7,594-601

GENOMICS

(1990)

Human aB-Crystallin Gene and Preferential Promoter Function in Lens ROBERT

A. DUBIN,*,’

ABDUL

H. AuY,t

SAMBATH CHUNG,*

AND JORAM PIATIGORSKY*

*Laboratory of Molecular and Developmental Biology, National Eye Institute, National Institutes of Health, Bethesda, Maryland 20892, and tDNA Chemistry, Biotechnica International, Inc., Cambridge, Massachusetts 02140 Received

January

2, 1990;

INTRODUCTION

Copyright All

rights

$3.00 Q 1990 by Academic Press, of reproduction in any form

AND METHODS

Isolation of the Human LuB-Crystallin Gene The human aB-crystallin gene (clone h-73~) was isolated from a X EMBL-3 genomic library (Clontech Laboratories, Inc., Palo Alto, CA) by hybridization to a bovine aB-crystallin cDNA (generously provided by H. Bloemendal, University of Nijmegen, The Netherlands). An approximately 3.8-kbp DNA fragment isolated from h-73c was used to localize this gene to human chromosome 11 (Ngo et al., 1989). As X-73c did not contain the complete gene, the library was rescreened using an exon III probe derived from the murine aB-crystallin gene (Dubin et aZ., 1989), resulting in the cloning of the entire gene (clone X-cp8). Hybridization conditions were previously described (QuaxJeuken et al., 1985).

MD

594 Inc. reserved.

28, 1990

MATERIALS

The crystallins compose approximately 90% of the soluble protein of the vertebrate eye lens (Bloemendal, 1977; Harding and Crabbe, 1984; Wistow and Piatigorsky, 1988). These include three major families of ubiquitously expressed crystallins (a, /3, and y) as well as a number of taxon-specific crystallins found only in certain species (reviewed in Piatigorsky and Wistow, 1989). a-Crystallin is composed of high-molecularweight aggregatesof two single-copy gene products, CYAcrystallin and cuB-crystallin. The two proteins share approximately 55% identity at the amino acid level (van der Ouderaa et al., 1974; van den Heuvel et al., 1985) and are related to the small heat-shock proteins

OSW-7543/90

March

of Drosophila (Ingolia and Craig, 1982) and an egg protein of Schistosoma mansoni (Nene et al., 1986). While expression of aA-crystallin appears to be restricted to the lens (Overbeek et al., 1985; Dubin et al., 1989; Wawrousek et aZ., 1990), the aB-crystallin gene is expressed at high levels in the lens and at lower levels in a variety of non-lens tissues, most notably in heart, skeletal muscle, kidney, lung, and brain (Duguid et al., 1988, Bhat and Nagineni, 1989; Dubin et al., 1989; Iwaki et aE., 1989, 1990). Overexpression and accumulation of cuB-crystallin in astrocytes has been associated with Alexander’s disease (Iwaki et al, 1989). Here we present the complete nucleotide sequence of the human cYB-crystallin gene. In addition, we have continued our studies (Dubin et al., 1989) on the regulation of aB-crystallin gene expression by constructing a human aB-crystallin promoter-chloramphenicol acetyltransferase (CAT) chimeric gene and show that it is preferentially, but not exclusively, expressed in lens cells.

aB-Crystallin, first identified as a structural component of the vertebrate eye lens, is expressed at high levels in lens and at lower levels in a number of other tissues, most notably cardiac and skeletal muscle, kidney, and brain. We have cloned and sequenced the human aB-crystallin gene and show that it is structurally similar to its hamster homolog. We have also identified its transcription initiation site in human lens RNA. Functional analysis of a promoter fragment extending from -537 to +21 (relative to the transcription initiation site) and fused to the bacterial chloramphenicol acetyltransferase gene suggests that this fragment contains regulatory elements that function preferentially, but not exclusively, in lens. In contrast, this fragment is apparently insufficient to promote transcription in glial cells, as this construct functioned poorly in a glioblastoma-astrocytoma cell line (U373MG) that synthesizes high levels of the endogenous aB-crystallin gene product. o isso Academic PWS, IIIC.

