Antonie van Leeuwenhoek (2015) 107:1359–1366 DOI 10.1007/s10482-015-0415-5

SHORT COMMUNICATION

Heterologous expression of galbonolide biosynthetic genes in Streptomyces coelicolor Chao Liu • Juanli Zhang • Chunhua Lu Yuemao Shen

•

Received: 9 December 2014 / Accepted: 23 February 2015 / Published online: 4 March 2015 Ó Springer International Publishing Switzerland 2015

Abstract The galbonolide antibiotics are non-glycosylated heptaketide 14-membered macrolides. These antibiotics exhibit broad-spectrum fungicidal activities, including against the human pathogen Cryptococcus neoformans. Previously, galbonolides B and E were isolated from the marine actinomycete Streptomyces sp. LZ35. By bioinformatics analysis, the putative galbonolide biosynthetic gene cluster, gbn, was identified in the genome of strain LZ35. In order to verify that the core genes (gbnA–E) are sufficient for synthesizing the basic structure of galbonolide as previously proposed, we performed the heterologous expression of gbnA–E in a ‘‘clean background’’ host Streptomyces coelicolor ZM12, in which all the native polyketide synthase genes have been deleted. As expected, the production of galbonolide B (1) was detected in the transformant. To the best

Electronic supplementary material The online version of this article (doi:10.1007/s10482-015-0415-5) contains supplementary material, which is available to authorized users. C. Liu  Y. Shen (&) State Key Laboratory of Microbial Technology, School of Life Sciences, Shandong University, Jinan 250100, Shandong, Peoples Republic of China e-mail: [email protected] J. Zhang  C. Lu  Y. Shen Key Laboratory of Chemical Biology (Ministry of Education), School of Pharmaceutical Sciences, Shandong University, Jinan 250012, Shandong, Peoples Republic of China

of our knowledge, this is the first report that demonstrates the essential role of gbnA–E in the biosynthesis of galbonolides by heterologous expression. This heterologous expression system would be helpful to generate novel galbonolide derivatives by co-overexpression of unusual biosynthesis extender units. Keywords Galbonolides  Heterologous expression  Polyketide  14-Membered macrolide antibiotics  Biosynthesis  Streptomyces

Introduction The galbonolides are 14-membered macrolide antibiotics having remarkable activity against several important clinical pathogens, such as Cryptococcus neoformans, Candida albicans, and Rhodotorula rubra (Fauth et al. 1986; Achenbach et al. 1988; Mandala et al. 1998; Harris et al. 1998; Sigmund and Hirsch 1998; Mandala and Harris 2000; Sakoh et al. 2004). However, the biosynthetic study of these antibiotics lags behind chemistry and pharmacology (Tse et al. 1997; Smith and Thomas 1998; Eshelby et al. 2005). Until recently, based on evidence that the gene disruption of galB, C, and D, respectively, resulted in non-production of galbonolides A and B, a putative genetic locus involved in the biosynthesis of galbonolide was identified in Streptomyces galbus (Karki et al. 2010; Kim et al. 2014). Although it was

123

1360

Antonie van Leeuwenhoek (2015) 107:1359–1366

proposed that GalA–C constituted a single module type I polyketide synthase (PKS) responsible for the macrolactone polyketide formation of galbonolides based on excluding other multimodular type I PKS genes in the genome of S. galbus involved in the formation of galbonolides (Kim et al. 2014), there were no direct evidences to prove the function of galA–E in galbonolide biosynthesis.

a

b A

B

AT-ACP

C

PKS

D

E

FG

FabH-like P450 RISP

1 kb

c

cat

aac(3)IV

ermER* A

int pSET152-ermER*-apkcr B E C

Fig. 1 a The chemical structures of galbonolides B (1) and E (2). b Organization of the gbn gene cluster in Streptomyces sp. LZ35. gbnA–E encodes discrete AT–ACP didomain protein (AT acyltransferase, ACP acyl carrier protein), polyketide synthase (PKS), FabH-like enzyme, cytochrome P450 monooxygenase (P450), and Rieske iron–sulfur protein (RISP), respectively. c The scheme of heterologous expression plasmid, pSET152ermER*-apkcr (carrying gbnA–E). ermER* the promoter region of the erythromycin resistance gene modified to have a typical Streptomyces ribosome binding site (RBS), cat chloramphenicol acetyltransferase gene, aac(3)IV apramycin resistance gene, oriT origin of transfer from RK2, attP uC31 attP site, int uC31 integrase enzyme gene

