HLA-DP polymorphsm in Sudanese controls and patients with insuh-dependent diabetes melhtus M. M. A. Magzoub, H. A. F. Stephens, J. A. Sachs, P. A. Biro, S. Cutbush, Z. Wu, G. F. Bottazzo. HLA-DP polymorphism in Sudanese controls and patients with insulin-dependent diabetes mellitus. Tissue Antigens 1992: 40: 64-68.
M. M. A. Magzoub'j, H. A. F. Stephens', J. A. Sachs', P. A. Biro', S. Cutbush', 2. Wu' and 6. F. Bottano2
Abstract: Human leukocyte antigen (HLA) genes are candidates for susceptibility to insulin-dependent diabetes mellitus (IDDM). The association of IDDM with particular DR and DQ alleles has been reported in all populations studied, but its association with HLA-DP alleles has been controversial. To address this question we analyzed 19 DPBl and 2 DPAl alleles and their associations in well-characterized Sudanese (an admixture of Arab and Black) IDDM patients (n = 71) and ethnically matched controls (n = 86) using polymerase chain reaction-sequence specific oligonucleotide (PCR-SSO) typing. There were no significant differences between the patient and control groups in the DPBl frequencies. DPB1*0201, *0401 and DPAl*Ol were the most frequent alleles in both IDDM patients and control subjects. Significant positive and negative associations between DPBl and DPAl alleles were detected in both groups. A novel DPB 1 allele included in DPB 1* 1701 was identified.
'Faculty of Medicine, University of Gedra, Sudan, 'Department of Immunology, The London Hospital Medical College, London, U.K., 3Department of Immunology, AFRIMS, Bangkok. Thailand
I
Introduction Genetic predisposition to IDDM (an autoimmune disease involving destruction of the beta cells of the pancreas (1, 2)) is coded by genes in the HLA Class I1 region (DR, DQ and DP) (3, 4) and its association with HLA-DR3 and -DR4 is well established (5). Comparative nucleotide-sequence analysis (6) suggests direct involvement (rather than indirect association by linkage) of DQBl alleles in IDDM susceptibility. However, the DQBl allelic variation does not provide a complete explanation of the genetic basis of IDDM (7) and some involvement of other linked (8) and unlinked (9) genes is indicated. Thus associations have also been described between IDDM and insulin (10, 11) and Ig heavy chain (12) genes. Another HLA locus with possible involvement in IDDM is HLA-DP. There are structural (13) and functional (14) similarities between HLADP, -DQ and -DR molecules, but the presence of linkage disequilibrium between HLA-DP and -DQ and -DR alleles is controversial (15-17). Associations between DP alleles and several other autoimmune diseases have been described that appear to be independent of the DR and/or DQ associations (18-22), but the role of DP antigens 64
Key words: HLA-DP polymorphism Sudanese oligotyping
-
- IDDM -
Received 27 December 1991, revised, accepted for publication 20 March 1992
in the pathogenesis of IDDM remains to be determined. The study of HLA-DP polymorphism has, until recently, been limited because of its dependence on the cellular technique of primed lymphocyte typing (PLT). Southern blot analysis of genomic DNA with DPA and DPB gene probes has shown some correlation between restriction fragment length polymorphism (RFLP) profiles and DP alleles (23-26). DP typing is now feasible using PCR-mediated DNA amplification and sequence-specificoligonucleotide (SSO) probing. This approach has revealed additional DP allelic polymorphism (27-29). Using the material supplied to the 1lth International HLA Workshop for DP genotyping, we have now extended our earlier study of the analysis of HLA Class I1 (DR and -DQ) gene polymorphisms in Sudanese controls and patients with IDDM (30) in order to establish the frequency of the different HLA-DP in a Central Sudanese population and in patients with IDDM.
Material and methods Patients and controls
IDDM patients and controls were collected from the Central Region of Sudan. Their clinical and
KLA-DP polymorphism in the Sudanese biochemical characteristics have been described previously (30). The number of controls has been increased from 59 to 97. DNA preparation
High molecular weight DNA was isolated from 10-20 ml of whole blood samples by salt precipitation (31). Primers and probes
These were provided by the 11th International HLA Workshop. The primer sequences for amplifying the second exons of the DPAl and DPBl genes are: Left DPAAMP-A 5’ - GCGGACCATGTGCAACTTAT - 3’ Right DPAAMP-B 5’ GCCTGAGTGTGGTTGGAACG - 3’ Left DPBAMP-A 5’ - GAGAGTGGCGCCTCCGCTCAT - 3’ Right DPBAMP-B 5’ GCCGGCCCAAAGCCCTCACTC - 3‘
SSO probe sequence and specificities are shown in Table 1. Probe labelling
at 42°C in 5 x SSPE, 5 x Denhardt’s solution, 0.5% SDS and 100 pg/ml denatured herring sperm DNA for at least 1 h and then hybridized under the same conditions with labelled SSO (0.5 pmol/ml) for 2-16 h. Washing
Membranes are washed twice in 2 x SSPE, [lo x SSPE is 1.5 M NaC1, 0.1 M sodium phosphate, 10 mM EDTA (PH 7.4)] 0.1% SDS at room temperature for 10 rnin followed by washing in 6 x SSPE, 1% SDS for 10 min twice at the Td. The Td may be calculated from the equation Td =4 x (number of GC in SSO)+2 (number of AT in SSO). Autoradiography
Positive hybridizations were visualized by autoradiography at room temperature using X-Ray film (Kodak, XAR-5) for 1-16 h. Dehybridization and reprobing of membranes
