Bioprocess Biosyst Eng DOI 10.1007/s00449-013-1123-z
ORIGINAL PAPER
High-level soluble and functional expression of Trigonopsis variabilis D-amino acid oxidase in Escherichia coli Senwen Deng • Erzheng Su • Xiaoqiang Ma Shengli Yang • Dongzhi Wei
•
Received: 19 September 2013 / Accepted: 30 December 2013 Ó Springer-Verlag Berlin Heidelberg 2014
Abstract D-Amino acid oxidase is an important biocatalyst used in a variety of fields, and its economically justified level recombinant expression in Escherichia coli has not been established. To accomplish this, after a single Phe54Tyr substitution, fusion proteins of D-amino acid oxidase from Trigonopsis variabilis (TvDAO) with 6 9 His-tags were constructed and expressed in E. coli. The effects of his-tags fusing position were revealed. Significant increase in holoenzyme percent and protein solubility made N-terminus tagged TvDAO (termed NHDAO) a suitable choice for TvDAO production. However, reduced cell growth and protein production rates were also observed for the NHDAO bearing strains. To optimize the performance of NHDAO production, changes of culture medium were tested. Finally, a production of 140 U/mL or 3.48 g active enzyme per liter which accounted for 41.4 % of the total protein, and a specific activity of 16.68 U/mg for the crude extract, were achieved in a 3.7 L fermenter in 28.5 h. This indicated a possibility for functional and economical TvDAO expression in E. coli to meet the industrial need.
Electronic supplementary material The online version of this article (doi:10.1007/s00449-013-1123-z) contains supplementary material, which is available to authorized users. S. Deng E. Su X. Ma S. Yang D. Wei (&) State Key Laboratory of Bioreactor Engineering, New World Institute of Biotechnology, East China University of Science and Technology, Shanghai 200237, People’s Republic of China e-mail: [email protected] E. Su (&) Enzyme and Fermentation Technology Laboratory, College of Light Industry Science and Engineering, Nanjing Forestry University, Nanjing 210037, People’s Republic of China e-mail: [email protected]
Keywords His-tags Fusing position D-Amino acid oxidase Solubility Holoenzyme
Introduction D-Amino acid oxidases (E.C.1.4.3.3) are flavoenzymes with a non-covalently flavin adenine dinucleotide (FAD) cofactor. They are well studied during the past two decades for importance in biotechnological applications, particularly the oxidation of cephalosporin C (CPC) on industrial scale [1]. Among D-amino acid oxidases from different sources, high catalytic efficiency, less sensitivity to product inhibition, and thermo stability make the D-amino acid oxidase from the yeast Trigonopsis variabilis (TvDAO) a suitable choice for CPC conversion [2]. As a model of flavorenzymes, further investigations in structure–function relationship of yeast Damino acid oxidase [3] make site-directed mutagenesis to improve the catalytic activity and other properties of TvDAO possible [4, 5]. For example, Wong et al. [5] reported a single Phe54Tyr substitution of TvDAO improves its catalytic activity for CPC by sixfold and thermo stability. Cloning and recombinant expression of TvDAO in different hosts, especially E. coli [6–14] and yeast [15–19], were intensively studied. Escherichia coli, with a reducing intracellular environment different from the yeast, might prevent the oxidation of some important amino acid residues [20], seems to be a suitable choice. But toxicity of the enzyme for this bacterium by depleting D-amino acids that are essential components of cell wall biosynthesis [9], has hampered efficient heterologous expression so far. Meanwhile, TvDAO produced in E. coli had often been precipitated in inclusion bodies [7–9, 14], or a considerable fraction of soluble protein was in the inactive apo form [6, 8]. Whether the large amount of apo protein can be ascribed to the limited cofactor FAD
123
Bioprocess Biosyst Eng
synthesis in E. coli cell or an intracellular environment which doesn’t facilitate the formation of the holoenzyme still remains uncertain [6]. The current maximum production of D-amino acid oxidase in E. coli was\2.0 g/L of medium per day [14]. In one case, 0.35 g active enzyme per liter medium was produced in E. coli during 14 h fed-batch cultivation in a 5 L bioreactor [12]. A similar activity yield with this in E. coli was achieved in longer 48 h fed-batch cultivation at a larger scale by lactose induction and oxygen supply control [13]. Thus, an economically justified level of TvDAO expression in E. coli for biotransformation purpose has not been achieved yet [14]. D-Amino acid oxidases fusing with various tags in different positions were designed firstly to facilitate the downstream processing. But some researchers found that an appropriate construction of tagged D-amino acid oxidases might be a valuable way to solve some of the problems that had hampered its efficient expression in E. coli [9, 21]. For example, an N-terminus tagged D-amino acid oxidase from Rhodosporidium toruloides (RgDAO) was expressed in a soluble and active form [21], while a considering fraction of the wild-type RgDAO was in the inactive apo form [22]. However, there were questions in the comparison between two articles published by two researchers, as the expression of D-amino acid oxidases could be strongly affected by changes of culture conditions and various activity analysis methods were employed [6, 7, 9, 22]. But direct comparison between wild type and tagged D-amino acid oxidases, and the fusingposition effect of tags were revealed in few researches [9, 10]. The volumetric activity of TvDAO fusing with a Strep-Tag II on the N-terminus was 1.5-fold greater than that of the wild type [9]. Chromatography of soluble and insoluble cell fraction suggested that about half of N-terminus tagged TvDAO (TvDAOstrepN) was in the soluble form while most of the C-terminus tagged enzymes were contained in the inclusion body [9]. The work of Ma et al. [10] concentrated mainly on the effects of different his-tags on TvDAO enzyme activity and biomass yield, and the influences on protein solubility and FAD binding were not mentioned. In this work, comprehensive effect of his-tags fusing position with TvDAO was revealed. To optimize the performance of TvDAO production in E. coli, changes of culture medium were employed. Scale-up cultivation was also conducted in a 3.7 L fermenter to determine the feasibility of our strategy.
from Toyobo Biotechnology Co., Ltd (Shanghai, China). Isopropyl-b-D-thiogalactopyranoside (IPTG) and lactose were purchased from Sigma (USA). Molecular marker for SDS-PAGE was bought from Thermo Fisher Scientific Inc. (Shanghai, China). All other chemicals were of reagent grade and obtained from commercial sources. Gene cloning, site mutation and construction of the fusion genes Gene amplification, restriction enzyme digestion, DNA ligation, agarose gel electrophoresis, DNA transformation, site-directed mutagenesis, and Sodium dodecyl sulfate– polyacrylamide gel electrophoresis (SDS-PAGE) were performed by standard procedures [23] or following the manufacturer’s protocol instructions. The cDNA of TvDAO from T. variabilis was obtained by PCR using primers DAO-F and DAO-R (Table 1), identical with the sequence of Z80895 in Genbank. The only intron of TvDAO gene was eliminated by PCR. Plasmid pET-TvDAO was constructed by fusing the gene with plasmid pET-28a (Novagen) via NcoI and HindIII sites. TvDAO (F54Y) is a TvDAO mutant with a single Tyr substitution at the 54th amino acid residue. Plasmid pETTvDAO (F54Y) was generated by using KOD-Plus-Mutagenesis Kit with primers 54-F and 54-R (Table 1), using plasmid pET-TvDAO as template. The details about Phe54Tyr substitution were described by Wong et al. [5]. Since all DAOs used in this work had a Phe54Tyr substitution, TvDAO (F54Y) was abbreviated as DAO. For example, DAO (T15A) in this study is a TvDAO mutant with a Tyr substitution at the 54th amino acid residue (F54Y) and an Alanine (Ala) substitution at the 15th amino acid residue (T15A). The extra T15A mutation was acquired while gene cloning. The fusion of 6 9 His-tag with N- or C-terminus of DAO was performed by PCR using plasmid pET-DAO as template. Primers N-HIS and DAO-R (Table 1) with NcoI and HindIII restriction sites were used for amplification of the fusion gene of 6 9 His-DAO, abbreviated as NHDAO. Similarly, primers DAO-F and C-HIS (Table 1) were used for amplification of the gene of DAO-6 9 His, abbreviated as CHDAO. Each PCR was performed with 25 cycles at 94 °C for 0.5 min, 55 °C for 0.5 min, and 68 °C for 1.1 min, using a KOD-plus DNA polymerase. Strains and plasmids
Materials and methods Materials Restriction enzymes, T4 DNA Ligase, rTaq and KOD-plus DNA polymerase, KOD-Plus-Mutagenesis Kit were bought
123
Strains and plasmids used in this study are listed in Table 2. Trigonopsis variabilis CGMCC 2.1611 was ordered from China General Microbiological Culture Collection Center (CGMCC). E. coli DH5a was used for genetic cloning. Protein expression was performed using
Bioprocess Biosyst Eng Table 1 List of primers used in this study Primer
Sequences (50 ? 30 )
DAO-F
CATGCCATGGCTAAAATCGTTGTTATTGGTGCCGGT
NcoI
DAO-R
CCCAAGCTTCTAAAGGTTTGGACG
HindIII
54-F
CACATATTACGATGGAGGCAAGTTAGCCGACT
/
54-R
AGCCAGTTGGCACCTGCCCAAGGC
/
N-HIS
CATGCCATGGCTCATCACCATCACCATCACAAAATCGTTGTTATTGGTGCCG
NcoI
C-HIS
CCCAAGCTTCTAGTGATGGTGATGGTGATGAAGGTTTGGACGAGTAAGAGC
HindIII
Restriction sites
Table 2 Strains and plasmids used in this study Strains or plasmids
Description
Source
Wild-type
CGMCC
supE44, hsdR1, recA1, thi-1, endA1, lacZ, gyrA96, relA1
Invitrogen
Strain Trigonopsis variabilis CGMCC 2.1611 Escherichia coli DH5a
-
Escherichia coli BL21 (DE3)
F ompT
hsdSB ðrB m BÞ
gal dcm (DE3)
Promega
Plasmid pMD19-T vector
TA cloning vector, Ampr
Takara
pET-28a
Recombinant protein expression, Kanr
Novagen
r
r
Amp ampicillin resistance, Kan kanamycin resistance