123

Materials and methods Reagents, bacterial strains, plasmid, oligonucleotides, and culture conditions

oriT attP

D

Previously, we isolated galbonolides B (1) and E (2) from Streptomyces sp. LZ35 (Fig. 1a), a marinederived actinomycete strain isolated from intertidal soil collected at Jimei, Xiamen, Peoples Republic of China (Wang et al. 2013). In addition, we have identified the galbonolide biosynthetic gene cluster (gbn) in the genome of LZ35 strain (Fig. 1b), which was confirmed by gene deletion and complementation experiments (Liu et al. 2015). Seven continuous open reading frames were found in this cluster. Among them, gbnA–C were considered responsible for the biosynthesis of the heptaketide frame, while gbnD–E may be responsible for post-PKS tailoring (hydroxylation, etc.; Reddick et al. 2007; Mccoy et al. 2009; Wilson et al. 2010; Ferraro et al. 2005). Here, we report the heterologous expression of gbnA–E in a ‘‘clean’’ host Streptomyces coelicolor ZM12 (Zhou et al. 2012; Li et al. 2014) to further confirm that these core genes are sufficient for the biosynthesis of galbonolides. This is also the first report for the production of galbonolide B in a heterologous host.

All solvents were analytical grade. DNA polymerase, RNAiso Plus, DNase I (RNase free) and PrimeScriptTM II 1st strand cDNA synthesis kit were purchased from Takara Bio, Inc. The bacterial strains, plasmid and oligonucleotides used in this study are listed in Tables 1 and 2. Streptomyces was grown at 30 °C on SFM solid medium (1.5 % agar, 2 % D-mannitol, 2 % soybean meal, pH 7.4) supplemented with 10 mM MgCl2 for spore preparation and conjugation between E. coli and Streptomyces; in YMG broth (0.4 % yeast extract, 1 % malt extract, 0.4 % glucose, pH 7.3) for Streptomyces total DNA extraction; or on M4 (1.8 % agar, 2.5 % soluble starch, 1.5 % soybean, 0.2 % yeast extract, pH 7.2) for Streptomyces fermentation. E. coli ET12567/ pUZ8002 strains were cultivated in Luria–Bertani media at 37 °C. All antibiotics in the subsequent sections were used at the following final concentrations: kanamycin (Km, 50 lg/ml), chloramphenicol (Cm, 25 lg/ml) and apramycin (Apr, 30 lg/ml) for Escherichia coli, nalidixic acid (25 lg/ml) and Apr (30 lg/ml) for Streptomyces.

Antonie van Leeuwenhoek (2015) 107:1359–1366

1361

Table 1 Strains used in this study Strain or plasmid names

Characteristics

Sources

ET12567 (dam-, dcm-, hsdS-) containing a non-transmissible RP4derived plasmid pUZ8002, nonmethylating plasmid donor strain for intergeneric conjugation between E. coli and Streptomyces

Paget et al. (1999)

ZM12

SCP1-, SCP2- containing deletions of the CDA/Red/Act/ SCO79–919/SCO7681–7691/SCO5314–5320/SCO6826–6827/ SCO6273–6288/SCO6429–6438, Kmr

Zhou et al. (2012)