Filters can be used repeatedly after successful removing of the probes by washing in 0.4 M NaOH at 42°C for 20 min followed by neutralization in 0.2 M Tris-HC1 (pH 8.0), 0.1 x SSPE, 0.10/0SDS at 42°C for 20 min. Results
All probes were 3’-end-labelled with C X - ~ ~ P - ~ C TDefinition P of DPB1 alleles using terminal deoxynucleotidyl transferase Due to the dispersed nature of the sequence vari(Amersham) to high specific activities. The labelled SSOs were used directly without elimination of ation in the second exon of the DPBl genes, the unincorporated radioactive nucleotides. oligonucleotides used in this typing were sequencespecific, not allele-specific. Most of the polymorphisms reside in six distinct hypervariable regions in PCR the DPBl second exon. 19 DPBl alleles (32), could 0.5-1 pg of genomic DNA from each sample (in be defined with the panel of 25 SSO probes directed 100 pl reaction mixture) was subjected to 30 cycles against these six regions (Table 1). of amplification (denaturation: 96°C for 1 min; annealing: 55°C for 30 sec; extension: 72°C for 1 Definition of DPAl alleles min) for DPAl amplification, and (denaturation: To define the DPAl alleles four SSO probes were 96°C for 1 min; annealing: 30°C for 30 sec; extension: 72°C for 1 min) for DPBl amplification. 2 used which hybridized to the two polymorphic reand 1.5 mM of MgClz were used in the reaction gions in the second exons of the DPAl genes. buffers for DPA 1 and DPB 1, respectively. DPAl*O101 has identical nucleotide sequences at the second exon to those of the DPA1*0102 and DPA1*0103 alleles. Since these 3 alleles cannot Dot-blot hybridization be distinguished by oligotyping with the 4 SSOs provided for the DPAl allele, DPAI-*O1, was as2-5 p1 of amplified DNA were applied to Hybond N nylon membranes (Amersham) by manual presigned for DPA1*0101, 0102 and 0103 (Table 2). paration. DNA was denatured by immersion in 0.4 The frequencies of 19 DPBl and 2 DPAl alleles M NaOH for 5 min followed by neutralization in defined in this study are shown in Table 3. None of the individuals tested had DPB1*0202, 1001, 1.5 NaCl, 0.1 M sodium phosphate, 10 mM EDTA, 1801 or 1901. DPB1*0201 was the most frequent pH 7.4 for 10 min. Membranes were prehybridized
Magzoub et al. Table 1. Determination of DPB alleles by S O probe hybridization DPB1 allele
sso
Sequence
DPB0901 DPB0902 DPB09D3 DPBD904
GAAllACClllXCAGGGA GTGTACCAGlTACGGCAG GTGTACCAGGGACGGCAG GTGCACCAGllACGGCAG
DPB3501 DPB3502 DPB3503 DPB3504 DPB3505
GGGAGGAGTEGCGCGCT GGGAGGAG'ITCGTGCGCT GGGAGGAGCTCGTGCGCT ACAACCGGCAGGAGTACG GGGAGGAGTACGCGCGCT
DPB5501 DPB5502 DPB5503 DPB5504
GGCCTGCTGCGGAGTACT GGCCTGATGAGGAGTACT GGCCTGAGGCGGAGTACT GGCCTGATGAGGACTACT
DPB6502 DPB6901 DPB6902 DPB6903 DPB6905 DPB6906
GCCAGAAGGACCTCCTGG GACATCCTGGAGGAGAAGC GCTCCTCCTCCAGGATGTC GACCTCCTGGAGGAGAAGCG ACCTCCTGGAGGAGAGGC GAGGAGAAGCGGGCAGTG
DPB7601 DPB7602 DPB7603
GGAC AGGATGTGCAGACA GGAC AGGGTATGCAGACA GGAC AGGATATGCAGACA
DPB8501 DPB8502 DPB8503
AGCTGGGCGGGCCCATGA AGCTGGTCGGGCCCATGA AGCTGGACGAGGCCGTGA
0 1 0 1
Amino acid
Table 2. Determination of DPA alleles by S O probe hybridization DPAl allele
Sequence
DPA3101 DPA3102
AAGATGAGATGTKTATG AAGATGAGCAG'ITCTATG
DPA5001 DPA5002
AGTTTGGCCAAGCCTll AGTTTGGCCGAGCCTTT
66
0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 2 3 4 4 5 6 8 9 0 1 3 4 5 6 7 8 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1
8 13 LFQGRQ WQLRQ WQGRQ VHQLRQ 32 37 REEFAR REEFVR REELVR RQEYAR REEYAR 53 59 RPAAEYW RPDEEYW RPEAEYW RPDEDYW 61 72 SQKDLLE DILEEK DILEEE DLLEEK DLLEER EEKRAV 73 79 PDRMCRH PDRVCRH PRRICRH 82 88 ELGGPMT ELVGPMT ELDEAVT
oligotype in both the disease (54.3%) and the control (52.6%) groups. There were no significant differences in the frequencies of the DPBl alleles between these two groups. DPAI*OI was the most and control indifrequent in both patients (86.4Y0) viduals (85.8%). There were no significant differ-
sso
0 2 0 1
Amino acid 2a 34 EDEMFYV EDEQFYV 47 53 EFGQAFS EFGRAFS
0 1 0 1
0 0 0 1 1 2 0 0 0 2 3 1
+ + + -
-
- - +
+ + +
- -
-
- +
ences in the frequencies of the DPAl alleles between the two groups. Associations between the DPAl and DPBl oligotypes were calculated by 2 x 2 tables for each combination. The significant uncorrected DPA 1-DPB1 positive associations in the two groups are: DPBI*1701 with DPA1*0201 in the patient group and DPB1*0101, 1301, 1701 with DPA*0201 in the control group @=3.0x 10-4, p=5.0 x 10-4, p=2.0 x 10-3, p = LO x respectively). Conversely, DPB 1* 1401 with DPAI*OI and DPB1*0301,0401 with DPA1*0201 in the patient group DPB1*0101 with DPAl*OI and DPB1*0201,0401 with DPA1*0201 in the control group (p=2.5 x lod3, p = 1.0 x lo-', p=3.7 x p=2.0 x p=5 x p = 1.0 x lod2respectively) showed uncorrected significant negative associations. 29 individuals (17 control subjects and 12 IDDM patients) were typed as DPB 1* 1701. Twenty-two samples were positive with all the six probes which identify this allele. Seven samples (1 control and 6
