Original Article
How prostate‑specific membrane antigen level may be correlated with stemness in prostate cancer stem cell‑like cell populations? ABSTRACT Background: Prostate‑specific membrane antigen (PSMA) is a widely used targeted molecule in prostate patients. The present research, attempts to support the hypothesis that PSMA expression in prostate cancer stem cell‑like (CSC) cell populations may be correlated with nanog and other transcription factors in different stages of prostate carcinomas. Materials and Methods: To provide more accurate evidence of the above, a population of prostate CSCs was isolated and analyzed using different protocols. The first method was based in the ability of CSCs to form spherical colonies in semi‑suspension of a culture. A qPCRbased protocol and a flow cytometric analysis protocol were chosen to test the presence of stemness markers and PSMA in the selected populations. Results: The formation of micro‑sphere in semi‑suspension has been pointed out. In the other panels of the test, the linear correlation between PSMA and nanog in gene and protein level was shown. However, the statistical analysis including the coefficient of variationand standard deviation’s values) has proved that there were differences in PSMA expression between cancer cells and CSCs. Conclusion: The previous analysis has pointed out that PSMA expression may be correlated with nanog’s expression as well as with other confounders in a population of prostate CSCs. KEY WORDS: Cancer stem cell‑like cells, prostate cancer, prostate‑specific membrane antigen, stemness
INTRODUCTION As prostate cancer is the second most frequently diagnosed cancer and the sixth leading cause of cancer death in males, the need for diagnosis, prognosis even treatment becomes crucial. Until now, many trials have been made to find a cure for this clinically important tumor but they were followed by some disadvantages because the age, the race (black), and the family history remain a well‑established risk factor and it is difficult to prevent it.[1,2] However, in the last decades the hypothesis concerning the cancer stem cells (CSCs) became a cornerstone in the treatment of the disease.[3] Their role in the development of prostate cancer has been a research focus area for many years. Many, if not all, tumors include a population of cells which have the ability to self‑renew as well as to expand with high rates. This small population, known as CSC cells, may be a part of a population of circulating tumor
cells (CTCs) that can be isolated from patient’s blood sample.[4] Previous studies have shown that CSCs are characterized by hallmarks such as surface and intracellular enzyme markers. Nanog gene is one of the most well‑characterized stemness markers and in relation with o ct3/4 (octamer‑binding transcription factor 3/4) and sox 2 (also known as Sex determining region Y (SRY)‑box 2) genes are a widely used triplet in describing a population of CSCs. During the epithelial‑to‑mesenchymal transition (EMT), cancer cells lose their epithelial differentiation and develop a mesenchymal phenotype. This is the reason that these cells acquire a sphere formation when cultivated in semi‑suspension.[5‑7] Concerning the patients who suffer from prostate carcinoma, prostate‑specific membrane antigen (PSMA), which is a membrane‑bound glycoprotein has been widely used by many researchers and oncologists to combine the PSMA’s expression level with a therapeutic model in the above group of patients.[8]
Journal of Cancer Research and Therapeutics - January-March 2014 - Volume 10 - Issue 1
Toloudi Maria, Apostolou Panagiotis, Chatziioannou Marina, Kourtidou Eleni, Vlachou Ioanna, Mimikakou Georgia, Papasotiriou Ioannis Research Genetic Cancer Centre Ltd, Megalou Alexandrou 115 Street, 53070, Filotas For correspondence: Dr. Papasotiriou Ioannis, Megalou Alexandrou 115 Street, 53070, Filotas, Greece. E‑mail: papasotiriou. ioannis@rgcc‑genlab. com
Access this article online Website: www.cancerjournal.net DOI: 10.4103/0973-1482.131461 PMID: *** Quick Response Code:
133
Toloudi, et al.: PSMA and prostate CSCs
This study attempts to prove the hypothesis that PSMA expression may be correlated with nanog gene as well as with other confounders in a population of prostate CSCs.
factor (10 μg/ml, F029, SIGMA Aldrich), STEMPRO hESC SFM Growth Supplement (50X), 25% BSA (Bovine Serum Albumin), and 55 mM of 2‑mercaptoethanol (M3148, SIGMA Aldrich).