ZM12::ermER*apkcr

Heterologous expression mutant, Aprr

This study

ZM12::ermER*apk

Heterologous expression mutant, Aprr

This study

pSET152-ermER*-apkcr

Used for heterologous expression, Aprr, Cmr

This study

pSET152-ermER*-apk

Used for heterologous expression, Aprr, Cmr

This study

E. coli ET12567/pUZ8002

Streptomyces coelicolor

Plasmid

Table 2 Oligonucleotides used in this study Oligo names

(50 –30 ) Sequence

Characteristics

SM13ATF

GCAGCTAGCATGCACGTGGTGGATTCTGT

Confirmation of gbnA

SM13ATR

AGCCTCGAGTCATCGACCGGCAGCCTCCG

SM13PKSF2

GGAACGCGTCCTGCTGGGCCGGC

SM13PKSR2

AGCAAGCTTTCACGAAAGGGGCGACTGGG

SM13PKSNF

ACTGGTCGTCGTGGGCTGGAAC

SM13PKSNR

GGGGTGAACCGGATCAGTGGC

SM13IIIPKSF

GCACATATGTTGTGGCAGGACATCAC

SM13IIIPKSR

AGCAAGCTTTCATGGACAACCTCCTTCTG

SM13P450F

GCACATATGACGGACACGAATACGGC

SM13P450R

AGCCTCGAGCTAGTGCTTCACCGGGCAGG

SM13FeSF

GCACATATGAAGCCTCACCTGAAGCC

Confirmation of gbnB, R-fragment Confirmation of gbnB, L-fragment; primers for RT-PCR Confirmation of gbnC Confirmation of gbnD Confirmation of gbnE

SM13FeSR

AGCCTCGAGTCACTCCTCCGAGCGGCTCG

SM13ATNF

CCCGAGGCGTTGATCGAGCATG

RT-PCR amplification of RNA gbnA

SM13ATNR ZM12sm13ksF

TCCGTCAGCACCGTGTCGTAGTCC GCAGGTACCCCCCATCAGGCCCGAGCAC

RT-PCR amplification of RNA gbnC

ZM12sm13ksR

AGCGGTACCTCATGGACAACCTCCTTCTGTTTGT

16SF

TCACGGAGAGTTTGATCCTGGCTC

16SR

CCCGAAGGCCGTCATCCCTCACGC

Construction of heterologous expression vectors The heterologous expression vectors pSET152ermER*-apkcr and pSET152-ermER*-apk were constructed identical to the plasmids for gbn deletion mutant complementation previously reported (Liu et al. 2015).

Yepes et al. (2011)

Intergeneric conjugation between E. coli and Streptomyces The galbonolide expression constructs were introduced into the host strain S. coelicolor ZM12 from E. coli by intergeneric conjugation and integrated into the chromosome by site-specific recombination.

123

1362

Briefly, the construct pSET152-ermER*-apkcr was electroporated into methylation-deficient E. coli ET12567/pUZ8002 for conjugation with ZM12. Spores of strain ZM12 were suspended in TES buffer (0.05 M, adjusted to pH 8.0) and heat-shocked for 10 min at 50 °C, followed by incubation in 29 YT broth (1 % yeast extract, 1 % casamino acids, 0.01 M CaCl2) for 2.5 h at 30 °C. The germinated spores were mixed with E. coli ET12567/pUZ8002/pSET152ermER*-apkcr and spread onto SFM plates supplemented with 10 mM MgCl2. After incubation for 16–20 h at 30 °C, the plates were overlaid with 1 ml of sterilized water containing 1 mg each of Apr and nalidixic acid. Integration mutants were selected on Apr. The mutant candidates were further verified by PCR amplification with primers listed in Table 2. The resulting mutant strain were named ZM12:: ermER*apkcr. The construction of mutant strain ZM12::ermER*apk as mentioned above. Gene transcription analysis by reverse transcription PCR Briefly, S. coelicolor mycelia were harvested after 5 days of growth on M4 solid medium and immediately frozen by immersion in liquid nitrogen. Frozen mycelium was then broken by shearing in a mortar, and the frozen lysate was added to RNAiso Plus (Takara). Total RNA was isolated according to manufacturer’s instructions, followed by the DNase I (RNase free, Takara) treatment in order to eliminate possible genomic DNA contamination. The concentration of isolated total RNA was determined with a NanoDrop ND-1000 spectrophotometer (Thermo Scientific). Gene transcription analysis by reverse transcription-PCR (RT-PCR) was performed with the PrimeScriptTM II 1st strand cDNA synthesis kit (Takara) using 400 ng of total RNA as a template. The primers used are listed in Table 2. Conditions were as follows: first strand cDNA synthesis, 42 °C for 60 min followed by 70 °C for 15 min; predenaturation, 95 °C for 10 min; amplification (29–35 cycles): 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min; 3 min at 72 °C. The 16S RNA gene was used as an internal control. Negative controls were carried out by using total RNA as a template with each set of primers and Ex Taq DNA polymerase (Takara) in order to confirm the absence of genomic DNA in the isolated RNA.