HLA-DP polymorphism in the Sudanese sixth (DPB5504). The same 7 individuals were identified by the DPB5503 SSO probe (Table 4). We propose that these 7 individuals possess a new DPBl allele (designated DPBl*1701Su) as a split of DPB1*1701. The detected difference between the 2 alleles resides in a single nucleotide substitution at codon 55 (GAT-DPBl*1701 vs GAGDPB 1* 1701Su) corresponding to a change from glutamic acid to alanine (Table 1). Sequencing the entire gene may reveal additional differences outside the region screened by the SSO probes. Previous investigations have shown that different ethnic groups may have marked differences in DPBl allelic frequencies. In the Sudanese (an admixture of Arabs and Black Africans) DPB1*0201 and *0401 are by far the most frequent alleles (Table 3), whereas DPB1*0401 and *0402 are the most frequent alleles among Caucasoids (33, 34). The DPB1*0501 allele, the most frequent in Japanese (33, was found only in 1 of the 167 Sudanese tested. The most frequent DPAl allele in the Sudanese is DPAI*Ol, as found in Caucasoids. In our analysis, most of the DPBl alleles occurred with either of the DPAl alleles, but only a few significant associations, either positive or negative, were observed. These associations could reveal a different kind of polymorphism by creating epitopes that cannot be correlated with specific sequences in either DPA or DPB but are conformational. IDDM is associated with particular DR and DQ alleles in all populations studied so far but its association with DP alleles has been unclear. Recently, the involvement of HLA-DPw3/6 in Caucasian Australian IDDM patients has been reported (36). However, DPw3/6 did not correlate with susceptibility to IDDM in South Indians (37) and Japanese (35). In our study, no significant association was detected between HLA-DP alleles and IDDM in the Sudanese.
Table 3. Phenotype frequency (P.F.) and gene frequencies (G.F.) of DPBl polymorphisms in Sudanese IDOM patients and mntrols
IDOM (11-70) DP allele
PF%
OPB1 '0101 '0201 '0202 '0301 11401 '0402 0501 '0601 40801 '0901 '1 001 '1 101 7301 '1 401 1 ' 501 '1 601 '1 701 '1 801 '1 901
5.7 54.3 0 17.1 47.1 10.0 0 4.3 1.4 0 0 4.3 4.3 2.9 29 4.3 24.3 0 0
OPAl '01 OPAl '0201
86.4' 43.9 ~~~
'
Controls (n-97)
GF'
'
0.03 0.33 0 0.09 0.27 0.06 0 0.02 0.01 0 0 0.02 0.02 0.02 0.02 0.02 0.1 3 0 0
10.3 52.6 0 11.3 37.1 18.6 1.a 4.1
0.05 0.31 0 0.06 0.21 0.10 0.005 0.02 0 0.02 0 0.02 0.04 0 0.05 0.02 0.07 0
'0 3.1 0 3.1 6.2 0 9.3 3.1 12.4 0 0
0.63 0.26 ~
GF'
PF%
0
85.8' 37.4+
0.62 0.21
~
n-66; + n=91 calculated from the formula 1 - v ( l -PF).
IDDM samples) reacted positively with five (DPB0904,3502,6902,7601 and 8503) probes and negatively with the sixth (DPB5504). The same seven samples reacted positively with the SSO probe DPB5503 which detects DPBl*O202, 0501 and 1901 (Table 4). Discussion
DNA typing by SSO provides the best direct definition of DPBl polymorphisms. We have used a full panel of 25 SSO probes to precisely define the 19 official DPB 1 alleles. The hybridization patterns in Sudanese correspond to those described by the workshop. DPB1*1701 was of particular interest as it gave rise to a new specificity. The split in this allele was detected in 7 individuals who reacted positively with five of the six SSO probes that identify DPB*1701, but failed to react with the
Acknowledgment
This research was supported by the University of Gezira and the British Council (M.M.A.M.) and by the Arthritis and Rheumatism Council (S.C.).
Table 4. Reaction patterns of SSO probes splitting DPB1'1701 DPBl SSO probes
No. of Individuals 22 7
0904
3502
5504
6902
7601
8503
5503
+ +
+
+
+
+
+ +
-
+
-
+
+
+
Designation of allele OPB1'1701 OPB1'1701SU
67
Magzoub et al. References 1. Bottazzo GF. Betacell damage in diabetic insulitis: are we approaching a solution? Diabetologia 1984: 26: 241-9. 2. Eisenbarth GS. Type I diabetes mellitus, a chronic autoimmune disease. N Engl J Med 1986: 314 1360-8. 3. Thomson G.HLA disease associations: models for insulin dependent diabetes mellitus and the study of complex human genetic disorders. Ann Rev Genet 1988: 22: 31-50. 4. Todd JA. Genetic control of autoimmunity in Type I diabetes. Irnmunol Today 1990: 11: 122-9. 5. Svejgaard A, Platz P, Rider LF? Insulin dependent diabetes mellitus. In: Terasaki PI, ed. Histocompatibility Testing. Los Angeles: UCLA Tissue Typing Laboratory, 1980. 6. Todd JA, Bell JI, McDevitt HO. HLA-DQB gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature 1987: 329: 599-604. 7. Serjeantson SW,Easteal S.Class I1 histocompatibility genes and insulindependent diabetes mellitus. Mol Biol Med 1990 6 219-26. 8. Deschamps I, Marcelli-Barge A, Lallemand N, et al. Study of cis and trans interactions between extended HLA-haplotypes in insulin-dependent diabetes. Tissue Antigens 1988: 31: 259-69. 9. Rotter JI, Landow EM. Measuring genetic contribution of a single locus to a multilocus disease. Clin Genet 1984: 26: 52942. 10. Bell GL, Horita S, Karam HJ. A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus. Diaberes 1984 33: 176-83. 11. Julier C, Hyer RN, Davies H, et al. Insulin-IGF2 region on chromosome I l p encodes a gene implicated in HLADRCdependent diabetes susceptibility. Nature 1991: 354: 155-9. 12. Field LL,Anderson CE, Neiswanger K, Hodge SE, Spence MA, Rotter JI. Interaction of HLA and immunoglobulin antigens in Type I (insulin-dependent) diabetes. Diabetologia 1984 27: 504-8. 13. Korman AJ, Boss JM, Spies T, Sorrentino R, Okada K, Strominger JL. Genetic complexity and expression of human histocompatibility antigens. Immunol Rev 1985: 85: 45-86.