E. coli BL21 (DE3). Plasmid pMD-19T was used for genetic cloning. Plasmid pET-28a was used for protein expression. Plasmid pET-TvDAO, pET-NHDAO, and pET-CHDAO were constructed by fusing the gene fragment with plasmid pET-28a after NcoI and HindIII double restriction enzymes treatment by T4 DNA ligase ligation. Then ligation solution was transformed into E. coli DH5a. Recombinant strains were obtained by Kanr screening on LB (Lauria-Bertani) solid plate. Then plasmids were extracted and transformed into E. coli BL21 (DE3). The mutated construction of pET-DAO was generated by using a KOD-Plus-Mutagenesis Kit, according to the manufacturer’s instructions. Culture medium and optimization The culture mediums used in this work were listed below: YPD, 10 g/L yeast extract, 20 g/L peptone, and 20 g/L glucose; Luria–Bertani (LB), 5 g/L yeast extract, 10 g/L tryptone, and 10 g/L sodium chloride; Terrific Broth (TB), 12 g/L tryptone, 24 g/L yeast extract, 5 g/L glycerol, 17 mM KH2PO4, and 72 mM K2HPO4; TB-G medium was a modified TB medium without 5 g/L glycerol; 2 9 YT broth, 20 g/L tryptone, 10 g/L yeast extract, and 5 g/L sodium chloride; 2 9 YT-9 and 2 9 YT-13: 2 9 YT medium with 9 and 13 g sodium chloride per liter, respectively. The tryptone and yeast extract were obtained from Oxoid Co., Ltd., UK. Other carbon sources, nitrogen
sources, and inorganic salts were industrial grade and purchased from Chinese market. The YPD medium was used for T. variabilis cultivation. LB medium was used for seed cultivation of recombinant E. coli and the primary screening medium for his-tagged TvDAOs. After preliminary screening, the selected recombinant strains were cultivated in LB, TB,TB-G, 2 9 YT, 2 9 YT-9, and 2 9 YT-13 medium to investigate the effect of different culture mediums. TB-G medium was selected as the basic fermentation medium for further components optimization. According to the results of components optimization, the yeast extract and tryptone in the basic medium were substituted by the optimized concentration of Angel yeast extract and fish peptone, respectively. A suitable concentration of dextrin was selected as the extra carbon source. An appropriate concentration of phosphate buffer saline (PBS) was then added to the culture medium. For E. coli cultivation, 0.025 g/L kanamycin was added to the LB medium and 0.12 g/L kanamycin was added to other mediums. Cultivation conditions The primary screening of his-tagged TvDAOs and culture medium optimization was performed in 250 mL shake flasks. Starter culture was prepared by growing a single colony of E. coli cell carrying the recombinant plasmid overnight at 37 °C in 250 mL flask containing 50 mL of
123
Bioprocess Biosyst Eng
LB medium at 200 rpm. After inoculating 1.0 % (V/V) of the seed broth into a flask with 50 mL of medium, cells were cultured at 37 °C, 200 rpm until an optical density of 0.6–1.0 at 600 nm (OD600) was achieved. Recombinant protein expression was induced by 0.5 mM IPTG or 6.25–50 mM lactose. Then culture temperature was decreased to 25 °C and maintained for another 20–30 h. The scale-up cultivation of recombinant E. coli BL21 (DE3)/pET-NHDAO was carried out in a 3.7 L fermenter containing 2.0 L optimized synthetic medium. The seed culture was performed in 50 mL flask, incubated at 37 °C for 6–8 h. The fermentation was carried out with 2.5 % of the inoculum. DO (dissolved oxygen) concentration was monitored by an oxygen electrode and controlled by varying the agitation speed and aeration rate. The culture temperature was kept initially at 37 °C, and DO concentration was maintained above 50 %. When the optical density of the culture broth reached 3.0 (OD600), 50 mM lactose was added. The broth temperature was slowly cooled to 25 °C, and the dissolved oxygen (DO) was maintained at 25–30 % during the fermentation. Crude extract preparation The cells were harvested by centrifugation. Cell pellets were re-suspended in freshly prepared 100 mM sodium phosphate buffer (pH 7.8). After ultrasonic process on ice at 400 W for 60 cycles (working 5 s and intervals 5 s as one cycle), supernatant was obtained as crude enzyme solution by centrifugation at 12, 000 rpm and 4 °C for 20 min. The protein concentration was determined by the Bradford method. Activity assay Enzyme activity was determined by measuring the formation of product GL-7-ACA using high-performance liquid chromatography (HPLC), mainly according to the method described previously by Zheng [17]. The 2.0 mL reaction mixture contained an appropriate amount of enzyme, 50 mM CPC and 100 mM sodium phosphate buffer (pH 8.0). The reaction was performed at 37 °C, 180 rpm for 10 min and stopped by adding 0.2 mL 6.0 M hydrochloric acid. 10 lL of hydrogen peroxide was added to the reaction mixture to transform all the keto acid intermediate to the final product. The amount of GL-7-ACA was quantified by HPLC under the condition described by Zheng et al. [17]. One unit of the enzyme activity was defined as the amount of enzyme produced 1.0 lmol of GL-7-ACA per min. Percentage of the holoenzyme form of D-amino acid oxidase was calculated by comparing the enzyme activity in the absence and presence of exogenous FAD (10 lM) [22]. Specific activity was denoted as units/mg protein of the sample.
123
Results and discussion Effect of his-tags fusing positions on solubility and cofactor FAD binding His-tags were added to the N- or C-terminus of DAO by PCR (termed as NHDAO and CHDAO respectively). For DAO (T15A), mutation T15A was acquired while gene cloning and contained in the consensus sequence GXGVXGS which was assumed to be responsible for the binding of the adenine moiety of FAD [14]. Influence of his-tags on cell growth differed with its fusing positions. Compared with CHDAO, DAO, and DAO (T15A) bearing recombinant E. coli strains, the growth rate of NHDAO bearing strain decreased significantly. Its final cell density could only reach to 3.0 (OD600), which was 60 % of those of CHDAO, DAO, and DAO (T15A) (Fig. 1a). SDS-PAGE analysis showed NHDAO and CHDAO had a slight increase in molecular weight as expected. NHDAO was expressed as a soluble protein while a large fraction of CHDAO and DAO was in the form of inclusion bodies. An even bigger proportion of DAO (T15A) was contained in the insoluble fraction. Meanwhile, total protein of NHDAO decreased more than 50 % in comparison with CHDAO, DAO, and DAO (T15A) (Fig. 1b). This might be partly ascribed to the lower cell growth rate and shortened growth period. Despite the relative low biomass yield, volumetric activity and specific activity of NHDAO were equal to those of CHDAO and higher than those of DAO and DAO (T15A). The increased volumetric activity of his-tagged DAOs and decreased cell density of NHDAO bearing strain were different from what was reported by Ma et al. [10]. This might be ascribed to the difference in culture conditions, activity analysis methods, and gene structure (an extra Val344Ile mutation was described in Ma’ study). Interestingly, holoenzyme percentage of NHDAO and CHDAO was 70 %, obviously higher than 40 % of DAO or DAO (T15A) (Fig. 1c). It seemed that the percentage of holoenzyme to a great extent relied on the his-tags addition while no significant difference between DAO and DAO (T15A) observed. Analysis of crystal structure of RgDAAO (PDB 1C0P) found no direct interaction between the Ser18 (In TvDAO, it is Thr15) and the adenine moiety of FAD, but a probable H-bond formed by the side chain hydroxyl groups of Ser18 [3]. Perhaps that was why a decreased solubility, not a lower holoenzyme percentage was observed with DAO (T15A). Furthermore, his-tags were also added to the N- and C-terminus of wild-type TvDAO, the same results were observed (data not shown). Also, the NHDAO was purified with Ni–NTA column (The detailed process of NHDAO purification was in ‘‘Supplementary file’’ and data were shown in Table S1 and Fig. S1 in ‘‘Supplementary file’’). Specific activity of purified
Bioprocess Biosyst Eng Fig. 1 Effect of various DAO type expression on the host cell growth and protein production. Culture was carried out in 250 mL flasks containing 50 mL of LB medium at 200 rpm and 37 °C, and induced with 0.5 mM IPTG at 25 °C for 22 h. a Effect on cell growth. b SDS-PAGE analysis. Lane 1, 2, 3, and 4: soluble fraction of DAO, NHDAO, CHDAO, and DAO (T15A); Lane 5, 6, 7, and 8: insoluble fraction of DAO, NHDAO, CHDAO and DAO (T15A); Lane M: protein molecular marker; Arrow indicated the band corresponding to DAOs. c Effect on enzyme activity. Values are means of three replicates and error bars are standard deviations
NHDAO enzyme was in accordance with the reported value of the purified no tagged control [5], which indicated that six-histidine tags locating at the N-terminus didn’t change the enzyme activity as Hwang et al. described [7]. His-tags are the most popular fusion tags for the isolation of proteins via metal affinity chromatography. The fusion tag is routinely attached to the protein with the assumption that the addition has no effect on structure or function. However, in our case, the fusion position effect of
his-tags on cell growth, protein solubility, and cofactor binding was revealed. Whether the improvement of NHDAO solubility can be ascribed to the change of folding/unfolding pattern or the slowdown of the transcription or translation rate remains uncertain. TvDAO solubility was improved by the protein expression rate optimization [13]. In another research, a better TvDAO solubility was obtained when the protein production was regulated by a native promoter [24]. It has been reported that the
123
Bioprocess Biosyst Eng
downstream A-rich region after the start codon ATG could function as a general translation enhancer in E. coli gene expression [25]. In our case, as was shown by primer DAOF and N-HIS in Table 1, the downstream A-rich region (AAAATC) in the wild-type TvDAO gene was replaced by the codons for histidines (CATCAC) in NHDAO gene. That might contribute to a decreased protein production rate and thus improve the folding of N-terminus tagged NHDAO finally. Significantly increased solubility and holoenzyme formation made NHDAO a better choice for TvDAO production. However, the impact of NHDAO expression on its host cell, manifested itself in the form of reduced cell growth and limited protein production, might have hampered its more efficient expression. To optimize the