MATERIALS AND METHODS To test the association between PSMA level and prostate carcinoma, a series of different prostate cancers were analyzed successfully and different protocols were performed on prostate cancer cells as well as on prostate CSCs. Peripheral blood was collected from 17 male patients who suffer from proven prostate carcinoma in different stages. To prevent coagulation, the sample was collected in tubes (Vacutainer K3E, 368860, BD (Becton, Dickinson and Company)) containing EDTA and it was rotated for about 30 min before use. All the samples were collected and analyzed with the consent of the patients. Cancer cells were obtained from three human prostate cancer cell lines provided by the European Collection of Cell Cultures (ECACC). LNCap nuclear extracted (clone FGC) (89110211, Human Caucasian prostate carcinoma), 22Rv1 (05092802, Human Xenograft Prostate), and PC‑3 (90112714, Human Caucasian prostate adenocarcinoma) were cultivated and used as controls. To isolate CTCs from whole blood sample, Biocoll (L6115, Biochrom AG), a separating solution with density 1.077 g/ml, isotonic , was used. This solution (D = 1.077 at + 20°C) contains Ficoll400 (Polysucrose 400), a polymer with a molecular weight of approximately 400,000 Dalton. Biocoll separating solution was added in 15 ml centrifuge tubes (188271, Greiner Bio- One GmbH Maybachstr. 272636 Frickenhausen Germany Gmbh) and equal parts of whole blood were carefully applied on top of it. After a centrifugation step at 2500 rpm for 20 min, the layer of enriched (70‑100%) lymphocytes between the plasma and Biocoll was isolated using a pasteur pipette. The collected cells were finally washed twice with phosphate buffer saline (PBS) (P3621, SIGMA‑Aldrich, Life Science Chemilab S.A. Athens, Greece) and then divided and cultured in 25 cm2 flask (5520100, Orange Scientific n.v./s.a., TECHNOLAB | Andreoiu Dimitriou 38, Athens, Greece) with Dulbecco’s Modified Eagle Medium (DMEM) (D5546, SIGMA ‑Aldrich ) as well as with STEMPRO hESC s erum‑ and feeder‑free medium (SFM) kit (A10007‑01, Life Technologies). Because cancer cells have infinite potential for division, those that remained in the flask after 1 week of culture were the cells of preference and normally a subset of them may had stemness phenotype.[9‑11] STEMPRO hESC SFM (serum‑ and feeder‑free medium) kit provided the growth of human mammary epithelial cells and the highest quality of the microsphere culture. Itcomposed of DMEM/F‑12 + GlutaMAX (1X) cultivation medium and the additional ingredients of FGF‑basic 134
So, the three commercial cell lines as well as the patient’s cell lines, were cultivated both in the recommended culture medium with the appropriate amount of heat inactivated fetal bovine serum (FBS Superior; standardized BS, EU‑approved, S0615, Biochrom AG) and 2 mM Glutamine (G5792, SIGMA Aldrich,) and in the STEMPRO product (complete medium) using 25 cm2 flasks (5520100, Orange Scientific n.v./s.a.) at 37°C and 5% CO2 atmosphere. Due to the fact that the environmental culture conditions play a critical role in the expansion, growth, and differentiation of cells, by cultivating the same starting cell population in different media, it would be possible to find differences between them concerning their genotype as well as their phenotype. All the experiments were performed during exponential phase and after 80‑90% confluence of the culture. The first scientific approach was an evaluation method which was based on the fact that CSCs, under special conditions, via epithelial‑to‑mesenchymal transition (EMT), lost their ability to detach and so they formed spheres and gained a mesenchymal phenotype. Prostate spheres are spheroid structures which can be passaged serially to generate daughter spheres with similar composition demonstrating that sphere‑forming cells are capable of self‑renewal.