14. Eckels DD, Lake P, Lamb JR, et al. SB-restricted presentation of influenza and herpes simplex virus antigens to human T-lymphocyte clones. Nature 1983: 301: 716-8. 15. De John BM, Termijtelen A, Bruining GJ, de Vries RRP, van Rood JJ. Relation of insulin-dependent diabetes mellitus (IDDM) and the HLA linked SB system. Tissue Antigens 1984: 23: 87-93. 16. Odum N, Hartzman R, Jakobsen BK, et al. The HLADP polymorphism in Denmark investigated by local and international PLT reagents. Tissue Antigens 1986: 2 8 105-
18. 17. Peterson CM, Moller BK, Lamm LU. HLA-DPw antigens in Danes and Eskimos as determined by local PLT-reagents. Tissue Antigens 1987:30: 217-28. 18. Odum N, Hyldig-Nielson JJ, Morling N, Sandberg-Wolheim M, Platz P, Svejgaard A. HLA-DP antigens are involved in the susceptibility to multiple sclerosis. Tissue Antigens 1988: 31: 235-7. 19. Odum N, Platz P, Morling N, et al. Increased frequency of HLA-DPw3 in severe aplastic anemia (AA). Tissue Antigens 1987: 2 9 184-5. 20. Hoffman RW, Shaw S, Francis LC, et al. HLA-DP antigens in patients with pauciarticular juvenile rheumatoid arthritis. Arthritis Rheum 1986: 29: 1057-62. 21. Begovich A, Bugawan TL, Nepom B, Klitz W, Nepom GT,
68
Erlich HA. A specific HLA-DP allele is associated with pauciarticular juvenile rheumatoid arthritis but not adult rheumatoid arthritis. Proc Nut1 Acad Sci USA 1989: 86:
9489-93. 22. Van Kerckhove L, Luyrink L, Elma MS, et al. HLA DPI DR interaction in children with juvenile rheumatoid arthritis. Irnmunogenerics 1990: 32: 363-8. 23. Hyldig-Nielson JJ, Morling N, Odum N, et al. Restriction fragment length polymorphism of the HLA-DP phenotypes. Proc Natl Acad Sci 1987: 84: 1644-8. 24. Bodmer J, Bodmer W, Heyes J, et al. Identification of HLADP polymorphism with DP alpha and DP beta probes and monoclonal antibodies: correlation with primed lymphocyte typing. Proc Nut1 Acad Sci 1987: 84: 4596-600. 25. Mitsuishi Y,Urlacher A, Tongio M-T, Mayer S. Restriction fragment length polymorphism of DP genes defines three new DP alleles. Immunogenetics 1987: 2 6 383-8. 26. Maeda M, Inoko H, Ando N, Uryu N, Nagata Y, Tsuji K. HLA-DP typing by analysis of DNA restriction fragment length polymorphisms in the HLA-DP beta subregion. Hum Immunol 1988: 21: 239-48. 27. Bugawan TL, Horn GT, Long CM, et al. Analysis of HLADP allelic sequence polymorphisms using the in vitro enzymatic DNA amplification of DP u and DP j3 loci. J Immunology 1988: 141:4024-30. 28. Angelini G,Bugawan TL, Delfino L, Erlich HA, Ferrara GB. HLA-DP typing by DNA amplification and hybridization with specific oligonucleotides. Hum Immunol 1989:26:
169-77. 29. Howell WM, Sage DA, Haegert DG, Evans PR, Smith JL. PCR-SSO typing for HLA-DBP alleles. Eur J Immunogentics 1991: 18: 81-95. 30. Magzoub MMA, Stephens HAF, Gale EAM, Bottazzo GF. Analysis of HLA-DR and -DQ gene polymorphisms in Sudanese patients with Type I (insulin-dependent)diabetes. Immunogenetics 1991: 34: 366-7 1. 31. Miller S, Dykes D, Polesky H. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic AcidF Research 1988: 16: 1215. 32. Bodmer JG, Marsh SGE, Albert E. Nomenclature for factors of the HLA system. Immunology T0du.v 1990: 11: 3-9. 33. Begovich AB, Helmuth RC, Oksenburg JR. HLA-DP beta and susceptibility to multiple sclerosis: an analysis of Caucasoid and Japanese patient populations. Hum Immund 1990:28: 365-72. 34. Al-Daccak R, Wang FQ, Theophille D, Lethielleux P, Colombani J, Loiseau P. Gene polymorphisms of HLA-DPBI and DPAl loci in Caucasoid population: Frequencies and DPBI-DPA1 associations. Hum Imrnunoll991:31: 277-85. 35. Yamagata K, Hanafisa T, Nakajima H, et al. HLA-DP and susceptibility to insulin-dependent diabetes mellitus in Japanese. Tissue Antigens 1991: 38: 107-10. 36. Easteal S, Kohonen-Corish MRJ, Zimmet P, Sejeantson SW. HLA-DP variation as additional risk factor in IDDM. Diabetes 1990: 39: 855-7. 37. Easteal S,Viswanathan M, Sejeantson SW. HLA-DP, -DQ and -DR RFLP types in South Indian insulin-dependent diabetes mellitus patients. Tissue Antigens 1990: 35: 71-4. Address: Professor G. B Bottazzo Department of Immunology The London Hospital Medical College Turner Street London El 2AD, U.K. Fax: 071-790-3033
M. M. A. Magzoub'j, H. A. F. Stephens', J. A. Sachs', P. A. Biro', S. Cutbush', 2. Wu' and 6. F. Bottano2
Abstract: Human leukocyte antigen (HLA) genes are candidates for susceptibility to insulin-dependent diabetes mellitus (IDDM). The association of IDDM with particular DR and DQ alleles has been reported in all populations studied, but its association with HLA-DP alleles has been controversial. To address this question we analyzed 19 DPBl and 2 DPAl alleles and their associations in well-characterized Sudanese (an admixture of Arab and Black) IDDM patients (n = 71) and ethnically matched controls (n = 86) using polymerase chain reaction-sequence specific oligonucleotide (PCR-SSO) typing. There were no significant differences between the patient and control groups in the DPBl frequencies. DPB1*0201, *0401 and DPAl*Ol were the most frequent alleles in both IDDM patients and control subjects. Significant positive and negative associations between DPBl and DPAl alleles were detected in both groups. A novel DPB 1 allele included in DPB 1* 1701 was identified.
