowledgments This investigation was supported by the Research Vice-Chancellor of Kerman University of Medical Sciences. The authors would also like to thank Mrs Z. Mahmoudian, Mrs N. Jalali Zand, Mrs P. Habibi and Dr Z. Babaie for their technical support. They are very grateful for National Institute of Health Research staff’s help. References Andersen, K., Ibrahim, M.E., Theander, T.G., Kharazmi, A., 1996. Random amplified polymorphic DNA for thee differentiation of Leishmania donovani isolates from Sudan. Trans. R. Soc. Trop. Med. Hyg. 90, 204–205. Berzunza-Cruz, M., Cabrera, N., Crippa-Rossi, M., Sosa, C.T., Perez- Montfort, R., Becker, I., 2002. Polymorphism analysis of the internal transcribed spacer and small subunit of ribosomal RNA genes of Leishmania mexicana. Parasitol. Res. 88, 918–925. Bousslimi, N., Ben-Ayed, S., Ben-Abda, I., Aoun, K., Bouratbine, A., 2012. Natural infection of North African gundi (Ctenodactylus gundi) by Leishmania tropica in the focus of cutaneous leishmaniasis, Southeast Tunisia. Am. J. Trop. Med. Hyg. 86, 962–965. Bulle, B., Millon, L., Bart, J.M., Gallego, M., Gambarelli, F., Portus, M., Schnur, L., Jaffe, C.L., Fernandez-Barredo, S., Alunda, J.M., Piarroux, R., 2002. Practical approach for typing strains of Leishmania infantum by microsatellite analysis. J. Clin. Microbiol. 40, 3391–3397. Cupolillo, E., Brahim, L.R., Toaldo, C.B., de Oliveira-Neto, M.P., de Brito, M.E., Falqueto, A., Naiff de Farias, M., Grimaldi Jr., G., 2003. Genetic polymorphism and molecular epidemiology of Leishmania (Viannia) braziliensis from different hosts and geographic areas in Brazil. J. Clin. Microbiol. 41, 3126–3132. Cupolillo, E., Grimaldi Jr., G., Momen, H., Beverley, S.M., 1995. Intergenic region typing (IRT): a rapid molecular approach to the characterization and evolution of Leishmania. Mol. Biochem. Parasitol. 73, 145–155. Dabirzadeh, M., Mirmohammad sadeghi, H, Baghaie, M., Hejazi, H., 2012. Genetic polymorphism of Leishmania major in two hyper endemic regions of Iran revealed by PPIP-PCR and ITS-RFLP. Arch. Iran. Med. 15, 151–156. de Almeida, M.C., Steurer, F.I., Koru, O., Herwaldt, B.L., Pieniazek, N.J., da Silva, A.J., 2011. Identification of Leishmania spp. by molecular amplification and DNA sequencing analysis of a fragment of rRNA internal transcribed spacer. J. Clin. Microbiol. 49, 3143–3149. Drummond AJ Ashton B, Buxton S, Cheung M, Cooper A, Duran C, Field M, Heled J, Kearse M, Markowitz S, Moir R, Stones-Havas S, Sturrock S, Thierer T, Wilson A (2011) Geneious v5.5 available from http://www.geneious.com. El Tai, N.O., Osman, O.F., El Fari, M., Presber, W., Schönian, G., 2000. Genetic heterogeneity of ribosomal internal transcribed spacer (ITS) in clinical samples of Leishmania donovani spotted on filter papers as revealed by single-strand conformation polymorphisms (SSCP) and sequencing. Trans. R. Soc. Trop. Med. Hyg. 94, 575–579. El Tai, N.O., El Fari, M., Mauricio, I.L., Miles, M.A., Oskam, L., El Safi, S., Presber, W.H., Schönian, G., 2001. Leishmania donovani: intraspecific polymorphisms of Sudanese isolates revealed by PCR-based analyses and DNA sequencing. Exp. Parasitol. 97, 35–44. Garcia, A.L., Kindt, A., Quispe-Tintaya, K.W., Bermudez, H., Llanos, A., Arevalo, J., Bañuls, A.L., De Doncker, S., Le Ray, D., Dujardin, J.C., 2005. American tegumentary leishmaniasis: antigen gene polymorphism, taxonomy and clinical pleomorphism. Infect. Gen. Evol. 5, 109–116. Ghatee, M.A., Sharifi, I., Mirhendi, H., Kanannejad, Z., Hatam, G., 2013. Investigation of double-Band electrophoretic pattern of ITS-rDNA region in Iranian isolates of Leishmania tropica. Iran. J. Parasitol. 