[12,13] By using a light microscope, the spheres could be observed in semi‑suspension in a culture. The second method used was the real‑time Polymerase Chain Reaction (PCR) method which was the most sensitive, simple and quick method for studying the gene expression. It requires small amounts of template and thus it is a widely used research tool. It has been proved that the population of CSCs is generally characterized by several molecular markers such as nanog, oct3/4, and sox2. Additionally, it was shown that prostate cancer cells expressed PSMA in different tumor stages. Concerning this approach, RNA was extracted using Trizol reagent (15596‑026, Life Technologies) and used as template to synthesize cDNA with the use of the First Strand cDNA Synthesis (K1612, Fermentas, Thermo Fisher Scientific Inc). To test gene’s expression, a quantitative real‑time PCR protocol was run (K0221, Maxima Sybr Green, Fermentas, Thermo Fisher Scientific Inc) using as endogenous control the 18S rRNA gene [Table 1]. The primers used were designed using Genamics expression program (Genamics Expression DNA Sequence Analysis Software, version 1.100© 2000) [Table 1]. All the designed sequences were run on BLAST to exclude those who amplified undesired genes. The real‑time PCR protocol included a
Journal of Cancer Research and Therapeutics - January-March 2014 - Volume 10 - Issue 1
Toloudi, et al.: PSMA and prostate CSCs
Table 1: Sequences of gene‑specific primers Gene sequence 18S rRNA nanog oct3/4 sox2 PSMA
Forward primer 5’TGCCCTATCAACTTTCGATGGTAGTC 3’ 5’TGAGATGCCTCACACGGAGACTG 3’ 5’ GGTGCCTGCCCTTCTAGGAATG 3’ 5’ CAACGGCAGCTACAGCATGATG 3’ 5’ CAGGGGCCAAAGGAGTCATTCTC 3’
Figure 1: 22Rv1 human xenograft prostate cancer cells were cultivated in RPMI without phenol red medium (R7509, SIGMA Aldrich). The cells, as it was expected, formed a matrix and they were detached to the flask
Figure 3: LNCap nuclear extracted (clone FGC) human caucasian prostate cancer cells were cultivated in RPMI 1640 medium (R0883, SIGMA Aldrich). The cells normally formed a matrix and they were detached to the flask
denaturation program (94°C for 10 min), an amplification, and quantification program repeated 50 times (94°C for 15 s, 59°C for 15 s, and 72°C for 30 s) with a single fluorescent measurement, a melting curve program (55 ‑95°C with a heating rate of 0.5°C/s and a continuous fluorescent measurement), and finally a cooling step at 4°C. Each sample was amplified in triplicates. At the end of the reaction the detection of the cycle‑threshold (which is the level of detection of the point at which a reaction reaches a fluorescent intensity above background) was made. Finally,
Reverse primer 5’ TTGGATGTGGTAGCCGTTTCTCA 3’ 5’ GGGTTGTTTGCCTTTGGGACTG 3’ 5’ TGCCCCCACCCTTTGTGTTC 3’ 5’ GCGAGCTGGTCATGGAGTTGTACT 3’ 5’ GGGTAACCTGGTGTGAGAGGGTCTC 3’
Figure 2: 22Rv1 human xenograft prostate cancer cells were cultivated in STEMPRO hESC SFM (serum- and feeder-free medium) kit (A10007-01, Life Technologies). Obviously, the cells started to form spheres to semi-suspension
Figure 4: LNCap nuclear extracted (clone FGC) human caucasian prostate cancer cells were cultivated in STEMPRO hESC SFM (serum- and feeder-free medium) kit (A10007-01, Life Technologies). This figure also represents cells of the same starting population which were cultivated with different culture mediums and they did not form a matrix. On the contrary, this population started forming spheres to semi-suspension
the genes’ relative expression was calculated using the 2− ΔΔCT (Livak) method.[14] To determine the expression of the above‑mentioned genes in a protein level, flow cytometric analysis was performed (BD Accuri™ C6 Flow Cytometer, BD Biosciences) .[7,8,15,16,17] The
Journal of Cancer Research and Therapeutics - January-March 2014 - Volume 10 - Issue 1
135
Toloudi, et al.: PSMA and prostate CSCs
Figure 5: Prostate cancer stem cell-like cells were isolated from a prostate patient’s blood sample (stage IV) and were cultivated in STEMPRO hESC SFM (serum- and feeder-free medium) kit (A1000701, Life Technologies).. The sphere formation is represented here
Figure 6: Prostate cancer stem cell-like cells were isolated from different prostate patient’s blood sample (Gleason rate 7) and were cultivated in STEMPRO hESC SFM (serum- and feeder-free medium) kit (A1000701, Life Technologies). The sphere formation is represented here
5HDO WLPH3&5DQDO\VLVGDWD LQ'0(0 FXOWLYDWHGFHOOV
5HDO WLPH3&5DQDO\VLVGDWD LQ67(0352 FXOWLYDWHGFHOOV \ [ 5ð &9
\ [ 5ð &9
360$ ǻ&W
360$ ǻ&W
Figure 7: Linear correlation between prostate-specific membrane antigen and nanog gene. Although the correlation between the two selected genes was high in both diagrams (R2 = 0.875 and R2 = 0.8745, respectively), the coefficient of variation in the second diagram (concerning STEMPRO-cultivated cells) was higher than in the first which means that the gene expression of prostate-specific membrane antigen in the prostate cancer stem cell-like cells population may be induced by other confounders (coefficient of variation, 0.382