123

Antonie van Leeuwenhoek (2015) 107:1359–1366

Fermentation and LC–MS/MS analysis of the metabolites in mutants For secondary metabolite production, ZM12 and mutants were inoculated on M4 medium in petri dishes (two dishes containing 50 ml medium for each strain) and cultivated for 7 days at 30 °C. The culture was diced and extracted with EtOAc/MeOH/AcOH (80:15:5, v/v/v) at room temperature, and the crude extract was decanted and concentrated under reduced pressure. The extract was dissolved in MeOH (1.25 ml) and centrifuged. An aliquot supernatant of each extract (15 ll) was analyzed by HPLC–MS/MS using a prominence modular HPLC (Shimadzu Corporation, YMC-Pack Pro C18, 250 9 4.6 mm, 5 lm) coupled to a LTQ-Orbitrap Velos Pro mass spectrometer (Thermo Scientific). Chromatographic conditions were as follows: water plus 0.1 % formic acid (FA) was used as solvent A, and acetonitrile (MeCN) plus 0.1 % FA was used as solvent B; solvent gradient from 20 to 35 % B in the first 5 min, increased to 55 % B at 19 min, to 65 % B at 20 min, to 100 % B at 23 min, followed by 4 min with 100 % B, linear decrease to 20 % B across 1 min, 20 % B for 7 min; flow rate: 1 ml/min, and UV detection at 230 nm. The mass spectrometer was operated at a mass resolution of 30,000 (150–500 m/z, negative ionization mode) followed by MS/MS scans (100–400 m/z) in the ion trap at 30 % normalized collision energy.

Results and discussion To get direct evidence for the function of gbnA–E in the formation of the basic structure of galbonolides, we performed the heterologous expression of these five genes in S. coelicolor ZM12. The ZM12 strain is derived from S. coelicolor through the deletion of all 10 native PKS and NRPS gene clusters in its genome, which provides a ‘‘clean’’ background for the analysis of secondary metabolite production (Zhou et al. 2012). The integrative plasmid pSET152-ermER*-apkcr which carried the five-gene gbnA–E operon under the control of a constitutive modified ermER* promoter (Fig. 1c) was constructed. The construct pSET152-ermER*-apkcr was introduced into the ZM12 strain from E. coli ET12567/pUZ8002 by intergeneric conjugation and integrated into the ZM12 chromosome by site-specific recombination

Antonie van Leeuwenhoek (2015) 107:1359–1366

1363

HR-MS data with the standard (Fig. 2b, c). The extracted ion chromatogram (negative ionization mode) of m/z 363.22 ([M-H]- for 1, C21 H31 O 5) was absent from the extract of ZM12 WT at the corresponding retention time (*17.7 min; Fig. 2b, ii). The detection results of three parallel fermentation products were completely consistent (data not shown). To further confirm the production of 1 by ZM12::ermER*apkcr mutant, we performed tandem mass (MS-MS) analysis on the ion peak at m/z 363.22 (RT 17.7 min). The quasi molecular ion at m/z 363.2 [M-H]-, the ion fragment of collision induced dissociation at m/z 345.2 [M-H2O-H](C21 H29 O 4 ), and the most abundance ion fragment at m/z 333.2 [M-CH2O-H]- (C20 H29 O 4 ) are identical to that of authentic sample (Fig. 2d, e). This finding undoubtedly proved that the ZM12:: ermER*apkcr strain can produce galbonolide B.