Fig. 2 Effect of D-Alanine concentration on the host cell growth and enzyme activity. a Effect on cell growth. b effect on enzyme activity. Culture was carried out in 250 mL flask containing 50 mL LB medium at 200 rpm and 37 °C, and induced with 0.5 mM IPTG at 25 °C for 22 h. As for NHDAO expression, D-Alanine was added to a final concentration of 20 or 40 mM with IPTG. Values are means of three replicates and error bars are standard deviations
123
performance of NHDAO production in E. coli, the effects of culture medium on growth behavior and protein synthesis were further investigated. Effect of D-Alanine (Ala) supplement on NHDAO expression Additional D-Ala, at final concentration of 20 or 40 mM, was added to the medium broth with IPTG to inspect the effect of D-Ala supplement on cell growth and NHDAO production. D-Ala supplementation markedly enhanced cell growth and protein production (Fig. 2). Growth curves of NHDAO bearing strain came closer to the DAO control as D-Ala concentration increased (Fig. 2a). The volumetric activity and specific activity for the total protein observed
Bioprocess Biosyst Eng
for NHDAO with 40 mM D-Ala supplementation were up to 4.0 and 2.7-fold greater, respectively (Fig. 2b). However, the use of supplemented D-amino acids has to be considered cautiously since it might compromise process economy, especially at larger scale. In the previous work, D-amino acid addition would enhance the enzyme production, but didn’t change the growth kinetics and biomass yield [9]. In our study, increased biomass yield and NHDAO production might indicate that D-Ala served as a limiting factor for cell growth and protein production in NHDAO bearing strains. As D-amino acid oxidases catalyze O2-dependent transformation of D-amino acids, de novo D-amino acids synthesis is required to maintain intracellular pool of D-amino acids for cell wall synthesis. Thus, it would make an
additional demand for nutrients like carbon and nitrogen sources. Effect of lactose induction on NHDAO expression Experiments with the NHDAO bearing strain induced by different concentrations of lactose were performed. Meanwhile, the DAO bearing strain induced by 12.5 mM lactose was set as control. As lactose concentration increased, log phase of the growth period extended (Fig. 3a). Still, influence of supplementary lactose on growth curve differed with TvDAO type. Comparing with DAO bearing strain, additional 37.5 mM of lactose was needed for NHDAO bearing strain to reach a final cell density of 10.5 (OD600) (Fig. 3a).
Fig. 3 Effect of lactose concentration on the host cell growth and enzyme activity. a effect on cell growth. b effect on enzyme activity. Culture was carried out in 250 mL flask containing 50 mL LB medium at 200 rpm and 37 °C, and induced with different concentration of lactose at 25 °C for 30 h. Values are means of three replicates and error bars are standard deviations
123
Bioprocess Biosyst Eng
DAO production was linearly correlated with the concentration of lactose. When induced with 50 mM of lactose, in comparison to induction with 0.5 mM of IPTG, 11-fold increase in volumetric activity was observed (Fig. 3b). The specific activity was 17.53 U/mg for the crude extract. That meant functional NHDAO accounted for 43.6 % of the total protein, higher than what was reported before [7–14] (This value was calculated by the comparison of specific activities before and after purification). Interestingly, lactose induction also benefited holoenzyme formation. Percentage of the holoenzyme was positively correlated with the lactose concentration (Fig. 3b). When induced with 12.5 mM of lactose, 6 and 25 % increases in holoenzyme percentage were observed for NHDAO and DAO, respectively. When a higher concentration of lactose was added, more than 95 % of NHDAO was in the holoenzyme form (Fig. 3b). Lactose, compared with IPTG, was a moderate inducer and carbon source simultaneously [26]. Considering the low cost and toxicity, lactose was regarded as a suitable choice for TvDAO production as increased volumetric and specific activity was observed [7]. The lactose concentration gradient study here further showed the possibility that an additional amount of lactose would meet the extra demand for carbon sources and partly relieve the toxicity of NHDAO expression to host cell growth and protein production. In previous research, influence of culture conditions (induction temperature and oxygen supply) on holoenzyme forming was observed [6, 22]. In this work, it was shown that the percentage of holoenzyme also relied on the inducer or carbon source supply. In conclusion, the use of a suitable concentration of lactose allowed a TvDAO production with higher yield and better quality. Effect of culture medium on NHDAO expression A systematic optimization of the culture medium such as culture medium type, yeast extract type, nitrogen source type, carbon source type, and phosphate buffer saline (PBS) concentration was further carried out under the induction of 50 mM lactose. LB, TB, TB-G, 2 9 YT, 2 9 YT-9, and 2 9 YT-13 media were employed to investigate their influence on cell growth and enzyme activity. The maximum cell density and NHDAO activity were observed in TB-G medium (Fig. 2S). Therefore, it was chosen as the basic fermentation medium for further optimization. The 2.4 % (w/v) Oxoid yeast extract in TB-G medium was substituted by Angel yeast extract with a much lower price at the concentration of 2.4–3.2 % (w/v) (Fig. 3S). The tryptone in TB-G medium was substituted with 1.2 % (w/v) of various organic nitrogen sources. Recombinant E. coli strain cultured in the presence of the
123
fish peptone or peanut powder achieved the highest enzyme activity. Since the insoluble particle in peanut powder might increase the difficulty for downstream processing, fish peptone was selected. The optimized concentration of fish peptone was 1.8 % (w/v) (Fig. 4S). 0.5 % (w/v) of various carbon sources was added to the culture medium. The results indicated that sucrose or dextrin or starch were favorable for the production of NHDAO. Dextrin was the best for enzyme activity and cell growth. Compared with the control one without any extra carbon source addition, the NHDAO activity increased nearly 100 % when an optimum concentration of 1 % (w/v) dextrin was added to the medium (Fig. 5S). This result further revealed the importance of carbon source supply for NHDAO production. The concentration of PBS varied from 0 to 178 mM was tested. Its effects on the initial culture pH and subsequent cell growth and enzyme activity were shown. The best concentration of PBS was 133.5 mM with an initial culture pH about 6.7 (Fig. 6S). After optimization, the growth of recombinant E. coli BL21 (DE3)/pET-NHDAO and the production of NHDAO were obviously improved (Fig. 2S * Fig. 6S). The OD600 and the enzyme activity attained to 21.51 and 120.22 U/mL, respectively (Fig. 6S). Scale-up cultivation Scale-up cultivation was performed in a 3.7 L fermenter containing 2.0 L optimized synthetic medium. It provided us tight control of process parameters such as aeration. As NHDAO is sufficiently toxic to the host cell and a high concentration of phosphate combined with a rich medium might increase the host cell resistance to kanamycin like Studier reported [27], a relative high concentration of kanamycin (0.12 g/L) was added to the medium to help the establishment of plasmid pET-NHDAO in host cell. Benefited from a culture medium balanced with nitrogen and carbon sources, drastic change in pH was avoided. Still, no significant cell lysis was observed as a relative low DO concentration (25–30 %), as previously reported, was maintained [11]. A production of 3.48 g active enzyme per liter medium or volumetric activity of 140 U/mL with a productivity of 4.7 KU L-1 h-1 was achieved in 28.5 h (Fig. 4). The specific activity was 16.68 U/mg for the crude extract or 2,100 U/g wet cell weight (wcw), accounted for 41.4 % of the total protein. Meanwhile, the holoenzyme percent of enzyme was 96 %. It confirmed the feasibility of a strategy used for NHDAO boom production at a large scale without compromising the protein quality and space-time yield. Further scale-up in 30 and 300 L fermenters is in progress. Various activity analysis methods in different publications make direct and quantitative comparison of published TvDAO enzyme activity data difficult. Until now, to our knowledge, the highest volumetric activity of TvDAO
Bioprocess Biosyst Eng Fig. 4 Time course of scale-up cultivation in 3.7 L fermenter containing 2.0 L medium. The arrow indicates the addition of lactose. The fermentation was carried out with 2.5 % of the inoculum. 50 mM lactose was added at OD600 of 3.0. The temperature was kept at 25 °C, and the DO was maintained 25 * 30 % during the fermentation. Values are means of three replicates and error bars are standard deviations
production was 220 U/mL obtained in P. pastoris by a much longer fed-batch cultivation lasting about 110 h [18]. This high volumetric activity should be partly ascribed to a high biomass concentration (more than 200 g/L) and a more complicated multi-step engineering approach including codon redesign, change of peroxisomal targeting sequence, multi copy integration, and screening [18]. Still, when exceeding a certain level in the cell, the recombinant TvDAO behaves like an inhibitor to P. pastoris growth [18]. However, in contrast with the relative low biomass yield and volumetric activity, NHDAO production in E. coli showed advantages in space-time yield (4.7 vs 2 KU L-1 h-1) and specific activity (2,100 vs 1,283 U/g wcw) [18]. For CPC oxidation, unlike E. coli expression system, TvDAO obtained from the yeast T. variabilis is structurally micro heterogeneous due to the partial oxidation and oxidatively modified TvDAO remains only 25 % activity of the native one [20]. Also, enzymatic conversion of cephalosporin C relies on the H2O2 produced in the first step to transform the a-keto acid intermediate to product, several steps of downstream processing are needed to obtain an immobilized biocatalyst without catalase and esterase activities in the P. pastori expression system for an extensive proliferation of peroxisomes [28–31]. All those indicated a possibility for functional and economical TvDAO expression in E. coli to meet the industrial need especially for CPC oxidation.