How prostate‑specific membrane antigen level may be correlated with stemness in prostate cancer stem cell‑like cell populations? ABSTRACT Background: Prostate‑specific membrane antigen (PSMA) is a widely used targeted molecule in prostate patients. The present research, attempts to support the hypothesis that PSMA expression in prostate cancer stem cell‑like (CSC) cell populations may be correlated with nanog and other transcription factors in different stages of prostate carcinomas. Materials and Methods: To provide more accurate evidence of the above, a population of prostate CSCs was isolated and analyzed using different protocols. The first method was based in the ability of CSCs to form spherical colonies in semi‑suspension of a culture. A qPCRbased protocol and a flow cytometric analysis protocol were chosen to test the presence of stemness markers and PSMA in the selected populations. Results: The formation of micro‑sphere in semi‑suspension has been pointed out. In the other panels of the test, the linear correlation between PSMA and nanog in gene and protein level was shown. However, the statistical analysis including the coefficient of variationand standard deviation’s values) has proved that there were differences in PSMA expression between cancer cells and CSCs. Conclusion: The previous analysis has pointed out that PSMA expression may be correlated with nanog’s expression as well as with other confounders in a population of prostate CSCs. KEY WORDS: Cancer stem cell‑like cells, prostate cancer, prostate‑specific membrane antigen, stemness
INTRODUCTION As prostate cancer is the second most frequently diagnosed cancer and the sixth leading cause of cancer death in males, the need for diagnosis, prognosis even treatment becomes crucial. Until now, many trials have been made to find a cure for this clinically important tumor but they were followed by some disadvantages because the age, the race (black), and the family history remain a well‑established risk factor and it is difficult to prevent it.[1,2] However, in the last decades the hypothesis concerning the cancer stem cells (CSCs) became a cornerstone in the treatment of the disease.[3] Their role in the development of prostate cancer has been a research focus area for many years. Many, if not all, tumors include a population of cells which have the ability to self‑renew as well as to expand with high rates. This small population, known as CSC cells, may be a part of a population of circulating tumor
cells (CTCs) that can be isolated from patient’s blood sample.[4] Previous studies have shown that CSCs are characterized by hallmarks such as surface and intracellular enzyme markers. Nanog gene is one of the most well‑characterized stemness markers and in relation with o ct3/4 (octamer‑binding transcription factor 3/4) and sox 2 (also known as Sex determining region Y (SRY)‑box 2) genes are a widely used triplet in describing a population of CSCs. During the epithelial‑to‑mesenchymal transition (EMT), cancer cells lose their epithelial differentiation and develop a mesenchymal phenotype. This is the reason that these cells acquire a sphere formation when cultivated in semi‑suspension.[5‑7] Concerning the patients who suffer from prostate carcinoma, prostate‑specific membrane antigen (PSMA), which is a membrane‑bound glycoprotein has been widely used by many researchers and oncologists to combine the PSMA’s expression level with a therapeutic model in the above group of patients.[8]
Journal of Cancer Research and Therapeutics - January-March 2014 - Volume 10 - Issue 1
Toloudi Maria, Apostolou Panagiotis, Chatziioannou Marina, Kourtidou Eleni, Vlachou Ioanna, Mimikakou Georgia, Papasotiriou Ioannis Research Genetic Cancer Centre Ltd, Megalou Alexandrou 115 Street, 53070, Filotas For correspondence: Dr. Papasotiriou Ioannis, Megalou Alexandrou 115 Street, 53070, Filotas, Greece. E‑mail: papasotiriou. ioannis@rgcc‑genlab. com
Access this article online Website: www.cancerjournal.net DOI: 10.4103/0973-1482.131461 PMID: *** Quick Response Code:
133
Toloudi, et al.: PSMA and prostate CSCs
This study attempts to prove the hypothesis that PSMA expression may be correlated with nanog gene as well as with other confounders in a population of prostate CSCs.
factor (10 μg/ml, F029, SIGMA Aldrich), STEMPRO hESC SFM Growth Supplement (50X), 25% BSA (Bovine Serum Albumin), and 55 mM of 2‑mercaptoethanol (M3148, SIGMA Aldrich).