8, 264–272. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Jacobson, R.L., 2003. Leishmania tropica (Kinetoplastida: Trypanosomatidae)—a perplexing parasite. Folia Parasitol. (Praha) 50, 241–250. Jacobson, R.L., Eisenberger, C.L., Svobodova, M., Baneth, G., Sztern, J., Carvalho, J., Nasereddin, A., El Fari, M., Shalom, U., Volf, P., Votypka, J., Dedet, J.P., Pratlong, F., Schönian, G., Schnur, L.F., Jaffe, C.L., Warburg, A., 2003. Outbreak of cutaneous leishmaniasis in northern Israel. J. Infect. Dis. 188, 1065–1073. Khanra, S., Bandopadhyay, S.K., Chakraborty, P., Datta, S., Mondal, D., Chatterjee, M., Naskar, K., Roy, S., Manna, M., 2011. Characterization of the recent clinical

isolates of Indian Kala-azar patients by RAPD-PCR method. J. Parasit. Dis. 35, 116–122. Kuhls, K., Chicharro, C., Canavate, C., Cortes, S., Campino, L., Haralambous, C., Soteriadou, K., Pratlong, F., Dedet, J.P., Mauricio, I., Miles, M., Schaar, M., Ochsenreither, S., Radtke, O.A., Schönian, G., 2008. Differentiation and gene flow among European populations of Leishmania infantum MON-1. PLoS Negl. Trop. Dis. 2, E261. Kuhls, K., Mauricio, I.L., Pratlong, F., Presber, W., Schönian, G., 2005. Analysis of ribosomal DNA internal transcribed spacer sequences of the Leishmania donovani complex. Microbes Infect. 7, 1224–1234. Laurent, T., Rijal, S., Yardley, V., Croft, S., De Doncker, S., Decuypere, S., Khanal, B., Singh, R., Schönian, G., Kuhls, K., Chappuis, F., Dujardin, J.C., 2007. Epidemiological dynamics of antimonial resistance in Leishmania donovani: genotyping reveals a polyclonal population structure among naturally-resistant clinical isolates from Nepal. Infect. Gen. Evol. 7, 206–212. Lawyer, P.G., Mebrahtu, Y.B., Ngumbi, P.M., Mwanyumba, P., Mbugua, J., Kiilu, G., Kipkoech, D., Nzovu, J., Anjili, C.O., 1991. Phlebotomus guggisbergi (Diptera: Psychodidae), a vector of Leishmania tropica in Kenya. Am. J. Trop. Med. Hyg. 44, 290–298. Magill, A.J., Grögl, M., Gasser, R.A., Sun, W., Oster, C.N., 1993. Visceral infection caused by Leishmania tropica in veterans of operation desert storm. N. Engl. J. Med. 328, 1383–1387. Mauricio, I.L., Gaunt, M.W., Stothard, J.R., Miles, M.A., 2001. Genetic typing and phylogeny of the Leishmania donovani complex by restriction analysis of PCR amplified gp63 intergenic regions. Parasitology 122, 393–403. Mauricio, I.L., Yeo, M., Baghaei, M., Doto, D., Pratlong, F., Zemanová, E., Dedet, J.P., Lukeš, J., Miles, M.A., 2006. Towards multilocus sequence typing of the Leishmania donovani complex: resolving genotypes and haplotypes for five polymorphic metabolic enzymes (ASAT, GPI, NH1, NH2, PGD). Int. J. Parasitol. 36, 757–769. Morales, M.A., Chicharro, C., Ares, M., Cašavate, C., Barker, D.C., Alvar, J., 2001. Molecular tracking of infections by Leishmania infantum. Trans. R. Soc. Trop. Med. Hyg. 95, 104–107. Nimri, L., Soubani, R., Gramiccia, M., 2002. Leishmania species and zymodemes isolated from endemic areas of cutaneous leishmaniasis in Jordan. Kinetoplastid Biol. Dis. 1 (1/7), 1–9. Noyes, H.A., Reyburn, H., Bailey, W., Smith, D., 1998. A nested-PCR-schizodeme method for identifying Leishmania kinetoplast minicircle classes directly from clinical samples and its application to the study of epidemiology of Leishmania tropica in Pakistan. J. Clin. Microbiol. 