Conclusions In this work, effects of his-tags fusing position with TvDAO were revealed. N-terminus tagged TvDAO (NHDAO) was found to be a suitable choice. To optimize the NHDAO production, a systematic optimization of culture medium was employed. Scale-up cultivation got a production of 3.48 g active enzyme per liter medium in
28.5 h and a specific activity of 16.68 U/mg for the crude extract, accounted for 41.4 % of the total protein. This indicated a possibility for functional and economical TvDAO expression in E. coli. The optimized results showed that the expression system, inducer, medium composition, and cultivation condition had great influences on high-level expression of TvDAO in E. coli. Acknowledgments This work was supported by the National Basic Research Program of China (No. 2012CB721103), the Fundamental Research Funds for the Central Universities and the Open Funding Project of the State Key Laboratory of Bioreactor Engineering.
References 1. Vijay C (2006) Enzymatic modifications of cephalosporins by cephalosporin acylase and other enzymes. Crit Rev Biotechnol 26:95–120 2. Loredano P, Laura C, Gianluca M, Silvia S, Mirella SP (2004) Catalytic properties of D-amino acid oxidase in CPC bioconversion: a comparison between proteins from different sources. Biotechnol Prog 20:467–473 3. Umhau S, Pollegioni L, Molla G, Diederichs K, Welte W, Pilone MS, Ghisla S (2000) The X-ray structure of D-amino acid oxidase at very high resolution identifies the chemical mechanism of flavindependent substrate dehydrogenation. Proc Natl Acad Sci 97:12463–12468 4. Komarova NV, Golubev IV, Khoronenkova SV, Chubar TA, Tishkov VI (2012) Engineering of substrate specificity of Damino acid oxidase from the yeast Trigonopsis variabilis: directed mutagenesis of Phe258 residue. Biochem (Mosc) 77(10):1181–1189 5. Wong KS, Fong WP, Tsang PWK (2010) A single Phe54Tyr substitution improves the catalytic activity and thermostability of Trigonopsis variabilis D-amino acid oxidase. New Biotechnol 27:78–84 6. Alonso J, Barredo JL, Armise´n P, Dı´ez B, Salto F, Guisan JM, Garcı´a JL, Corte´s E (1999) Engineering the D-amino acid oxidase from Trigonopsis variabilis to facilitate its overproduction in Escherichia coli and its downstream processing by tailor-made metal chelate supports. Enzyme Microb Technol 25:88–95
123
Bioprocess Biosyst Eng 7. Hwang TS, Fu HM, Lin LL, Hsu WH (2000) High-level expression of Trigonopsis variabilis D-amino acid oxidase in Escherichia coli using lactose as inducer. Biotechnol Lett 22:655–658 8. Lin LL, Chien HR, Wang WC, Hwang TS, Fu HM, Hsu WH (2000) Expression of Trigonopsis variabilis D-amino acid oxidase gene in Escherichia coli and characterization of its inactive mutants. Enzyme Microb Technol 27:482–491 9. Dib I, Stanzer D, Nidetzky B, Nidetzky B (2007) Trigonopsis variabilis D-amino acid oxidase: control of protein quality and opportunities for biocatalysis through production in Escherichia coli. Appl Environ Microbiol 73:331–333 10. Ma XF, Yu HM, Wen C, Luo H, Li Q, Shen ZY (2009) Triple fusion of D-amino acid oxidase from Trigonopsis variabilis with polyhistidine and Vitreoscilla hemoglobin. World J Micro Biot 25:1353–1361 11. Kim SJ, Kim NJ, Shin CH, Kim CW (2008) Optimization of culture condition for the production of D-amino acid oxidase in a recombinant Escherichia coli. Biotechnol Bioproc Eng 13:144–149 12. Stanzer D, Mrvcˇic´ J, Krizˇanovic´ S, Stehlik-Tomas V, Grba S (2011) Enhancement of Trigonopsis variabilis D-Amino acid oxidase overproduction in fed-batch cultivation of E. coli. Chem Biochem Eng Q 25(4):513–517 13. Hou J, Liu Y, Li Q, Yang J (2013) High activity expression of Damino acid oxidase in Escherichia coli by the protein expression rate optimization. Protein Expr Purif 88:120–126 14. Tishkov VI, Khoronenkova SV (2005) D-Amino acid oxidase: structure, catalytic mechanism, and practical application. Biochem (Mosc) 70:40–54 15. Gonza´lez FJ, Montes J, Martin F, Lo´pez MC, Fermin˜a´n E, Catala´n J, Gala´n MA, Domı´nguez A (1997) Molecular cloning of TvDAO1, a gene encoding a D-amino acid oxidase from Trigonopsis variabilis and its expression in Saccharomyces cerevisiae and Kluyveromyces lactis. Yeast 13(15):1399–1408 16. Yu J, Li DY, Zhang YJ, Yang S, Li RB, Yuan ZY (2002) High expression of Trigonopsis variabilis D-amino acid oxidase in Pichia pastoris. J Mol Catal B Enzym 18:291–297 17. Zheng HB, Wang XL, Chen J, Zhu K, Zhao YZ, Yang YL, Yang S, Jiang WH (2006) Expression, purification, and immobilization of His-tagged D-amino acid oxidase of Trigonopsis variabilis in Pichia pastoris. Appl Microbiol Biot 70:683–698 18. Abad S, Nahalka J, Bergler G, Arnold SA, Speight R, Fotheringham I, Nidetzky B, Glieder A (2010) Stepwise engineering of
123
19.
20.
21.
22.
23.
24.
25.
26.
27. 28. 29.
30. 31.
a Pichia pastoris D-amino acid oxidase whole cell catalyst. Microb Cell Fact 9:24 Redo VA, Novikova EK, E´l’darov MA (2011) Expression of modified oxidase of D-amino acids of Trigonopsis variabilis in methylotrophic yeasts Pichia pastoris. Prikl Biokhim Mikrobiol 47(1):39–45 Slavica A, Dib I, Nidetzky B (2005) Single-site oxidation, cysteine-108 to cysteine sulfinic acid, in D-amino acid oxidase from Trigonopsis variabilis and its structural and functional consequences. Appl Environ Microbiol 71:8061–8068 Molla G, Vegezzi C, Pilone MS, Pollegioni L (1998) Overexpression in Escherichia coli of a recombinant chimeric Rhodotorula gracilis D-amino acid oxidase. Protein Expr Purif 14:289–294 Alonso J, Barredo JL, Diez B, Mellado E, Salto F, Garcia JL, Cortes E (1998) D-Amino acid oxidase gene from Rhodotorula gracilis (Rhodosporidium toruloides) ATCC 26217. Microbiol 144:1095–1101 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, Cold Spring Harbor. Cold Spring Harbor Laboratory Press, New York Liu Y, Li Q, Zhu H, Yang J (2009) High soluble expression of Damino acid oxidase in Escherichia coli regulated by a native promoter. Appl Biochem Biotechnol 158:313–322 Brock JE, Paz RL, Cottle P, Janssen GR (2007) Naturally occurring adenines within mRNA coding sequences affect ribosome binding and expression in Escherichia coli. J Bacteriol 189:501–510 Gombert AK, Kilikian BV (1998) Recombinant gene expression in Escherichia coli cultivation using lactose as inducer. J Biotech 60:47–54 Studier FW (2005) Protein production by auto-induction in highdensity shaking cultures. Protein Expres Purif 41:207–234 Gleeson MA, Sudbery PE (1988) The methylotrophic yeasts. Yeast 4:1–15 van der Klei IJ, Yurimoto H, Sakai Y, Veenhuis M (2006) The significance of peroxisomes in methanol metabolism in methylotrophic yeast. Biochim Biophys Acta 1763:1453–1462 Liese A, Seelbach K, Wandrey C (2006) Industrial biotransformations. Wiley-VCH, Weinheim Riethorst W, Reichert A (1999) An industrial view on enzymes for the cleavage of Cephalosporin C. Chimia 53:600–607
ORIGINAL PAPER
High-level soluble and functional expression of Trigonopsis variabilis D-amino acid oxidase in Escherichia coli Senwen Deng • Erzheng Su • Xiaoqiang Ma Shengli Yang • Dongzhi Wei
•
Received: 19 September 2013 / Accepted: 30 December 2013 Ó Springer-Verlag Berlin Heidelberg 2014
Abstract D-Amino acid oxidase is an important biocatalyst used in a variety of fields, and its economically justified level recombinant expression in Escherichia coli has not been established. To accomplish this, after a single Phe54Tyr substitution, fusion proteins of D-amino acid oxidase from Trigonopsis variabilis (TvDAO) with 6 9 His-tags were constructed and expressed in E. coli. The effects of his-tags fusing position were revealed. Significant increase in holoenzyme percent and protein solubility made N-terminus tagged TvDAO (termed NHDAO) a suitable choice for TvDAO production. However, reduced cell growth and protein production rates were also observed for the NHDAO bearing strains. To optimize the performance of NHDAO production, changes of culture medium were tested. Finally, a production of 140 U/mL or 3.48 g active enzyme per liter which accounted for 41.4 % of the total protein, and a specific activity of 16.68 U/mg for the crude extract, were achieved in a 3.7 L fermenter in 28.5 h. This indicated a possibility for functional and economical TvDAO expression in E. coli to meet the industrial need.