1 To whom correspondence should be addressed at LMDB/NEI/ NIH, Building 6, Room 203, 9000 Rockville Pike, Bethesda, 20892.

revised

HUMAN

aB-CRYSTALLIN

Sequence Analysis A 3.8-kbp DNA fragment subcloned from X-73c and extending from -948 to +2854 (relative to the transcription initiation site; Fig. 1) was sheared by sonication, randomly cloned into M13mp8, and sequenced as described (Nickerson et al., 1986). Additional sequence was obtained from overlapping fragments isolated from X-cp8, subcloned into pBluescript SK (+) (Stratagene, La Jolla, CA), and sequenced in both directions as described (Dubin et al., 1989). Sequence comparisons to the hamster UB-crystallin gene (QuaxJeuken et al., 1985) were performed using the NUCALN program. The sequence of the human cuB-crystallin gene has been deposited with GenBank (Los Alamos, NM) under Accession Number M28638. RNA Analysis RNA was isolated by the acid phenol method of Chomczynski and Sacchi (1987). Normal human lenses of a 32-year-old male were obtained from an eye bank (provided by J. Horwitz, Jules Stein Eye Institute, Los Angeles, CA). Northern blot and primer extension analyses were performed as described (Dubin et al, 1989) except that the final wash temperature for the Northern blots was 59°C. Fragments used for Northern blot probes included (1) a 244-bp BamHI-Hind111 fragment isolated from the human cuB-crystallin gene (+2849 to +3092 on Fig. 1) containing much of exon III (subclone pSCl), (2) an approximately 630-bp fragment containing an aB-crystallin cDNA isolated from duck lens (provided by G. Wistow; Wistow and Piatigorsky, unpublished data), and (3) a human @-actin cDNA (Gunning et al., 1983). Oligonucleotides for primer extension analysis were synthesized and purified by high-performance liquid chromatography (Promega, Madison, WI). Oligonucleotide CS-220 (5’AGGAAAGAAGGGGCGGCGGATC 3’) is complementary to nucleotides +77 to +98 in Fig. 1 and was used to determine the initiation site of the human cYB-crystallin RNA; oligonucleotide CS-135 (5’ TCTTTACGATGCCATTGGGA 3’) is complementary to the CAT gene’s RNA and was used to determine the initiation site of CAT RNA expressed from the aB promoter-CAT chimerit gene construct pB5F35. Plasmid

Constructions

DNA manipulations were performed using standard techniques. A 618-bp BamHI fragment (-537 to +81 in Fig. 1) containing the human aB-crystallin promoter was subcloned into pBluescript SK (+); restricted within the polylinker on the 3’ side of this fragment; treated with Bal31 (Bal31-slow form; International Biotechnologies, Inc., New Haven, CT), T4 DNApolymerase (Bethesda Research Laboratories, Gaithers-

595

GENE

burg, MD), and dNTP; ligated in the presence of BamHI (8 mer) linkers (Pharmacia, Piscataway, NJ), and introduced in bacterial strain HBlOl. Characterization by sequence analysis led to the isolation of a 558-bp BamHI fragment extending from -537 to +2l (Fig. 1) which was used for further studies. This 558bp fragment was inserted in front of the CAT gene in vector pRD30A, a slightly modified version of pSVOCAT (Gorman et al., 1982). Plasmid pRD3OA was constructed by first eliminating the BamHI site at the 3’ end of the CAT gene (by restriction with BamHI, treatment with T4 DNA polymerase and dNTP, and religation), and followed by restriction with HindI (at the 5’ end of the CAT gene), end repair with T4 DNA polymerase and dNTP, and ligation in the presence of BamHI linkers. Thus, pRD3OA contains a single BamHI site at the 5’ end of the CAT gene. The 558bp BamHI fragment containing the human aB-crystallin promoter (-537 to +21) was introduced into the BamHI site of pRD30A either in the correct orientation (pB5F35) or in the opposite orientation (pB5) with respect to its position in the human cuB-crystallin gene. Constructs were confirmed by restriction analysis and sequencing of the junctions. Plasmids used for transfections were grown in HBlOl and purified as described (Dubin et al., 1989). Cell Cultures