'Faculty of Medicine, University of Gedra, Sudan, 'Department of Immunology, The London Hospital Medical College, London, U.K., 3Department of Immunology, AFRIMS, Bangkok. Thailand
I
Introduction Genetic predisposition to IDDM (an autoimmune disease involving destruction of the beta cells of the pancreas (1, 2)) is coded by genes in the HLA Class I1 region (DR, DQ and DP) (3, 4) and its association with HLA-DR3 and -DR4 is well established (5). Comparative nucleotide-sequence analysis (6) suggests direct involvement (rather than indirect association by linkage) of DQBl alleles in IDDM susceptibility. However, the DQBl allelic variation does not provide a complete explanation of the genetic basis of IDDM (7) and some involvement of other linked (8) and unlinked (9) genes is indicated. Thus associations have also been described between IDDM and insulin (10, 11) and Ig heavy chain (12) genes. Another HLA locus with possible involvement in IDDM is HLA-DP. There are structural (13) and functional (14) similarities between HLADP, -DQ and -DR molecules, but the presence of linkage disequilibrium between HLA-DP and -DQ and -DR alleles is controversial (15-17). Associations between DP alleles and several other autoimmune diseases have been described that appear to be independent of the DR and/or DQ associations (18-22), but the role of DP antigens 64
Key words: HLA-DP polymorphism Sudanese oligotyping
-
- IDDM -
Received 27 December 1991, revised, accepted for publication 20 March 1992
in the pathogenesis of IDDM remains to be determined. The study of HLA-DP polymorphism has, until recently, been limited because of its dependence on the cellular technique of primed lymphocyte typing (PLT). Southern blot analysis of genomic DNA with DPA and DPB gene probes has shown some correlation between restriction fragment length polymorphism (RFLP) profiles and DP alleles (23-26). DP typing is now feasible using PCR-mediated DNA amplification and sequence-specificoligonucleotide (SSO) probing. This approach has revealed additional DP allelic polymorphism (27-29). Using the material supplied to the 1lth International HLA Workshop for DP genotyping, we have now extended our earlier study of the analysis of HLA Class I1 (DR and -DQ) gene polymorphisms in Sudanese controls and patients with IDDM (30) in order to establish the frequency of the different HLA-DP in a Central Sudanese population and in patients with IDDM.
Material and methods Patients and controls
IDDM patients and controls were collected from the Central Region of Sudan. Their clinical and
KLA-DP polymorphism in the Sudanese biochemical characteristics have been described previously (30). The number of controls has been increased from 59 to 97. DNA preparation
High molecular weight DNA was isolated from 10-20 ml of whole blood samples by salt precipitation (31). Primers and probes
These were provided by the 11th International HLA Workshop. The primer sequences for amplifying the second exons of the DPAl and DPBl genes are: Left DPAAMP-A 5’ - GCGGACCATGTGCAACTTAT - 3’ Right DPAAMP-B 5’ GCCTGAGTGTGGTTGGAACG - 3’ Left DPBAMP-A 5’ - GAGAGTGGCGCCTCCGCTCAT - 3’ Right DPBAMP-B 5’ GCCGGCCCAAAGCCCTCACTC - 3‘
SSO probe sequence and specificities are shown in Table 1. Probe labelling
at 42°C in 5 x SSPE, 5 x Denhardt’s solution, 0.5% SDS and 100 pg/ml denatured herring sperm DNA for at least 1 h and then hybridized under the same conditions with labelled SSO (0.5 pmol/ml) for 2-16 h. Washing
Membranes are washed twice in 2 x SSPE, [lo x SSPE is 1.5 M NaC1, 0.1 M sodium phosphate, 10 mM EDTA (PH 7.4)] 0.1% SDS at room temperature for 10 rnin followed by washing in 6 x SSPE, 1% SDS for 10 min twice at the Td. The Td may be calculated from the equation Td =4 x (number of GC in SSO)+2 (number of AT in SSO). Autoradiography
Positive hybridizations were visualized by autoradiography at room temperature using X-Ray film (Kodak, XAR-5) for 1-16 h. Dehybridization and reprobing of membranes
Filters can be used repeatedly after successful removing of the probes by washing in 0.4 M NaOH at 42°C for 20 min followed by neutralization in 0.2 M Tris-HC1 (pH 8.0), 0.1 x SSPE, 0.10/0SDS at 42°C for 20 min. Results
All probes were 3’-end-labelled with C X - ~ ~ P - ~ C TDefinition P of DPB1 alleles using terminal deoxynucleotidyl transferase Due to the dispersed nature of the sequence vari(Amersham) to high specific activities. The labelled SSOs were used directly without elimination of ation in the second exon of the DPBl genes, the unincorporated radioactive nucleotides. oligonucleotides used in this typing were sequencespecific, not allele-specific. Most of the polymorphisms reside in six distinct hypervariable regions in PCR the DPBl second exon. 19 DPBl alleles (32), could 0.5-1 pg of genomic DNA from each sample (in be defined with the panel of 25 SSO probes directed 100 pl reaction mixture) was subjected to 30 cycles against these six regions (Table 1). of amplification (denaturation: 96°C for 1 min; annealing: 55°C for 30 sec; extension: 72°C for 1 Definition of DPAl alleles min) for DPAl amplification, and (denaturation: To define the DPAl alleles four SSO probes were 96°C for 1 min; annealing: 30°C for 30 sec; extension: 72°C for 1 min) for DPBl amplification. 