Electronic supplementary material The online version of this article (doi:10.1007/s00449-013-1123-z) contains supplementary material, which is available to authorized users. S. Deng E. Su X. Ma S. Yang D. Wei (&) State Key Laboratory of Bioreactor Engineering, New World Institute of Biotechnology, East China University of Science and Technology, Shanghai 200237, People’s Republic of China e-mail: [email protected] E. Su (&) Enzyme and Fermentation Technology Laboratory, College of Light Industry Science and Engineering, Nanjing Forestry University, Nanjing 210037, People’s Republic of China e-mail: [email protected]
Keywords His-tags Fusing position D-Amino acid oxidase Solubility Holoenzyme
Introduction D-Amino acid oxidases (E.C.1.4.3.3) are flavoenzymes with a non-covalently flavin adenine dinucleotide (FAD) cofactor. They are well studied during the past two decades for importance in biotechnological applications, particularly the oxidation of cephalosporin C (CPC) on industrial scale [1]. Among D-amino acid oxidases from different sources, high catalytic efficiency, less sensitivity to product inhibition, and thermo stability make the D-amino acid oxidase from the yeast Trigonopsis variabilis (TvDAO) a suitable choice for CPC conversion [2]. As a model of flavorenzymes, further investigations in structure–function relationship of yeast Damino acid oxidase [3] make site-directed mutagenesis to improve the catalytic activity and other properties of TvDAO possible [4, 5]. For example, Wong et al. [5] reported a single Phe54Tyr substitution of TvDAO improves its catalytic activity for CPC by sixfold and thermo stability. Cloning and recombinant expression of TvDAO in different hosts, especially E. coli [6–14] and yeast [15–19], were intensively studied. Escherichia coli, with a reducing intracellular environment different from the yeast, might prevent the oxidation of some important amino acid residues [20], seems to be a suitable choice. But toxicity of the enzyme for this bacterium by depleting D-amino acids that are essential components of cell wall biosynthesis [9], has hampered efficient heterologous expression so far. Meanwhile, TvDAO produced in E. coli had often been precipitated in inclusion bodies [7–9, 14], or a considerable fraction of soluble protein was in the inactive apo form [6, 8]. Whether the large amount of apo protein can be ascribed to the limited cofactor FAD
123
Bioprocess Biosyst Eng
synthesis in E. coli cell or an intracellular environment which doesn’t facilitate the formation of the holoenzyme still remains uncertain [6]. The current maximum production of D-amino acid oxidase in E. coli was\2.0 g/L of medium per day [14]. In one case, 0.35 g active enzyme per liter medium was produced in E. coli during 14 h fed-batch cultivation in a 5 L bioreactor [12]. A similar activity yield with this in E. coli was achieved in longer 48 h fed-batch cultivation at a larger scale by lactose induction and oxygen supply control [13]. Thus, an economically justified level of TvDAO expression in E. coli for biotransformation purpose has not been achieved yet [14]. D-Amino acid oxidases fusing with various tags in different positions were designed firstly to facilitate the downstream processing. But some researchers found that an appropriate construction of tagged D-amino acid oxidases might be a valuable way to solve some of the problems that had hampered its efficient expression in E. coli [9, 21]. For example, an N-terminus tagged D-amino acid oxidase from Rhodosporidium toruloides (RgDAO) was expressed in a soluble and active form [21], while a considering fraction of the wild-type RgDAO was in the inactive apo form [22]. However, there were questions in the comparison between two articles published by two researchers, as the expression of D-amino acid oxidases could be strongly affected by changes of culture conditions and various activity analysis methods were employed [6, 7, 9, 22]. But direct comparison between wild type and tagged D-amino acid oxidases, and the fusingposition effect of tags were revealed in few researches [9, 10]. The volumetric activity of TvDAO fusing with a Strep-Tag II on the N-terminus was 1.5-fold greater than that of the wild type [9]. Chromatography of soluble and insoluble cell fraction suggested that about half of N-terminus tagged TvDAO (TvDAOstrepN) was in the soluble form while most of the C-terminus tagged enzymes were contained in the inclusion body [9]. The work of Ma et al. [10] concentrated mainly on the effects of different his-tags on TvDAO enzyme activity and biomass yield, and the influences on protein solubility and FAD binding were not mentioned. In this work, comprehensive effect of his-tags fusing position with TvDAO was revealed. To optimize the performance of TvDAO production in E. coli, changes of culture medium were employed. Scale-up cultivation was also conducted in a 3.7 L fermenter to determine the feasibility of our strategy.
from Toyobo Biotechnology Co., Ltd (Shanghai, China). Isopropyl-b-D-thiogalactopyranoside (IPTG) and lactose were purchased from Sigma (USA). Molecular marker for SDS-PAGE was bought from Thermo Fisher Scientific Inc. (Shanghai, China). All other chemicals were of reagent grade and obtained from commercial sources. Gene cloning, site mutation and construction of the fusion genes Gene amplification, restriction enzyme digestion, DNA ligation, agarose gel electrophoresis, DNA transformation, site-directed mutagenesis, and Sodium dodecyl sulfate– polyacrylamide gel electrophoresis (SDS-PAGE) were performed by standard procedures [23] or following the manufacturer’s protocol instructions. The cDNA of TvDAO from T. variabilis was obtained by PCR using primers DAO-F and DAO-R (Table 1), identical with the sequence of Z80895 in Genbank. The only intron of TvDAO gene was eliminated by PCR. Plasmid pET-TvDAO was constructed by fusing the gene with plasmid pET-28a (Novagen) via NcoI and HindIII sites. TvDAO (F54Y) is a TvDAO mutant with a single Tyr substitution at the 54th amino acid residue. Plasmid pETTvDAO (F54Y) was generated by using KOD-Plus-Mutagenesis Kit with primers 54-F and 54-R (Table 1), using plasmid pET-TvDAO as template. The details about Phe54Tyr substitution were described by Wong et al. [5]. Since all DAOs used in this work had a Phe54Tyr substitution, TvDAO (F54Y) was abbreviated as DAO. For example, DAO (T15A) in this study is a TvDAO mutant with a Tyr substitution at the 54th amino acid residue (F54Y) and an Alanine (Ala) substitution at the 15th amino acid residue (T15A). The extra T15A mutation was acquired while gene cloning. The fusion of 6 9 His-tag with N- or C-terminus of DAO was performed by PCR using plasmid pET-DAO as template. Primers N-HIS and DAO-R (Table 1) with NcoI and HindIII restriction sites were used for amplification of the fusion gene of 6 9 His-DAO, abbreviated as NHDAO. Similarly, primers DAO-F and C-HIS (Table 1) were used for amplification of the gene of DAO-6 9 His, abbreviated as CHDAO. Each PCR was performed with 25 cycles at 94 °C for 0.5 min, 55 °C for 0.5 min, and 68 °C for 1.1 min, using a KOD-plus DNA polymerase. Strains and plasmids
Materials and methods Materials Restriction enzymes, T4 DNA Ligase, rTaq and KOD-plus DNA polymerase, KOD-Plus-Mutagenesis Kit were bought
123
Strains and plasmids used in this study are listed in Table 2. Trigonopsis variabilis CGMCC 2.1611 was ordered from China General Microbiological Culture Collection Center (CGMCC). E. coli DH5a was used for genetic cloning. Protein expression was performed using
Bioprocess Biosyst Eng Table 1 List of primers used in this study Primer
Sequences (50 ? 30 )
DAO-F
CATGCCATGGCTAAAATCGTTGTTATTGGTGCCGGT
NcoI
DAO-R
CCCAAGCTTCTAAAGGTTTGGACG
HindIII
54-F
CACATATTACGATGGAGGCAAGTTAGCCGACT
/
54-R
AGCCAGTTGGCACCTGCCCAAGGC
/
N-HIS
CATGCCATGGCTCATCACCATCACCATCACAAAATCGTTGTTATTGGTGCCG
NcoI
C-HIS
CCCAAGCTTCTAGTGATGGTGATGGTGATGAAGGTTTGGACGAGTAAGAGC
HindIII
Restriction sites
Table 2 Strains and plasmids used in this study Strains or plasmids
Description
Source
Wild-type
CGMCC
supE44, hsdR1, recA1, thi-1, endA1, lacZ, gyrA96, relA1
Invitrogen
Strain Trigonopsis variabilis CGMCC 2.1611 Escherichia coli DH5a
-
Escherichia coli BL21 (DE3)
F ompT
hsdSB ðrB m BÞ
gal dcm (DE3)
Promega
Plasmid pMD19-T vector
TA cloning vector, Ampr
Takara
pET-28a
Recombinant protein expression, Kanr
Novagen
r
r
Amp ampicillin resistance, Kan kanamycin resistance
E. coli BL21 (DE3). Plasmid pMD-19T was used for genetic cloning. Plasmid pET-28a was used for protein expression. Plasmid pET-TvDAO, pET-NHDAO, and pET-CHDAO were constructed by fusing the gene fragment with plasmid pET-28a after NcoI and HindIII double restriction enzymes treatment by T4 DNA ligase ligation. Then ligation solution was transformed into E. coli DH5a. Recombinant strains were obtained by Kanr screening on LB (Lauria-Bertani) solid plate. Then plasmids were extracted and transformed into E. coli BL21 (DE3). The mutated construction of pET-DAO was generated by using a KOD-Plus-Mutagenesis Kit, according to the manufacturer’s instructions. Culture medium and optimization The culture mediums used in this work were listed below: YPD, 10 g/L yeast extract, 20 g/L peptone, and 20 g/L glucose; Luria–Bertani (LB), 5 g/L yeast extract, 10 g/L tryptone, and 10 g/L sodium chloride; Terrific Broth (TB), 12 g/L tryptone, 24 g/L yeast extract, 5 g/L glycerol, 17 mM KH2PO4, and 72 mM K2HPO4; TB-G medium was a modified TB medium without 5 g/L glycerol; 2 9 YT broth, 20 g/L tryptone, 10 g/L yeast extract, and 5 g/L sodium chloride; 2 9 YT-9 and 2 9 YT-13: 2 9 YT medium with 9 and 13 g sodium chloride per liter, respectively. The tryptone and yeast extract were obtained from Oxoid Co., Ltd., UK. Other carbon sources, nitrogen