36, 2877–2881. Ochsenreither, S., Kuhls, K., Schaar, M., Presber, W., Schönian, G., 2006. Multilocus microsatellite typing as a new tool for discrimination of Leishmania infantum MON-1 strains. J. Clin. Microbiol. 44, 495–503. Oskam, L., Pratlong, F., Zijlstra, E.E., Kroon, C.C.M., Dedet, J.P., Kager, P.A., Schönian, G., Ghalib, H.W., El-Hassan, A.M., Meredith, S.E.O., 1998. Biochemical and molecular characterization of Leishmania parasites isolated from an endemic focus in eastern Sudan. Trans. R. Soc. Trop. Med. Hyg. 92, 120–122. Pandey, K., Yanagi, T., Pandey, B.D., Kumar Mallik, A., Sherchand, J.B., Kanbara, H., 2007. Characterization of Leishmania isolates from Nepalese patients with visceral leishmaniasis. Parasitol. Res. 100, 1361–1369. Parvizi, P., Akhoundi, M., Mirzaei, H., 2012. Distribution, fauna and seasonal variation of sandflies, simultaneous detection of nuclear internal transcribed spacer ribosomal DNA gene of Leishmania major in Rhombomys opimus and Phlebotomus papatasi, in Natanz district in central part of Iran. Iran Biomed. J. 16, 113–120. Parvizi, P., Mauricio, I., Aransay, A.M., Miles, M.A., Ready, P.D., 2005. First detection of Leishmania major in peridomestic Iranian sandflies: comparison of nested PCR of nuclear ITS ribosomalDNA and semi-nested PCR of minicircle kinetoplast DNA. Acta. Trop. 93, 75–83. Parvizi, P., Moradi, G., Akbari, G., Farahmand, M., Ready, P.D., Piazak, N., Assmar, M., Amirkhani, A., 2008. PCR detection and sequencing of parasite ITS-rDNA gene from reservoirs host of zoonotic cutaneous leishmaniasis in central Iran. Parasitol. Res. 103, 1273–1278. Pratlong, F., Rioux, J.A., Dereure, J., Mahjour, J., Gallego, M., Guilvard, E., Lanotte, G., Perieres, J., Martini, A., Saddiki, A., 1991. Leishmania tropica in Morocco. IV– Intrafocal enzyme diversity. Ann Parasitol Hum Comp 66, 100–104. Raju, B.V.S., Gurumurthy, S., Kuhls, K., Bhandari, V., Schönian, G., Salotra, P., 2012. Genetic typing reveals monomorphism between antimony sensitive and resistant Leishmania donovani isolates from visceral leishmaniasis or post kala-azar dermal leishmaniasis cases in India. Parasitol Res 111, 1559–1568. Razmjou, S., Hejazy, H., Motazedian, M.H., Baghaei, M., Emami, M., Kalantary, M., 2009. A new focus of zoonotic cutaneous leishmaniasis in Shiraz. Iran. Trans. Roy. Soc. Trop. Med. Hyg. 103, 727–730. Rioux, J.A., Lanotte, G., Serres, E., Pratlong, F., Bastien, P., Perieres, J., 1990. Taxonomy of Leishmania. Use of isoenzymes. Suggestions for a new classification. Annales de Parasitologie Humaine et Comparee 65, 111–125. Sacks, D.L., Kenney, R.T., Kreutzer, R.D., Jaffe, C.L., Gupta, A.K., Sharma, M.C., Sinha, S.P., Neva, F.A., Saran, R., 1995. Indian kala-azar caused by Leishmania tropica. Lancet 345 (8955), 959–961. Sang, D.K., Njeru, W.K., Ashford, R.W., 1994. A zoonotic focus of cutaneous leishmaniasis due to Leishmania tropica at Utut, Rift Valley Province, Kenya. Trans R Soc Trop Med Hyg 88, 35–37. Schönian, G., Akuffo, H., Lewin, S., Maasho, K., Nylén, S., Pratlong, F., Eisenberger, C.L., Schnur, L.F., Presber, W., 2000. Genetic variability within the species Leishmania aethiopica does not correlate with clinical variations of cutaneous leishmaniasis. Mol. Biochem. Parasitol. 106, 239–248.