MATERIALS AND METHODS To test the association between PSMA level and prostate carcinoma, a series of different prostate cancers were analyzed successfully and different protocols were performed on prostate cancer cells as well as on prostate CSCs. Peripheral blood was collected from 17 male patients who suffer from proven prostate carcinoma in different stages. To prevent coagulation, the sample was collected in tubes (Vacutainer K3E, 368860, BD (Becton, Dickinson and Company)) containing EDTA and it was rotated for about 30 min before use. All the samples were collected and analyzed with the consent of the patients. Cancer cells were obtained from three human prostate cancer cell lines provided by the European Collection of Cell Cultures (ECACC). LNCap nuclear extracted (clone FGC) (89110211, Human Caucasian prostate carcinoma), 22Rv1 (05092802, Human Xenograft Prostate), and PC‑3 (90112714, Human Caucasian prostate adenocarcinoma) were cultivated and used as controls. To isolate CTCs from whole blood sample, Biocoll (L6115, Biochrom AG), a separating solution with density 1.077 g/ml, isotonic , was used. This solution (D = 1.077 at + 20°C) contains Ficoll400 (Polysucrose 400), a polymer with a molecular weight of approximately 400,000 Dalton. Biocoll separating solution was added in 15 ml centrifuge tubes (188271, Greiner Bio- One GmbH Maybachstr. 272636 Frickenhausen Germany Gmbh) and equal parts of whole blood were carefully applied on top of it. After a centrifugation step at 2500 rpm for 20 min, the layer of enriched (70‑100%) lymphocytes between the plasma and Biocoll was isolated using a pasteur pipette. The collected cells were finally washed twice with phosphate buffer saline (PBS) (P3621, SIGMA‑Aldrich, Life Science Chemilab S.A. Athens, Greece) and then divided and cultured in 25 cm2 flask (5520100, Orange Scientific n.v./s.a., TECHNOLAB | Andreoiu Dimitriou 38, Athens, Greece) with Dulbecco’s Modified Eagle Medium (DMEM) (D5546, SIGMA ‑Aldrich ) as well as with STEMPRO hESC s erum‑ and feeder‑free medium (SFM) kit (A10007‑01, Life Technologies). Because cancer cells have infinite potential for division, those that remained in the flask after 1 week of culture were the cells of preference and normally a subset of them may had stemness phenotype.[9‑11] STEMPRO hESC SFM (serum‑ and feeder‑free medium) kit provided the growth of human mammary epithelial cells and the highest quality of the microsphere culture. Itcomposed of DMEM/F‑12 + GlutaMAX (1X) cultivation medium and the additional ingredients of FGF‑basic 134
So, the three commercial cell lines as well as the patient’s cell lines, were cultivated both in the recommended culture medium with the appropriate amount of heat inactivated fetal bovine serum (FBS Superior; standardized BS, EU‑approved, S0615, Biochrom AG) and 2 mM Glutamine (G5792, SIGMA Aldrich,) and in the STEMPRO product (complete medium) using 25 cm2 flasks (5520100, Orange Scientific n.v./s.a.) at 37°C and 5% CO2 atmosphere. Due to the fact that the environmental culture conditions play a critical role in the expansion, growth, and differentiation of cells, by cultivating the same starting cell population in different media, it would be possible to find differences between them concerning their genotype as well as their phenotype. All the experiments were performed during exponential phase and after 80‑90% confluence of the culture. The first scientific approach was an evaluation method which was based on the fact that CSCs, under special conditions, via epithelial‑to‑mesenchymal transition (EMT), lost their ability to detach and so they formed spheres and gained a mesenchymal phenotype. Prostate spheres are spheroid structures which can be passaged serially to generate daughter spheres with similar composition demonstrating that sphere‑forming cells are capable of self‑renewal.