2 used which hybridized to the two polymorphic reand 1.5 mM of MgClz were used in the reaction gions in the second exons of the DPAl genes. buffers for DPA 1 and DPB 1, respectively. DPAl*O101 has identical nucleotide sequences at the second exon to those of the DPA1*0102 and DPA1*0103 alleles. Since these 3 alleles cannot Dot-blot hybridization be distinguished by oligotyping with the 4 SSOs provided for the DPAl allele, DPAI-*O1, was as2-5 p1 of amplified DNA were applied to Hybond N nylon membranes (Amersham) by manual presigned for DPA1*0101, 0102 and 0103 (Table 2). paration. DNA was denatured by immersion in 0.4 The frequencies of 19 DPBl and 2 DPAl alleles M NaOH for 5 min followed by neutralization in defined in this study are shown in Table 3. None of the individuals tested had DPB1*0202, 1001, 1.5 NaCl, 0.1 M sodium phosphate, 10 mM EDTA, 1801 or 1901. DPB1*0201 was the most frequent pH 7.4 for 10 min. Membranes were prehybridized
Magzoub et al. Table 1. Determination of DPB alleles by S O probe hybridization DPB1 allele
sso
Sequence
DPB0901 DPB0902 DPB09D3 DPBD904
GAAllACClllXCAGGGA GTGTACCAGlTACGGCAG GTGTACCAGGGACGGCAG GTGCACCAGllACGGCAG
DPB3501 DPB3502 DPB3503 DPB3504 DPB3505
GGGAGGAGTEGCGCGCT GGGAGGAG'ITCGTGCGCT GGGAGGAGCTCGTGCGCT ACAACCGGCAGGAGTACG GGGAGGAGTACGCGCGCT
DPB5501 DPB5502 DPB5503 DPB5504
GGCCTGCTGCGGAGTACT GGCCTGATGAGGAGTACT GGCCTGAGGCGGAGTACT GGCCTGATGAGGACTACT
DPB6502 DPB6901 DPB6902 DPB6903 DPB6905 DPB6906
GCCAGAAGGACCTCCTGG GACATCCTGGAGGAGAAGC GCTCCTCCTCCAGGATGTC GACCTCCTGGAGGAGAAGCG ACCTCCTGGAGGAGAGGC GAGGAGAAGCGGGCAGTG
DPB7601 DPB7602 DPB7603
GGAC AGGATGTGCAGACA GGAC AGGGTATGCAGACA GGAC AGGATATGCAGACA
DPB8501 DPB8502 DPB8503
AGCTGGGCGGGCCCATGA AGCTGGTCGGGCCCATGA AGCTGGACGAGGCCGTGA
0 1 0 1
Amino acid
Table 2. Determination of DPA alleles by S O probe hybridization DPAl allele
Sequence
DPA3101 DPA3102
AAGATGAGATGTKTATG AAGATGAGCAG'ITCTATG
DPA5001 DPA5002
AGTTTGGCCAAGCCTll AGTTTGGCCGAGCCTTT
66
0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 2 3 4 4 5 6 8 9 0 1 3 4 5 6 7 8 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1
8 13 LFQGRQ WQLRQ WQGRQ VHQLRQ 32 37 REEFAR REEFVR REELVR RQEYAR REEYAR 53 59 RPAAEYW RPDEEYW RPEAEYW RPDEDYW 61 72 SQKDLLE DILEEK DILEEE DLLEEK DLLEER EEKRAV 73 79 PDRMCRH PDRVCRH PRRICRH 82 88 ELGGPMT ELVGPMT ELDEAVT
oligotype in both the disease (54.3%) and the control (52.6%) groups. There were no significant differences in the frequencies of the DPBl alleles between these two groups. DPAI*OI was the most and control indifrequent in both patients (86.4Y0) viduals (85.8%). There were no significant differ-
sso
0 2 0 1
Amino acid 2a 34 EDEMFYV EDEQFYV 47 53 EFGQAFS EFGRAFS
0 1 0 1
0 0 0 1 1 2 0 0 0 2 3 1
+ + + -
-
- - +
+ + +
- -
-
- +
ences in the frequencies of the DPAl alleles between the two groups. Associations between the DPAl and DPBl oligotypes were calculated by 2 x 2 tables for each combination. The significant uncorrected DPA 1-DPB1 positive associations in the two groups are: DPBI*1701 with DPA1*0201 in the patient group and DPB1*0101, 1301, 1701 with DPA*0201 in the control group @=3.0x 10-4, p=5.0 x 10-4, p=2.0 x 10-3, p = LO x respectively). Conversely, DPB 1* 1401 with DPAI*OI and DPB1*0301,0401 with DPA1*0201 in the patient group DPB1*0101 with DPAl*OI and DPB1*0201,0401 with DPA1*0201 in the control group (p=2.5 x lod3, p = 1.0 x lo-', p=3.7 x p=2.0 x p=5 x p = 1.0 x lod2respectively) showed uncorrected significant negative associations. 29 individuals (17 control subjects and 12 IDDM patients) were typed as DPB 1* 1701. Twenty-two samples were positive with all the six probes which identify this allele. Seven samples (1 control and 6
HLA-DP polymorphism in the Sudanese sixth (DPB5504). The same 7 individuals were identified by the DPB5503 SSO probe (Table 4). We propose that these 7 individuals possess a new DPBl allele (designated DPBl*1701Su) as a split of DPB1*1701. The detected difference between the 2 alleles resides in a single nucleotide substitution at codon 55 (GAT-DPBl*1701 vs GAGDPB 1* 1701Su) corresponding to a change from glutamic acid to alanine (Table 1). Sequencing the entire gene may reveal additional differences outside the region screened by the SSO probes. Previous investigations have shown that different ethnic groups may have marked differences in DPBl allelic frequencies. In the Sudanese (an admixture of Arabs and Black Africans) DPB1*0201 and *0401 are by far the most frequent alleles (Table 3), whereas DPB1*0401 and *0402 are the most frequent alleles among Caucasoids (33, 34). The DPB1*0501 allele, the most frequent in Japanese (33, was found only in 1 of the 167 Sudanese tested. The most frequent DPAl allele in the Sudanese is DPAI*Ol, as found in Caucasoids. In our analysis, most of the DPBl alleles occurred with either of the DPAl alleles, but only a few significant associations, either positive or negative, were observed. These associations could reveal a different kind of polymorphism by creating epitopes that cannot be correlated with specific sequences in either DPA or DPB but are conformational. IDDM is associated with particular DR and DQ alleles in all populations studied so far but its association with DP alleles has been unclear. Recently, the involvement of HLA-DPw3/6 in Caucasian Australian IDDM patients has been reported (36). However, DPw3/6 did not correlate with susceptibility to IDDM in South Indians (37) and Japanese (35). In our study, no significant association was detected between HLA-DP alleles and IDDM in the Sudanese.