M.A. Ghatee et al. / Experimental Parasitology 144 (2014) 44–51 Schönian, G., Schnur, L., El Fari, M., Oskam, L., Kolesnikov, A.A., Sokolowska-Köhler, W., Presber, W., 2001. Genetic heterogeneity in the species Leishmania tropica revealed by different PCR-based methods. Trans R Soc Trop Med Hyg 95, 217–224. Schönian, G., Nasereddin, A., Dinse, N., Schweynoch, C., Schallig, H.D., Presber, W., Jaffe, C.L., 2003. PCR diagnosis and characterization of Leishmania in local and imported clinical samples. Diagn. Microbiol. Infect. Dis. 47, 349–358. Schönian, G., Mauricio, I., Gramiccia, M., Canavate, C., Boelaert, M., Dujardin, J.C., 2008. Leishmaniases in the Mediterranean in the era of molecular epidemiology. Trend. Parasitol. 24, 135–142. Schönian, G., Kuhls, K., Mauricio, I.L., 2011. Molecular approaches for a better understanding of the epidemiology and population genetics of Leishmania. Parasitology 138 (4), 405–425. Schwenkenbecher, J.M., Fröhlich, C., Gehre, F., Schnur, L.F., Schönian, G., 2004. Evolution and conservation of microsatellite markers for Leishmania tropica. Infect. Genet. Evol. 4, 99–105. Schwenkenbecher, J.M., Wirth, T., Schnur, L.F., Jaffe, C.L., Schallig, H., Al-Jawabreh, A., Hamarsheh, O., Azmi, K., Pratlong, F., Schönian, G., 2006. Microsatellite analysis reveals genetic structure of Leishmania tropica. Int J Parasitol 36, 237–246. Sharifi, F., Sharifi, I., Zarean, M., Hakimi Parizi, M., Aflatoonian, M.R., Fasihi Harandi, M., Zahmatkesh, R., Mashayekhi, M., Kermanizadeh, A.R., 2012. Spatial distribution and molecular identification of Leishmania species from endemic foci of south-eastern Iran. Iranian J Parasitol 7 (1), 45–52. Sharifi, I., FeKri, A.R., Aflatonian, M.R., Khamesipour, A., Nadim, A., Mousavi, M.R., Momeni, A.Z., Dowlati, Y., Godal, T., Zicker, F., Smith, P.G., Modabber, F., 1998.

51

Randomised vaccine trial of single dose of killed Leishmania major plus BCG against anthroponotic cutaneous leishmaniasis in Bam. Iran. Lancet 351, 1540– 1543. Talmi-Frank, D., Jaffe, C.L., Nasereddin, A., Warburg, A., King, R., Svobodova, M., Peleg, O., Baneth, G., 2010. Leishmania tropica in rock hyraxes (Procavia capensis) in a focus of human cutaneous leishmaniasis. Am. J. Trop. Med. Hyg. 82, 814– 818. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tashakori, M., Kuhls, K., Al-Jawabreh, A., Mauricio, I.L., Schönian, G., Farajnia, S., Alimohammadian, M.H., 2006. Leishmania major: genetic heterogeneity of Iranian isolates by single strand conformation polymorphism and sequence analysis of ribosomal DNA internal transcribed spacer. Acta Trop. 98 (1), 52–58. World Health Organization, 2002. Urbanization: an increasingrisk factor for leishmaniasis. Wkly. Epidemiol. Rec. 77, 365–372. Zemanová, E., Jirku, M., Mauricio, I.L., Horak, A., Miles, M.A., Lukeö, J., 2007. The Leishmania donovani complex: genotypes of five metabolic enzymes (ICD, ME, MPI, G6PDH, and FH), new targets for multilocus sequence typing. Int. J. Parasitol. 37, 149–160. Zemanová, E., Jirku, M., Mauricio, I.L., Miles, M.A., Lukeš, J., 2004. Genetic polymorphism within the Leishmania donovani complex: correlation with geographic origin. Am. J. Trop. Med. Hyg. 70, 613–617.