and Transfections

Primary patched lens epithelial (PLE) cells were prepared from 14-day-old chick embryos as described by Borras et al. (1988) and modified by Dubin et al. (1989). For CAT analysis, PLE from six lenses were used per 60-mm dish; for RNA analysis, PLE from 24 lenses were used per loo-mm dish. PLE were transfected 48 h after plating. Chick fibroblasts were prepared from 14-day-old chick embryo thigh muscle by trypsin dissociation, grown on plastic for 24 h, trypsinized and replated, and transfected 24 h later; at completion of the experiment, this population contained approximately 10% myotubes. Chicken cells, HeLa cells, and the rabbit lens cell line N/N1003A (Reddan et aZ., 1986) were grown in Dulbecco’s modified Eagle’s medium (GIBCO Laboratories, Grand Island, NY) containing 10% fetal bovine serum (FBS) and 50 pg/ml gentamicin. Rabbit kidney cell line RK13 (Beale et al., 1963) was grown in the same medium as above plus MEM nonessential amino acids (GIBCO Laboratories) added to a final concentration of 1X; the human glioblastoma cell line U-138MG (Ponten and Macintyre, 1968), the glioblastoma-astrocytoma cell lines U-87MG (Ponten and Macintyre, 1968) and U373MG (Beckman et al., 1971), and the neuroblastoma lines SK-N-SH and SK-N-MC (Spengler et al., 1973) were grown in the same medium as RK13 cells plus the addition of both glutamine and sodium pyruvate

596

DUBIN

to a final concentration of 1 mM. The human astrocytoma line CCF-STTGl (Barna et al., 1983) was grown in RPM1 1640 (MediaTech, Washington, DC), 10% FBS, 1 mM glutamine, and 50 pg/ml gentamicin. Chicken and rabbit cells were grown in a 9.5% COZ environment and human cells were grown in 5% COZ. PLE cells were grown on collagen-coated plastic while other cells were grown on plastic. N/N1003A and HeLa cells were provided by Drs. A. B. Chepelinsky and G. Thomas of this laboratory; other cell lines were obtained from the American Type Culture Collection (Rockville, MD). Chick embryos were from Truslow Farms (Chestertown, MD). Ten micrograms of test plasmid and 1.3 or 2 pg of an internal control plasmid containing the P-galactosidase gene were used for cotransfection as calcium phosphate precipitates (described in Dubin et aZ., 1989). The DNA precipitate remained in contact with the cells for 16 h, and following its removal, cells were washed twice with phosphate-buffered saline, refed, and harvested (as described by Borras et al., 1988) 32 h later. Immediately following removal of the DNA precipitate, human cells were glycerol shocked (Parker and Stark, 1979) for 1 min at room temperature in the appropriate growth medium containing 15% glycerol and then treatment was continued as described. The P-galactosidase plasmid pTB.1 (RSV-Pgal; Borras et al., 1988) was used for cotransfection into chick and human cells while pCHll0 (SV40 early promoter-$Gal, obtained from Pharmacia; Herbomel et al., 1984) was used in rabbit cells. Plasmids pRSV-CAT and pSV2-CAT were used as positive controls. Transfection experiments were repeated at least four times, using two preparations of plasmids pRD30A, pB5F35, and pB5. Enzyme Assays Cells were lysed in 100 m&f Tris-Cl, pH 7.8. CAT activity was determined by the method of Neumann et al. (1987) using 3H-acetyl coenzyme A (New England Nuclear, Boston, MA). Extracts were heated to 65°C for 15 min to inactivate inhibitory factors (Overbeek et al., 1985) and interfering acylases (New England Nuclear product description). @-Galactosidase levels were determined as described in Borras et al. (1988) except the sodium phosphate buffer was pH 7.0. To control for variation in transfection efficiencies, CAT levels were normalized using &galactosidase levels. Normalized CAT activity is expressed as a fold over CAT levels expressed by the promoterless vector pRD30A in each cell type. RESULTS