(between attP and attB or pseB1–3) to produce ZM12::ermER*apkcr (Combes et al. 2002; Gupta et al. 2007). The Apr-resistant exconjugants were verified by specific PCR using the primers listed in Table 2 to confirm that the desired mutants had been generated (Fig. 2a). Note that due to the large size of gbnB (6213 bp), we specifically amplified two different *1 kb regions of gbnB to determine its presence. For the other four genes, we performed a full-length PCR amplification. The fidelity of PCR products was further verified by sequencing. The ZM12 wild-type (WT) and ZM12::ermER*apkcr mutant were cultured for 7 days on M4 medium in triplicate. LC–HR-ESIMS analysis of the metabolites from both strains indicated the production of compound 1 by ZM12::ermER*apkcr mutant. Compound 1 was determined as galbonolide B on the basis of the same retention time of HPLC, UV absorbance and

a

b

1

2

3

4

5

6

7

8

9

10

11

12

m/z = 363.12-363.32

13

i NL: 4.80E6 ii NL: 1.92E6 iii NL: 1.08E6

iv NL: 3.10E6 12

80 60 40 364.22

20 311.22

0 300

350

400 m/z

450

500

20

22

24

e

Galbonolide B RT: 17.67 NL: 5.04E6 T: ITMS - c ESI r Full ms2 [email protected] [100.00-400.00] 333.25 100

ZM12::ermER*apkcr RT: 17.68 NL: 3.26E6 T: ITMS - c ESI r Full ms2 [email protected] [100.00-400.00] 333.23 100

80

60 40 20

345.38 363.20

431.20

349.20

18 Time (min)

d ZM12::ermER*apkcr, RT: 17.68, NL: 3.17E6 363.22 Relative Abundance

Relative Abundance

100

16

Relative Abundance

c

14

0 100

80 60 40 20

345.23 363.21

0 200

Fig. 2 Heterologous production of galbonolide B in Streptomyces coelicolor ZM12. a Specific PCR verification of integration mutant. Lanes 1–6 PCR products of gbnA (1557 bp), R-fragment of gbnB (1051 bp), L-fragment of gbnB (951 bp), gbnC (1044 bp), gbnD (1470 bp) and gbnE (1125 bp), respectively, which using genome of ZM12::ermER*apkcr for template, lane 7 DL5000 DNA ladder (up to bottom 5000, 3000, 2000, 1500, 1000, 750, 500, 250, 100 bp), lanes 8–13 control group which using genome of ZM12 wild-type for template. b HPLC–MS analysis of the

300 m/z

400

100

200

300

400

m/z

metabolites of S. coelicolor ZM12 (host strain), ZM12::ermER*apk (insertion mutant containing gbnA–C) and ZM12::ermER*apkcr (insertion mutant containing gbnA–E). The peak for compound 1 (i) was absent in the fermentation products of ZM12 (ii) and ZM12::ermER*apk (iii), but present in the extract of ZM12::ermER*apkcr (iv). c Mass spectra of the quasi molecular ion at m/z 363.22 [M-H]- from the extract of ZM12::ermER*apkcr. d The tandem MS/MS data of galbonolide B standard and e the tandem MS/MS data of the extract of ZM12::ermER*apkcr at corresponding retention time