[12,13] By using a light microscope, the spheres could be observed in semi‑suspension in a culture. The second method used was the real‑time Polymerase Chain Reaction (PCR) method which was the most sensitive, simple and quick method for studying the gene expression. It requires small amounts of template and thus it is a widely used research tool. It has been proved that the population of CSCs is generally characterized by several molecular markers such as nanog, oct3/4, and sox2. Additionally, it was shown that prostate cancer cells expressed PSMA in different tumor stages. Concerning this approach, RNA was extracted using Trizol reagent (15596‑026, Life Technologies) and used as template to synthesize cDNA with the use of the First Strand cDNA Synthesis (K1612, Fermentas, Thermo Fisher Scientific Inc). To test gene’s expression, a quantitative real‑time PCR protocol was run (K0221, Maxima Sybr Green, Fermentas, Thermo Fisher Scientific Inc) using as endogenous control the 18S rRNA gene [Table 1]. The primers used were designed using Genamics expression program (Genamics Expression DNA Sequence Analysis Software, version 1.100© 2000) [Table 1]. All the designed sequences were run on BLAST to exclude those who amplified undesired genes. The real‑time PCR protocol included a
Journal of Cancer Research and Therapeutics - January-March 2014 - Volume 10 - Issue 1
Toloudi, et al.: PSMA and prostate CSCs
Table 1: Sequences of gene‑specific primers Gene sequence 18S rRNA nanog oct3/4 sox2 PSMA
Forward primer 5’TGCCCTATCAACTTTCGATGGTAGTC 3’ 5’TGAGATGCCTCACACGGAGACTG 3’ 5’ GGTGCCTGCCCTTCTAGGAATG 3’ 5’ CAACGGCAGCTACAGCATGATG 3’ 5’ CAGGGGCCAAAGGAGTCATTCTC 3’
Figure 1: 22Rv1 human xenograft prostate cancer cells were cultivated in RPMI without phenol red medium (R7509, SIGMA Aldrich). The cells, as it was expected, formed a matrix and they were detached to the flask
Figure 3: LNCap nuclear extracted (clone FGC) human caucasian prostate cancer cells were cultivated in RPMI 1640 medium (R0883, SIGMA Aldrich). The cells normally formed a matrix and they were detached to the flask
denaturation program (94°C for 10 min), an amplification, and quantification program repeated 50 times (94°C for 15 s, 59°C for 15 s, and 72°C for 30 s) with a single fluorescent measurement, a melting curve program (55 ‑95°C with a heating rate of 0.5°C/s and a continuous fluorescent measurement), and finally a cooling step at 4°C. Each sample was amplified in triplicates. At the end of the reaction the detection of the cycle‑threshold (which is the level of detection of the point at which a reaction reaches a fluorescent intensity above background) was made. Finally,
Reverse primer 5’ TTGGATGTGGTAGCCGTTTCTCA 3’ 5’ GGGTTGTTTGCCTTTGGGACTG 3’ 5’ TGCCCCCACCCTTTGTGTTC 3’ 5’ GCGAGCTGGTCATGGAGTTGTACT 3’ 5’ GGGTAACCTGGTGTGAGAGGGTCTC 3’
Figure 2: 22Rv1 human xenograft prostate cancer cells were cultivated in STEMPRO hESC SFM (serum- and feeder-free medium) kit (A10007-01, Life Technologies). Obviously, the cells started to form spheres to semi-suspension
Figure 4: LNCap nuclear extracted (clone FGC) human caucasian prostate cancer cells were cultivated in STEMPRO hESC SFM (serum- and feeder-free medium) kit (A10007-01, Life Technologies). This figure also represents cells of the same starting population which were cultivated with different culture mediums and they did not form a matrix. On the contrary, this population started forming spheres to semi-suspension
the genes’ relative expression was calculated using the 2− ΔΔCT (Livak) method.[14] To determine the expression of the above‑mentioned genes in a protein level, flow cytometric analysis was performed (BD Accuri™ C6 Flow Cytometer, BD Biosciences) .[7,8,15,16,17] The
Journal of Cancer Research and Therapeutics - January-March 2014 - Volume 10 - Issue 1
135
Toloudi, et al.: PSMA and prostate CSCs
Figure 5: Prostate cancer stem cell-like cells were isolated from a prostate patient’s blood sample (stage IV) and were cultivated in STEMPRO hESC SFM (serum- and feeder-free medium) kit (A1000701, Life Technologies).. The sphere formation is represented here
Figure 6: Prostate cancer stem cell-like cells were isolated from different prostate patient’s blood sample (Gleason rate 7) and were cultivated in STEMPRO hESC SFM (serum- and feeder-free medium) kit (A1000701, Life Technologies). The sphere formation is represented here
5HDO WLPH3&5DQDO\VLVGDWD LQ'0(0 FXOWLYDWHGFHOOV
5HDO WLPH3&5DQDO\VLVGDWD LQ67(0352 FXOWLYDWHGFHOOV \ [ 5ð &9
\ [ 5ð &9
360$ ǻ&W
360$ ǻ&W
Figure 7: Linear correlation between prostate-specific membrane antigen and nanog gene. Although the correlation between the two selected genes was high in both diagrams (R2 = 0.875 and R2 = 0.8745, respectively), the coefficient of variation in the second diagram (concerning STEMPRO-cultivated cells) was higher than in the first which means that the gene expression of prostate-specific membrane antigen in the prostate cancer stem cell-like cells population may be induced by other confounders (coefficient of variation, 0.382