sources, and inorganic salts were industrial grade and purchased from Chinese market. The YPD medium was used for T. variabilis cultivation. LB medium was used for seed cultivation of recombinant E. coli and the primary screening medium for his-tagged TvDAOs. After preliminary screening, the selected recombinant strains were cultivated in LB, TB,TB-G, 2 9 YT, 2 9 YT-9, and 2 9 YT-13 medium to investigate the effect of different culture mediums. TB-G medium was selected as the basic fermentation medium for further components optimization. According to the results of components optimization, the yeast extract and tryptone in the basic medium were substituted by the optimized concentration of Angel yeast extract and fish peptone, respectively. A suitable concentration of dextrin was selected as the extra carbon source. An appropriate concentration of phosphate buffer saline (PBS) was then added to the culture medium. For E. coli cultivation, 0.025 g/L kanamycin was added to the LB medium and 0.12 g/L kanamycin was added to other mediums. Cultivation conditions The primary screening of his-tagged TvDAOs and culture medium optimization was performed in 250 mL shake flasks. Starter culture was prepared by growing a single colony of E. coli cell carrying the recombinant plasmid overnight at 37 °C in 250 mL flask containing 50 mL of
123
Bioprocess Biosyst Eng
LB medium at 200 rpm. After inoculating 1.0 % (V/V) of the seed broth into a flask with 50 mL of medium, cells were cultured at 37 °C, 200 rpm until an optical density of 0.6–1.0 at 600 nm (OD600) was achieved. Recombinant protein expression was induced by 0.5 mM IPTG or 6.25–50 mM lactose. Then culture temperature was decreased to 25 °C and maintained for another 20–30 h. The scale-up cultivation of recombinant E. coli BL21 (DE3)/pET-NHDAO was carried out in a 3.7 L fermenter containing 2.0 L optimized synthetic medium. The seed culture was performed in 50 mL flask, incubated at 37 °C for 6–8 h. The fermentation was carried out with 2.5 % of the inoculum. DO (dissolved oxygen) concentration was monitored by an oxygen electrode and controlled by varying the agitation speed and aeration rate. The culture temperature was kept initially at 37 °C, and DO concentration was maintained above 50 %. When the optical density of the culture broth reached 3.0 (OD600), 50 mM lactose was added. The broth temperature was slowly cooled to 25 °C, and the dissolved oxygen (DO) was maintained at 25–30 % during the fermentation. Crude extract preparation The cells were harvested by centrifugation. Cell pellets were re-suspended in freshly prepared 100 mM sodium phosphate buffer (pH 7.8). After ultrasonic process on ice at 400 W for 60 cycles (working 5 s and intervals 5 s as one cycle), supernatant was obtained as crude enzyme solution by centrifugation at 12, 000 rpm and 4 °C for 20 min. The protein concentration was determined by the Bradford method. Activity assay Enzyme activity was determined by measuring the formation of product GL-7-ACA using high-performance liquid chromatography (HPLC), mainly according to the method described previously by Zheng [17]. The 2.0 mL reaction mixture contained an appropriate amount of enzyme, 50 mM CPC and 100 mM sodium phosphate buffer (pH 8.0). The reaction was performed at 37 °C, 180 rpm for 10 min and stopped by adding 0.2 mL 6.0 M hydrochloric acid. 10 lL of hydrogen peroxide was added to the reaction mixture to transform all the keto acid intermediate to the final product. The amount of GL-7-ACA was quantified by HPLC under the condition described by Zheng et al. [17]. One unit of the enzyme activity was defined as the amount of enzyme produced 1.0 lmol of GL-7-ACA per min. Percentage of the holoenzyme form of D-amino acid oxidase was calculated by comparing the enzyme activity in the absence and presence of exogenous FAD (10 lM) [22]. Specific activity was denoted as units/mg protein of the sample.
123
Results and discussion Effect of his-tags fusing positions on solubility and cofactor FAD binding His-tags were added to the N- or C-terminus of DAO by PCR (termed as NHDAO and CHDAO respectively). For DAO (T15A), mutation T15A was acquired while gene cloning and contained in the consensus sequence GXGVXGS which was assumed to be responsible for the binding of the adenine moiety of FAD [14]. Influence of his-tags on cell growth differed with its fusing positions. Compared with CHDAO, DAO, and DAO (T15A) bearing recombinant E. coli strains, the growth rate of NHDAO bearing strain decreased significantly. Its final cell density could only reach to 3.0 (OD600), which was 60 % of those of CHDAO, DAO, and DAO (T15A) (Fig. 1a). SDS-PAGE analysis showed NHDAO and CHDAO had a slight increase in molecular weight as expected. NHDAO was expressed as a soluble protein while a large fraction of CHDAO and DAO was in the form of inclusion bodies. An even bigger proportion of DAO (T15A) was contained in the insoluble fraction. Meanwhile, total protein of NHDAO decreased more than 50 % in comparison with CHDAO, DAO, and DAO (T15A) (Fig. 1b). This might be partly ascribed to the lower cell growth rate and shortened growth period. Despite the relative low biomass yield, volumetric activity and specific activity of NHDAO were equal to those of CHDAO and higher than those of DAO and DAO (T15A). The increased volumetric activity of his-tagged DAOs and decreased cell density of NHDAO bearing strain were different from what was reported by Ma et al. [10]. This might be ascribed to the difference in culture conditions, activity analysis methods, and gene structure (an extra Val344Ile mutation was described in Ma’ study). Interestingly, holoenzyme percentage of NHDAO and CHDAO was 70 %, obviously higher than 40 % of DAO or DAO (T15A) (Fig. 1c). It seemed that the percentage of holoenzyme to a great extent relied on the his-tags addition while no significant difference between DAO and DAO (T15A) observed. Analysis of crystal structure of RgDAAO (PDB 1C0P) found no direct interaction between the Ser18 (In TvDAO, it is Thr15) and the adenine moiety of FAD, but a probable H-bond formed by the side chain hydroxyl groups of Ser18 [3]. Perhaps that was why a decreased solubility, not a lower holoenzyme percentage was observed with DAO (T15A). Furthermore, his-tags were also added to the N- and C-terminus of wild-type TvDAO, the same results were observed (data not shown). Also, the NHDAO was purified with Ni–NTA column (The detailed process of NHDAO purification was in ‘‘Supplementary file’’ and data were shown in Table S1 and Fig. S1 in ‘‘Supplementary file’’). Specific activity of purified
Bioprocess Biosyst Eng Fig. 1 Effect of various DAO type expression on the host cell growth and protein production. Culture was carried out in 250 mL flasks containing 50 mL of LB medium at 200 rpm and 37 °C, and induced with 0.5 mM IPTG at 25 °C for 22 h. a Effect on cell growth. b SDS-PAGE analysis. Lane 1, 2, 3, and 4: soluble fraction of DAO, NHDAO, CHDAO, and DAO (T15A); Lane 5, 6, 7, and 8: insoluble fraction of DAO, NHDAO, CHDAO and DAO (T15A); Lane M: protein molecular marker; Arrow indicated the band corresponding to DAOs. c Effect on enzyme activity. Values are means of three replicates and error bars are standard deviations
NHDAO enzyme was in accordance with the reported value of the purified no tagged control [5], which indicated that six-histidine tags locating at the N-terminus didn’t change the enzyme activity as Hwang et al. described [7]. His-tags are the most popular fusion tags for the isolation of proteins via metal affinity chromatography. The fusion tag is routinely attached to the protein with the assumption that the addition has no effect on structure or function. However, in our case, the fusion position effect of
his-tags on cell growth, protein solubility, and cofactor binding was revealed. Whether the improvement of NHDAO solubility can be ascribed to the change of folding/unfolding pattern or the slowdown of the transcription or translation rate remains uncertain. TvDAO solubility was improved by the protein expression rate optimization [13]. In another research, a better TvDAO solubility was obtained when the protein production was regulated by a native promoter [24]. It has been reported that the
123
Bioprocess Biosyst Eng
downstream A-rich region after the start codon ATG could function as a general translation enhancer in E. coli gene expression [25]. In our case, as was shown by primer DAOF and N-HIS in Table 1, the downstream A-rich region (AAAATC) in the wild-type TvDAO gene was replaced by the codons for histidines (CATCAC) in NHDAO gene. That might contribute to a decreased protein production rate and thus improve the folding of N-terminus tagged NHDAO finally. Significantly increased solubility and holoenzyme formation made NHDAO a better choice for TvDAO production. However, the impact of NHDAO expression on its host cell, manifested itself in the form of reduced cell growth and limited protein production, might have hampered its more efficient expression. To optimize the
Fig. 2 Effect of D-Alanine concentration on the host cell growth and enzyme activity. a Effect on cell growth. b effect on enzyme activity. Culture was carried out in 250 mL flask containing 50 mL LB medium at 200 rpm and 37 °C, and induced with 0.5 mM IPTG at 25 °C for 22 h. As for NHDAO expression, D-Alanine was added to a final concentration of 20 or 40 mM with IPTG. Values are means of three replicates and error bars are standard deviations
123