123

1364

Taken together, these results indicate that the gbn gene cluster is responsible for the biosynthesis of galbonolides. In addition, the production of 1 in ZM12::ermER*apkcr directly indicates that the five successive gbnA–E genes are sufficient for the biosynthesis of the galbonolide scaffold in Streptomyces spp. In order to get direct evidence for the functions of GbnA–C, we generated a second expression construct pSET152-ermER*-apk that contains only gbnA–C under the control of the ermER* promoter. The construct was introduced into S. coelicolor ZM12 to generate strain ZM12::ermER*apk. However, LC– HR-ESIMS analysis showed that there was no significant difference between the metabolic profiles of ZM12::ermER*apk mutant and ZM12 WT (Fig. 2b, iii, see details in Supplementary Material). In order to prove that the gbnA–C genes are indeed expressed in ZM12::ermER*apk mutant, we investigated the transcription of gbnA–C genes by using the RT-PCR assay (Fig. 3). The results clearly showed that gbnA–C genes were transcribed in ZM12::ermER*apk mutant under current culture conditions. Since the putative intermediate assembled by GbnA–C may contain several conjugated double bonds, which is unstable and might be reduced to form a series of related compounds, it could be the reason for the negative detection of the expression product. For the biosynthetic mechanism of the galbonolides, the polyketide frame was proposed to be assembled by a trans-acyltransferase domain–acyl carrier protein domain (AT–ACP) didomain protein, an atypical modular iterative PKS, and a FabH-like priming KS encoded by gbnA, B, and C, respectively (Cheng et al. 2003; Shen 2003; Bao et al. 1999) (Fig. 4). GbnA functions as an uncommonly discrete AT–ACP, in which the AT repetitive loading methylmalonyl-CoA extender unit and the ACP accept the growing polyketide chain. GbnC similar to the FabH of the type II fatty acid synthase (FAS) system or KASIII enzyme, it may be responsible for the generation of a diketide primer for GbnB (Bao et al. 1999). GbnB is a penta-domain iterative PKS (KR– KS–KS–KR–DH) lacking AT and ACP domains. The iterative PKS module catalyze five cycles of chain elongation followed by intramolecular cyclization and post-PKS tailoring to generate final product. Bioinformatics analysis shows that gbnD–E encode cytochrome P450 monooxygenase and Rieske (2Fe–2S)

123

Antonie van Leeuwenhoek (2015) 107:1359–1366 Left

Right

gbnA

gbnB

gbnC

RNA 16S

Fig. 3 Gene transcription analysis of the genes gbnA–C by RTPCR. Analysis was carried out on S. coelicolor ZM12 wild-type (left lane) and ZM12::ermER*apk mutant strain (right lane) as indicated in the ‘‘Materials and methods’’ section. RNA was extracted from cultures after growth for 5 days on M4 medium. The absence of genomic DNA in the RNA samples was confirmed by PCR. Transcription of the 16S ribosomal RNA gene was used as an internal control

domain-containing protein, respectively. Sequence analysis further revealed that the N-terminal *150 residues region of GbnE (369 residues) contain the [2Fe–2S] cluster of the oxygenase alpha subunit, in which Cys81 and Cys101 coordinate one Fe ion, while His83 and His104 coordinate the other one. We speculate that GbnD may be involved in the hydroxylation of polyketide frame; while GbnE may be coupled with the former functions as an oxidoreductase, and participate in post-PKS tailoring (Ferraro et al. 2005; Kim et al. 2014). This is an unprecedented biosynthetic pathway for the 14-membered macrolide formation, which has hybrid characteristics of FAS and PKS systems. The antifungal activity of galbonolide analogues proved to be strictly affected by the substituents at C-6 (Sakoh et al. 2004). Since the AT domain of GbnA probably has a relaxed substrate specificity at the installation of C-5 and C-6 (Karki et al. 2010), it has the potential to recruit unusual extender units to synthesize various galbonolide analogs. Thus, introduce biosynthetic genes of rare extender units (ethylmalonyl-CoA, aminomalonyl-ACP, hydroxymalonylACP, etc.) to ZM12 or feeding with particular

Antonie van Leeuwenhoek (2015) 107:1359–1366

1365

CO2 & CoA

CoA

AT-ACP (GbnA)

SH

S

ACP-AT

ACP-AT

S

FabH-like

Loading

(GbnC)

holo-form

Diketide generation

PKS (GbnB)

NADPH 5

5

CO & CoA & NADP

Five cycles of chain elongation (GbnD)

P450 S

ACP-AT

Intramolecular cyclization

RISP (GbnE) Galbonolide B

Post-PKS tailoring

Macrolactone precursor ?

Fig. 4 The proposed biosynthetic pathway for galbonolide B in Streptomyces spp.

precursor molecules might generate novel galbonolide derivatives. S. coelicolor, as a famous model organism has clear genetic background, and strain ZM12 provides a relatively ‘‘clean’’ background to facilitate the analysis of minor metabolites. Heterologous expression of the galbonolide biosynthetic genes in the ZM12 strain will help us to investigate more details about galbonolides biosynthesis. Meanwhile, through optimization of the metabolic pathways and manipulation of transcriptional regulatory genes, mutant strain ZM12::ermER*apkcr has the potential to become a microbial cell factory for the production of galbonolides. Furthermore, the successful production of galbonolide B in heterologous host S. coelicolor ZM12 offers a way for the study of other related PKS systems (Goranovic et al. 2010).