Table 3. Phenotype frequency (P.F.) and gene frequencies (G.F.) of DPBl polymorphisms in Sudanese IDOM patients and mntrols
IDOM (11-70) DP allele
PF%
OPB1 '0101 '0201 '0202 '0301 11401 '0402 0501 '0601 40801 '0901 '1 001 '1 101 7301 '1 401 1 ' 501 '1 601 '1 701 '1 801 '1 901
5.7 54.3 0 17.1 47.1 10.0 0 4.3 1.4 0 0 4.3 4.3 2.9 29 4.3 24.3 0 0
OPAl '01 OPAl '0201
86.4' 43.9 ~~~
'
Controls (n-97)
GF'
'
0.03 0.33 0 0.09 0.27 0.06 0 0.02 0.01 0 0 0.02 0.02 0.02 0.02 0.02 0.1 3 0 0
10.3 52.6 0 11.3 37.1 18.6 1.a 4.1
0.05 0.31 0 0.06 0.21 0.10 0.005 0.02 0 0.02 0 0.02 0.04 0 0.05 0.02 0.07 0
'0 3.1 0 3.1 6.2 0 9.3 3.1 12.4 0 0
0.63 0.26 ~
GF'
PF%
0
85.8' 37.4+
0.62 0.21
~
n-66; + n=91 calculated from the formula 1 - v ( l -PF).
IDDM samples) reacted positively with five (DPB0904,3502,6902,7601 and 8503) probes and negatively with the sixth (DPB5504). The same seven samples reacted positively with the SSO probe DPB5503 which detects DPBl*O202, 0501 and 1901 (Table 4). Discussion
DNA typing by SSO provides the best direct definition of DPBl polymorphisms. We have used a full panel of 25 SSO probes to precisely define the 19 official DPB 1 alleles. The hybridization patterns in Sudanese correspond to those described by the workshop. DPB1*1701 was of particular interest as it gave rise to a new specificity. The split in this allele was detected in 7 individuals who reacted positively with five of the six SSO probes that identify DPB*1701, but failed to react with the
Acknowledgment
This research was supported by the University of Gezira and the British Council (M.M.A.M.) and by the Arthritis and Rheumatism Council (S.C.).
Table 4. Reaction patterns of SSO probes splitting DPB1'1701 DPBl SSO probes
No. of Individuals 22 7
0904
3502
5504
6902
7601
8503
5503
+ +
+
+
+
+
+ +
-
+
-
+
+
+
Designation of allele OPB1'1701 OPB1'1701SU
67
Magzoub et al. References 1. Bottazzo GF. Betacell damage in diabetic insulitis: are we approaching a solution? Diabetologia 1984: 26: 241-9. 2. Eisenbarth GS. Type I diabetes mellitus, a chronic autoimmune disease. N Engl J Med 1986: 314 1360-8. 3. Thomson G.HLA disease associations: models for insulin dependent diabetes mellitus and the study of complex human genetic disorders. Ann Rev Genet 1988: 22: 31-50. 4. Todd JA. Genetic control of autoimmunity in Type I diabetes. Irnmunol Today 1990: 11: 122-9. 5. Svejgaard A, Platz P, Rider LF? Insulin dependent diabetes mellitus. In: Terasaki PI, ed. Histocompatibility Testing. Los Angeles: UCLA Tissue Typing Laboratory, 1980. 6. Todd JA, Bell JI, McDevitt HO. HLA-DQB gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature 1987: 329: 599-604. 7. Serjeantson SW,Easteal S.Class I1 histocompatibility genes and insulindependent diabetes mellitus. Mol Biol Med 1990 6 219-26. 8. Deschamps I, Marcelli-Barge A, Lallemand N, et al. Study of cis and trans interactions between extended HLA-haplotypes in insulin-dependent diabetes. Tissue Antigens 1988: 31: 259-69. 9. Rotter JI, Landow EM. Measuring genetic contribution of a single locus to a multilocus disease. Clin Genet 1984: 26: 52942. 10. Bell GL, Horita S, Karam HJ. A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus. Diaberes 1984 33: 176-83. 11. Julier C, Hyer RN, Davies H, et al. Insulin-IGF2 region on chromosome I l p encodes a gene implicated in HLADRCdependent diabetes susceptibility. Nature 1991: 354: 155-9. 12. Field LL,Anderson CE, Neiswanger K, Hodge SE, Spence MA, Rotter JI. Interaction of HLA and immunoglobulin antigens in Type I (insulin-dependent) diabetes. Diabetologia 1984 27: 504-8. 13. Korman AJ, Boss JM, Spies T, Sorrentino R, Okada K, Strominger JL. Genetic complexity and expression of human histocompatibility antigens. Immunol Rev 1985: 85: 45-86.