performance of NHDAO production in E. coli, the effects of culture medium on growth behavior and protein synthesis were further investigated. Effect of D-Alanine (Ala) supplement on NHDAO expression Additional D-Ala, at final concentration of 20 or 40 mM, was added to the medium broth with IPTG to inspect the effect of D-Ala supplement on cell growth and NHDAO production. D-Ala supplementation markedly enhanced cell growth and protein production (Fig. 2). Growth curves of NHDAO bearing strain came closer to the DAO control as D-Ala concentration increased (Fig. 2a). The volumetric activity and specific activity for the total protein observed
Bioprocess Biosyst Eng
for NHDAO with 40 mM D-Ala supplementation were up to 4.0 and 2.7-fold greater, respectively (Fig. 2b). However, the use of supplemented D-amino acids has to be considered cautiously since it might compromise process economy, especially at larger scale. In the previous work, D-amino acid addition would enhance the enzyme production, but didn’t change the growth kinetics and biomass yield [9]. In our study, increased biomass yield and NHDAO production might indicate that D-Ala served as a limiting factor for cell growth and protein production in NHDAO bearing strains. As D-amino acid oxidases catalyze O2-dependent transformation of D-amino acids, de novo D-amino acids synthesis is required to maintain intracellular pool of D-amino acids for cell wall synthesis. Thus, it would make an
additional demand for nutrients like carbon and nitrogen sources. Effect of lactose induction on NHDAO expression Experiments with the NHDAO bearing strain induced by different concentrations of lactose were performed. Meanwhile, the DAO bearing strain induced by 12.5 mM lactose was set as control. As lactose concentration increased, log phase of the growth period extended (Fig. 3a). Still, influence of supplementary lactose on growth curve differed with TvDAO type. Comparing with DAO bearing strain, additional 37.5 mM of lactose was needed for NHDAO bearing strain to reach a final cell density of 10.5 (OD600) (Fig. 3a).
Fig. 3 Effect of lactose concentration on the host cell growth and enzyme activity. a effect on cell growth. b effect on enzyme activity. Culture was carried out in 250 mL flask containing 50 mL LB medium at 200 rpm and 37 °C, and induced with different concentration of lactose at 25 °C for 30 h. Values are means of three replicates and error bars are standard deviations
123
Bioprocess Biosyst Eng
DAO production was linearly correlated with the concentration of lactose. When induced with 50 mM of lactose, in comparison to induction with 0.5 mM of IPTG, 11-fold increase in volumetric activity was observed (Fig. 3b). The specific activity was 17.53 U/mg for the crude extract. That meant functional NHDAO accounted for 43.6 % of the total protein, higher than what was reported before [7–14] (This value was calculated by the comparison of specific activities before and after purification). Interestingly, lactose induction also benefited holoenzyme formation. Percentage of the holoenzyme was positively correlated with the lactose concentration (Fig. 3b). When induced with 12.5 mM of lactose, 6 and 25 % increases in holoenzyme percentage were observed for NHDAO and DAO, respectively. When a higher concentration of lactose was added, more than 95 % of NHDAO was in the holoenzyme form (Fig. 3b). Lactose, compared with IPTG, was a moderate inducer and carbon source simultaneously [26]. Considering the low cost and toxicity, lactose was regarded as a suitable choice for TvDAO production as increased volumetric and specific activity was observed [7]. The lactose concentration gradient study here further showed the possibility that an additional amount of lactose would meet the extra demand for carbon sources and partly relieve the toxicity of NHDAO expression to host cell growth and protein production. In previous research, influence of culture conditions (induction temperature and oxygen supply) on holoenzyme forming was observed [6, 22]. In this work, it was shown that the percentage of holoenzyme also relied on the inducer or carbon source supply. In conclusion, the use of a suitable concentration of lactose allowed a TvDAO production with higher yield and better quality. Effect of culture medium on NHDAO expression A systematic optimization of the culture medium such as culture medium type, yeast extract type, nitrogen source type, carbon source type, and phosphate buffer saline (PBS) concentration was further carried out under the induction of 50 mM lactose. LB, TB, TB-G, 2 9 YT, 2 9 YT-9, and 2 9 YT-13 media were employed to investigate their influence on cell growth and enzyme activity. The maximum cell density and NHDAO activity were observed in TB-G medium (Fig. 2S). Therefore, it was chosen as the basic fermentation medium for further optimization. The 2.4 % (w/v) Oxoid yeast extract in TB-G medium was substituted by Angel yeast extract with a much lower price at the concentration of 2.4–3.2 % (w/v) (Fig. 3S). The tryptone in TB-G medium was substituted with 1.2 % (w/v) of various organic nitrogen sources. Recombinant E. coli strain cultured in the presence of the
123
fish peptone or peanut powder achieved the highest enzyme activity. Since the insoluble particle in peanut powder might increase the difficulty for downstream processing, fish peptone was selected. The optimized concentration of fish peptone was 1.8 % (w/v) (Fig. 4S). 0.5 % (w/v) of various carbon sources was added to the culture medium. The results indicated that sucrose or dextrin or starch were favorable for the production of NHDAO. Dextrin was the best for enzyme activity and cell growth. Compared with the control one without any extra carbon source addition, the NHDAO activity increased nearly 100 % when an optimum concentration of 1 % (w/v) dextrin was added to the medium (Fig. 5S). This result further revealed the importance of carbon source supply for NHDAO production. The concentration of PBS varied from 0 to 178 mM was tested. Its effects on the initial culture pH and subsequent cell growth and enzyme activity were shown. The best concentration of PBS was 133.5 mM with an initial culture pH about 6.7 (Fig. 6S). After optimization, the growth of recombinant E. coli BL21 (DE3)/pET-NHDAO and the production of NHDAO were obviously improved (Fig. 2S * Fig. 6S). The OD600 and the enzyme activity attained to 21.51 and 120.22 U/mL, respectively (Fig. 6S). Scale-up cultivation Scale-up cultivation was performed in a 3.7 L fermenter containing 2.0 L optimized synthetic medium. It provided us tight control of process parameters such as aeration. As NHDAO is sufficiently toxic to the host cell and a high concentration of phosphate combined with a rich medium might increase the host cell resistance to kanamycin like Studier reported [27], a relative high concentration of kanamycin (0.12 g/L) was added to the medium to help the establishment of plasmid pET-NHDAO in host cell. Benefited from a culture medium balanced with nitrogen and carbon sources, drastic change in pH was avoided. Still, no significant cell lysis was observed as a relative low DO concentration (25–30 %), as previously reported, was maintained [11]. A production of 3.48 g active enzyme per liter medium or volumetric activity of 140 U/mL with a productivity of 4.7 KU L-1 h-1 was achieved in 28.5 h (Fig. 4). The specific activity was 16.68 U/mg for the crude extract or 2,100 U/g wet cell weight (wcw), accounted for 41.4 % of the total protein. Meanwhile, the holoenzyme percent of enzyme was 96 %. It confirmed the feasibility of a strategy used for NHDAO boom production at a large scale without compromising the protein quality and space-time yield. Further scale-up in 30 and 300 L fermenters is in progress. Various activity analysis methods in different publications make direct and quantitative comparison of published TvDAO enzyme activity data difficult. Until now, to our knowledge, the highest volumetric activity of TvDAO
Bioprocess Biosyst Eng Fig. 4 Time course of scale-up cultivation in 3.7 L fermenter containing 2.0 L medium. The arrow indicates the addition of lactose. The fermentation was carried out with 2.5 % of the inoculum. 50 mM lactose was added at OD600 of 3.0. The temperature was kept at 25 °C, and the DO was maintained 25 * 30 % during the fermentation. Values are means of three replicates and error bars are standard deviations
production was 220 U/mL obtained in P. pastoris by a much longer fed-batch cultivation lasting about 110 h [18]. This high volumetric activity should be partly ascribed to a high biomass concentration (more than 200 g/L) and a more complicated multi-step engineering approach including codon redesign, change of peroxisomal targeting sequence, multi copy integration, and screening [18]. Still, when exceeding a certain level in the cell, the recombinant TvDAO behaves like an inhibitor to P. pastoris growth [18]. However, in contrast with the relative low biomass yield and volumetric activity, NHDAO production in E. coli showed advantages in space-time yield (4.7 vs 2 KU L-1 h-1) and specific activity (2,100 vs 1,283 U/g wcw) [18]. For CPC oxidation, unlike E. coli expression system, TvDAO obtained from the yeast T. variabilis is structurally micro heterogeneous due to the partial oxidation and oxidatively modified TvDAO remains only 25 % activity of the native one [20]. Also, enzymatic conversion of cephalosporin C relies on the H2O2 produced in the first step to transform the a-keto acid intermediate to product, several steps of downstream processing are needed to obtain an immobilized biocatalyst without catalase and esterase activities in the P. pastori expression system for an extensive proliferation of peroxisomes [28–31]. All those indicated a possibility for functional and economical TvDAO expression in E. coli to meet the industrial need especially for CPC oxidation.