Conclusions In this study, we successfully produced the 14-membered macrolide antibiotic galbonolide B in heterologous host S. coelicolor ZM12. This finding fully proves that the gbn gene cluster is responsible for the biosynthesis of galbonolides in Streptomyces sp. LZ35. More precisely, the five-gene gbnA–E operon is sufficient to synthesize the heptaketide frame of

galbonolides. Our efforts provide a foundation for the design of galbonolides production strains and in-depth study of its biosynthesis mechanism. Acknowledgments We are grateful to Prof. Zhongjun Qin at the Key Laboratory of Synthetic Biology of the Chinese Academy of Sciences for providing the strain Streptomyces coelicolor ZM12. This study was financially supported by the 973 programs (2012CB721005, 2010CB833802), the Fundamental Research Funds of Shandong University (2014JC027), and the Program for Changjiang Scholars and Innovative Research Team in University (IRT13028). Conflict of interest We declare that there is no financial/commercial conflicts of interest about all authors.

References Achenbach H, Muhlenfeld A, Fauth U, Zahner H (1988) The galbonolides. Novel, powerful antifungal macrolides from Streptomyces galbus ssp. eurythermus. Ann NY Acad Sci 544:128–140 Bao WL, Sheldon PJ, Hutchinson CR (1999) Purification and properties of the Streptomyces peucetius DpsC b-ketoacyl:acyl carrier protein synthase III that specifies the propionate-starter unit for type II polyketide biosynthesis. Biochemistry 38:9752–9757 Cheng YQ, Tang GL, Shen B (2003) Type I polyketide synthase requiring a discrete acyltransferase for polyketide biosynthesis. Proc Natl Acad Sci USA 100:3149–3154 Combes P, Till R, Bee S, Smith MCM (2002) The Streptomyces genome contains multiple pseudo-attB sites for the uC31-

123

1366 encoded site-specific recombination system. J Bacteriol 184:5746–5752 Eshelby J, Goessman M, Parsons PJ, Pennicotta L, Highton A (2005) Model studies for the synthesis of galbonolide B. Org Biomol Chem 3:2994–2997 Fauth U, Zahner H, Muhlenfeld A, Achenbach H (1986) Galbonolides A and B—two non-glycosidic antifungal macrolides. J Antibiot 39:1760–1764 Ferraro DJ, Gakhar L, Ramaswamy S (2005) Rieske business: structure–function of Rieske non-heme oxygenases. Biochem Biophys Res Commun 338:175–190 Goranovic D, Kosec G, Mrak P, Fujs S, Horvat J, Kuscer E, Kopitar G, Petkovic H (2010) Origin of the allyl group in FK506 biosynthesis. J Biol Chem 285:14292–14300 Gupta M, Till R, Smith MCM (2007) Sequences in attB that affect the ability of uC31 integrase to synapse and to activate DNA cleavage. Nucleic Acids Res 35:3407–3419 Harris GH, Shafiee A, Cabello MA, Curotto JE, Genilloud O, Goklen KE, Kurtz MB, Rosenbach M, Salmon PM, Thornton RA et al (1998) Inhibition of fungal sphingolipid biosynthesis by rustmicin, galbonolide B and their new 21-hydroxy analogs. J Antibiot 51:837–844 Karki S, Kwon SY, Yoo HG, Suh JW, Park SH, Kwon HJ (2010) The methoxymalonyl-acyl carrier protein biosynthesis locus and the nearby gene with the b-ketoacyl synthase domain are involved in the biosynthesis of galbonolides in Streptomyces galbus, but these loci are separate from the modular polyketide synthase gene cluster. FEMS Microbiol Lett 310:69–75 Kim HJ, Karki S, Kwon SY, Park SH, Nahm BH, Kim YK, Kwon HJ (2014) A single module type I polyketide synthase directs de novo macrolactone biogenesis during galbonolide biosynthesis in Streptomyces galbus. J Biol Chem 289:34557–34568 Li Y, Chen H, Ding Y, Xie Y, Wang H, Cerny RL, Shen Y, Du L (2014) Iterative assembly of two separate polyketide chains by the same single-module bacterial polyketide synthase in the biosynthesis of HSAF. Angew Chem Int Ed 53:7524–7530 Liu C, Zhu J, Li Y, Zhang J, Lu C, Wang H, Shen Y (2015) In vitro reconstitution of a PKS pathway for the biosynthesis of galbonolides in Streptomyces sp. LZ35. Chembiochem. doi:10.1002/cbic.201500017 Mandala SM, Harris GH (2000) Isolation and characterization of novel inhibitors of sphingolipid synthesis: australifungin, viridiofungins, rustmicin, and khafrefungin. Method Enzymol 311:335–348 Mandala SM, Thornton RA, Milligan J, Rosenbach M, GarciaCalvo M, Bull HG, Harris G, Abruzzo GK, Flattery AM, Gill CJ et al (1998) Rustmicin, a potent antifungal agent,