14. Eckels DD, Lake P, Lamb JR, et al. SB-restricted presentation of influenza and herpes simplex virus antigens to human T-lymphocyte clones. Nature 1983: 301: 716-8. 15. De John BM, Termijtelen A, Bruining GJ, de Vries RRP, van Rood JJ. Relation of insulin-dependent diabetes mellitus (IDDM) and the HLA linked SB system. Tissue Antigens 1984: 23: 87-93. 16. Odum N, Hartzman R, Jakobsen BK, et al. The HLADP polymorphism in Denmark investigated by local and international PLT reagents. Tissue Antigens 1986: 2 8 105-
18. 17. Peterson CM, Moller BK, Lamm LU. HLA-DPw antigens in Danes and Eskimos as determined by local PLT-reagents. Tissue Antigens 1987:30: 217-28. 18. Odum N, Hyldig-Nielson JJ, Morling N, Sandberg-Wolheim M, Platz P, Svejgaard A. HLA-DP antigens are involved in the susceptibility to multiple sclerosis. Tissue Antigens 1988: 31: 235-7. 19. Odum N, Platz P, Morling N, et al. Increased frequency of HLA-DPw3 in severe aplastic anemia (AA). Tissue Antigens 1987: 2 9 184-5. 20. Hoffman RW, Shaw S, Francis LC, et al. HLA-DP antigens in patients with pauciarticular juvenile rheumatoid arthritis. Arthritis Rheum 1986: 29: 1057-62. 21. Begovich A, Bugawan TL, Nepom B, Klitz W, Nepom GT,
68
Erlich HA. A specific HLA-DP allele is associated with pauciarticular juvenile rheumatoid arthritis but not adult rheumatoid arthritis. Proc Nut1 Acad Sci USA 1989: 86:
9489-93. 22. Van Kerckhove L, Luyrink L, Elma MS, et al. HLA DPI DR interaction in children with juvenile rheumatoid arthritis. Irnmunogenerics 1990: 32: 363-8. 23. Hyldig-Nielson JJ, Morling N, Odum N, et al. Restriction fragment length polymorphism of the HLA-DP phenotypes. Proc Natl Acad Sci 1987: 84: 1644-8. 24. Bodmer J, Bodmer W, Heyes J, et al. Identification of HLADP polymorphism with DP alpha and DP beta probes and monoclonal antibodies: correlation with primed lymphocyte typing. Proc Nut1 Acad Sci 1987: 84: 4596-600. 25. Mitsuishi Y,Urlacher A, Tongio M-T, Mayer S. Restriction fragment length polymorphism of DP genes defines three new DP alleles. Immunogenetics 1987: 2 6 383-8. 26. Maeda M, Inoko H, Ando N, Uryu N, Nagata Y, Tsuji K. HLA-DP typing by analysis of DNA restriction fragment length polymorphisms in the HLA-DP beta subregion. Hum Immunol 1988: 21: 239-48. 27. Bugawan TL, Horn GT, Long CM, et al. Analysis of HLADP allelic sequence polymorphisms using the in vitro enzymatic DNA amplification of DP u and DP j3 loci. J Immunology 1988: 141:4024-30. 28. Angelini G,Bugawan TL, Delfino L, Erlich HA, Ferrara GB. HLA-DP typing by DNA amplification and hybridization with specific oligonucleotides. Hum Immunol 1989:26:
169-77. 29. Howell WM, Sage DA, Haegert DG, Evans PR, Smith JL. PCR-SSO typing for HLA-DBP alleles. Eur J Immunogentics 1991: 18: 81-95. 30. Magzoub MMA, Stephens HAF, Gale EAM, Bottazzo GF. Analysis of HLA-DR and -DQ gene polymorphisms in Sudanese patients with Type I (insulin-dependent)diabetes. Immunogenetics 1991: 34: 366-7 1. 31. Miller S, Dykes D, Polesky H. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic AcidF Research 1988: 16: 1215. 32. Bodmer JG, Marsh SGE, Albert E. Nomenclature for factors of the HLA system. Immunology T0du.v 1990: 11: 3-9. 33. Begovich AB, Helmuth RC, Oksenburg JR. HLA-DP beta and susceptibility to multiple sclerosis: an analysis of Caucasoid and Japanese patient populations. Hum Immund 1990:28: 365-72. 34. Al-Daccak R, Wang FQ, Theophille D, Lethielleux P, Colombani J, Loiseau P. Gene polymorphisms of HLA-DPBI and DPAl loci in Caucasoid population: Frequencies and DPBI-DPA1 associations. Hum Imrnunoll991:31: 277-85. 35. Yamagata K, Hanafisa T, Nakajima H, et al. HLA-DP and susceptibility to insulin-dependent diabetes mellitus in Japanese. Tissue Antigens 1991: 38: 107-10. 36. Easteal S, Kohonen-Corish MRJ, Zimmet P, Sejeantson SW. HLA-DP variation as additional risk factor in IDDM. Diabetes 1990: 39: 855-7. 37. Easteal S,Viswanathan M, Sejeantson SW. HLA-DP, -DQ and -DR RFLP types in South Indian insulin-dependent diabetes mellitus patients. Tissue Antigens 1990: 35: 71-4. Address: Professor G. B Bottazzo Department of Immunology The London Hospital Medical College Turner Street London El 2AD, U.K. Fax: 071-790-3033