Conclusions In this work, effects of his-tags fusing position with TvDAO were revealed. N-terminus tagged TvDAO (NHDAO) was found to be a suitable choice. To optimize the NHDAO production, a systematic optimization of culture medium was employed. Scale-up cultivation got a production of 3.48 g active enzyme per liter medium in
28.5 h and a specific activity of 16.68 U/mg for the crude extract, accounted for 41.4 % of the total protein. This indicated a possibility for functional and economical TvDAO expression in E. coli. The optimized results showed that the expression system, inducer, medium composition, and cultivation condition had great influences on high-level expression of TvDAO in E. coli. Acknowledgments This work was supported by the National Basic Research Program of China (No. 2012CB721103), the Fundamental Research Funds for the Central Universities and the Open Funding Project of the State Key Laboratory of Bioreactor Engineering.
References 1. Vijay C (2006) Enzymatic modifications of cephalosporins by cephalosporin acylase and other enzymes. Crit Rev Biotechnol 26:95–120 2. Loredano P, Laura C, Gianluca M, Silvia S, Mirella SP (2004) Catalytic properties of D-amino acid oxidase in CPC bioconversion: a comparison between proteins from different sources. Biotechnol Prog 20:467–473 3. Umhau S, Pollegioni L, Molla G, Diederichs K, Welte W, Pilone MS, Ghisla S (2000) The X-ray structure of D-amino acid oxidase at very high resolution identifies the chemical mechanism of flavindependent substrate dehydrogenation. Proc Natl Acad Sci 97:12463–12468 4. Komarova NV, Golubev IV, Khoronenkova SV, Chubar TA, Tishkov VI (2012) Engineering of substrate specificity of Damino acid oxidase from the yeast Trigonopsis variabilis: directed mutagenesis of Phe258 residue. Biochem (Mosc) 77(10):1181–1189 5. Wong KS, Fong WP, Tsang PWK (2010) A single Phe54Tyr substitution improves the catalytic activity and thermostability of Trigonopsis variabilis D-amino acid oxidase. New Biotechnol 27:78–84 6. Alonso J, Barredo JL, Armise´n P, Dı´ez B, Salto F, Guisan JM, Garcı´a JL, Corte´s E (1999) Engineering the D-amino acid oxidase from Trigonopsis variabilis to facilitate its overproduction in Escherichia coli and its downstream processing by tailor-made metal chelate supports. Enzyme Microb Technol 25:88–95
123
Bioprocess Biosyst Eng 7. Hwang TS, Fu HM, Lin LL, Hsu WH (2000) High-level expression of Trigonopsis variabilis D-amino acid oxidase in Escherichia coli using lactose as inducer. Biotechnol Lett 22:655–658 8. Lin LL, Chien HR, Wang WC, Hwang TS, Fu HM, Hsu WH (2000) Expression of Trigonopsis variabilis D-amino acid oxidase gene in Escherichia coli and characterization of its inactive mutants. Enzyme Microb Technol 27:482–491 9. Dib I, Stanzer D, Nidetzky B, Nidetzky B (2007) Trigonopsis variabilis D-amino acid oxidase: control of protein quality and opportunities for biocatalysis through production in Escherichia coli. Appl Environ Microbiol 73:331–333 10. Ma XF, Yu HM, Wen C, Luo H, Li Q, Shen ZY (2009) Triple fusion of D-amino acid oxidase from Trigonopsis variabilis with polyhistidine and Vitreoscilla hemoglobin. World J Micro Biot 25:1353–1361 11. Kim SJ, Kim NJ, Shin CH, Kim CW (2008) Optimization of culture condition for the production of D-amino acid oxidase in a recombinant Escherichia coli. Biotechnol Bioproc Eng 13:144–149 12. Stanzer D, Mrvcˇic´ J, Krizˇanovic´ S, Stehlik-Tomas V, Grba S (2011) Enhancement of Trigonopsis variabilis D-Amino acid oxidase overproduction in fed-batch cultivation of E. coli. Chem Biochem Eng Q 25(4):513–517 13. Hou J, Liu Y, Li Q, Yang J (2013) High activity expression of Damino acid oxidase in Escherichia coli by the protein expression rate optimization. Protein Expr Purif 88:120–126 14. Tishkov VI, Khoronenkova SV (2005) D-Amino acid oxidase: structure, catalytic mechanism, and practical application. Biochem (Mosc) 70:40–54 15. Gonza´lez FJ, Montes J, Martin F, Lo´pez MC, Fermin˜a´n E, Catala´n J, Gala´n MA, Domı´nguez A (1997) Molecular cloning of TvDAO1, a gene encoding a D-amino acid oxidase from Trigonopsis variabilis and its expression in Saccharomyces cerevisiae and Kluyveromyces lactis. Yeast 13(15):1399–1408 16. Yu J, Li DY, Zhang YJ, Yang S, Li RB, Yuan ZY (2002) High expression of Trigonopsis variabilis D-amino acid oxidase in Pichia pastoris. J Mol Catal B Enzym 18:291–297 17. Zheng HB, Wang XL, Chen J, Zhu K, Zhao YZ, Yang YL, Yang S, Jiang WH (2006) Expression, purification, and immobilization of His-tagged D-amino acid oxidase of Trigonopsis variabilis in Pichia pastoris. Appl Microbiol Biot 70:683–698 18. Abad S, Nahalka J, Bergler G, Arnold SA, Speight R, Fotheringham I, Nidetzky B, Glieder A (2010) Stepwise engineering of
123
19.
20.
21.
22.
23.
24.
25.
26.
27. 28. 29.
30. 31.
a Pichia pastoris D-amino acid oxidase whole cell catalyst. Microb Cell Fact 9:24 Redo VA, Novikova EK, E´l’darov MA (2011) Expression of modified oxidase of D-amino acids of Trigonopsis variabilis in methylotrophic yeasts Pichia pastoris. Prikl Biokhim Mikrobiol 47(1):39–45 Slavica A, Dib I, Nidetzky B (2005) Single-site oxidation, cysteine-108 to cysteine sulfinic acid, in D-amino acid oxidase from Trigonopsis variabilis and its structural and functional consequences. Appl Environ Microbiol 71:8061–8068 Molla G, Vegezzi C, Pilone MS, Pollegioni L (1998) Overexpression in Escherichia coli of a recombinant chimeric Rhodotorula gracilis D-amino acid oxidase. Protein Expr Purif 14:289–294 Alonso J, Barredo JL, Diez B, Mellado E, Salto F, Garcia JL, Cortes E (1998) D-Amino acid oxidase gene from Rhodotorula gracilis (Rhodosporidium toruloides) ATCC 26217. Microbiol 144:1095–1101 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, Cold Spring Harbor. Cold Spring Harbor Laboratory Press, New York Liu Y, Li Q, Zhu H, Yang J (2009) High soluble expression of Damino acid oxidase in Escherichia coli regulated by a native promoter. Appl Biochem Biotechnol 158:313–322 Brock JE, Paz RL, Cottle P, Janssen GR (2007) Naturally occurring adenines within mRNA coding sequences affect ribosome binding and expression in Escherichia coli. J Bacteriol 189:501–510 Gombert AK, Kilikian BV (1998) Recombinant gene expression in Escherichia coli cultivation using lactose as inducer. J Biotech 60:47–54 Studier FW (2005) Protein production by auto-induction in highdensity shaking cultures. Protein Expres Purif 41:207–234 Gleeson MA, Sudbery PE (1988) The methylotrophic yeasts. Yeast 4:1–15 van der Klei IJ, Yurimoto H, Sakai Y, Veenhuis M (2006) The significance of peroxisomes in methanol metabolism in methylotrophic yeast. Biochim Biophys Acta 1763:1453–1462 Liese A, Seelbach K, Wandrey C (2006) Industrial biotransformations. Wiley-VCH, Weinheim Riethorst W, Reichert A (1999) An industrial view on enzymes for the cleavage of Cephalosporin C. Chimia 53:600–607