123

Antonie van Leeuwenhoek (2015) 107:1359–1366 inhibits sphingolipid synthesis at inositol phosphoceramide synthase. J Biol Chem 273:14942–14949 Mccoy JG, Johnson HD, Singh S, Bingman CA, Lei IK, Thorson JS, Phillips GN (2009) Structural characterization of CalO2: a putative orsellinic acid P450 oxidase in the calicheamicin biosynthetic pathway. Proteins 74:50–60 Paget MSB, Chamberlin L, Atrih A, Foster SJ, Buttner MJ (1999) Evidence that the extracytoplasmic function sigma factor rE is required for normal cell wall structure in Streptomyces coelicolor A3(2). J Bacteriol 181:204–211 Reddick JJ, Antolak SA, Raner GM (2007) PksS from Bacillus subtilis is a cytochrome P450 involved in bacillaene metabolism. Biochem Biophys Res Commun 358:363–367 Sakoh H, Sugimoto Y, Imamura H, Sakuraba S, Jona H, BambaNagano R, Yamada K, Hashizume T, Morishima H (2004) Novel galbonolide derivatives as IPC synthase inhibitors: design, synthesis and in vitro antifungal activities. Bioorg Med Chem Lett 14:143–145 Shen B (2003) Polyketide biosynthesis beyond the type I, II and III polyketide synthase paradigms. Curr Opin Chem Biol 7:285–295 Sigmund JM, Hirsch CF (1998) Fermentation studies of rustmicin production by a Micromonospora sp. J Antibiot 51:829–836 Smith PM, Thomas EJ (1998) Approaches to a synthesis of galbonolide B. J Chem Soc Perkin Trans 1:3541–3556 Tse B, Blazey CM, Tu B, Balkovec J (1997) Determination of the absolute stereochemistry of (-)-galbonolide A. J Org Chem 62:3236–3241 Wang HX, Chen YY, Ge L, Fang TT, Meng J, Liu Z, Fang XY, Ni S, Lin C, Wu YY et al (2013) PCR screening reveals considerable unexploited biosynthetic potential of ansamycins and a mysterious family of AHBA-containing natural products in actinomycetes. J Appl Microbiol 115:77–85 Wilson MC, Gulder TAM, Mahmud T, Moore BS (2010) Shared biosynthesis of the saliniketals and rifamycins in Salinispora arenicola is controlled by the sare1259-encoded cytochrome P450. J Am Chem Soc 132:12757–12765 Yepes A, Rico S, Rodrı´guez-Garcı´a A, Santamarı´a RI, Dı´az M (2011) Novel two-component systems implied in antibiotic production in Streptomyces coelicolor. PLoS ONE 6(5):e19980. doi:10.1371/journal.pone.0019980 Zhou M, Jing XY, Xie PF, Chen WH, Wang T, Xia HY, Qin ZJ (2012) Sequential deletion of all the polyketide synthase and nonribosomal peptide synthetase biosynthetic gene clusters and a 900-kb subtelomeric sequence of the linear chromosome of Streptomyces coelicolor. FEMS Microbiol Lett 333:169–179