AND

DISCUSSION

Structural Analysis of the Human aB-Crystallin Gene The sequence of the human cYB-crystallin gene is presented in Fig. 1. This gene, like the previously se-

ET

AL.

quenced hamster aB-crystallin gene (Quax-Jeuken et al., 1985), is organized into three exons, with introns interrupting the two genes at identical positions. Primer extension analysis of RNA isolated from human lens (Fig. 2, lanes 1 and 2) suggests that the cuB-crystallin mRNA initiates at two or three sites at or very near the +l site indicated in Fig. 1, approximately 23 bp downstream of a TATATAA box; this is within 3 bp of the initiation site of the murine aB-crystallin gene (Dubin et al., 1989). Northern analysis demonstrated that the cYB-crystallin RNA isolated from human and mouse lens are the same size, approximately BOO-900bases (Fig. 3A1, lanes 1 and 2). As in the hamster (Quax-Jeuken et al., 1985) and murine (Dubin et al., 1989; R.A.D. and J.P., unpublished results) aBcrystallin genes, a polyadenylation addition signal, utilized in human cells (Iwaki et aZ., 1989), is located 120 bp downstream from the stop codon in the human gene (+3127 to +3132 in Fig. 1). The human and hamster aB-crystallin genes are highly similar at the nucleotide level in their promoters (approximately 95% nucleotide identity from -183 to -l), 5’ and 3’untranslated exon sequences(86 and 90%, respectively), and coding sequences (92% in exon 1; 86% in exon 2; 92% in exon 3). Despite the 49-nucleotide differences within the coding regions of the human and hamster genes, the two proteins differ by only six amino acid residues. Other regions of the two genes show greater sequence divergence. Comparison of the 111 bp past the end of the transcribed region (+3148 to +3258 in Fig. 1) reveals only 62% identity. While the introns of the hamster gene have been only partially sequenced, it is still clear that considerable divergence has occurred between the two genes in this region. For the 186 bp of intron 1 of the hamster aB gene available, there is only 57% nucleotide identity; for the 339 bp of intron 2 available, only a 64% identity. The protein sequence predicted from the gene sequence is nearly identical to the protein sequence experimentally determined by Kramps et al. (1977). The two differences observed were at residue 80 (where the gene sequence predicts aspartic acid rather than asparagine) and residue 132 (where threonine is predicted rather than alanine). The partial human aB-crystallin cDNA sequence presented by Iwaki et al. (1989) also predicts a threonine at amino acid position 132. Curiously, the complement of bases+1810 to +1783 within intron IT is nearly identical (27/28 matches) to the first 28 basesof the human U6 snRNA (Kunkel et al., 1986; Kunkel and Pederson, 1988) and to sequences near the 3’ end of a rat cytochrome C pseudogene (Scarpulla, 1984). U6 snRNA requires an AT-rich region and a proximal element for accurate transcription (Kunkel and Pederson, 1988; Lobo and Hernandez, 1989). While a short AT-rich region is present approximately 27 bp upstream of this sequence (near

HUMAN -940 -828 -ma -588 -468 -348 -228 -108

+13

+133 +253 l 373 +493 +613 +733 +053 +973 l lW3

aB-CRYSTALLIN

597

GENE

-829

GTCGAUCCACCCMMTACTGCCGAGCCTCTTCeGCCGGGGGGGAGGGGClGG~GTGGGGGCCCl~GlGAGAGCMC~GGGlGT~CCAGCGCCGCCCG~CCCCTAGTCCCCTCCCCCG CACACTCTTCAGCTGTCGUGGGGGCCTGAGAtGACAGCT~GGGTCCTGGCTGG~CGAGCTGGGGAGGGG~GCTGGTG~TGCCTGGGGCATGM~GGCCTCGCT~~CCCT~C ~CGGTTTGUCGTTTCUCACCTCATTTTCTCCTCTTCGGTGGCAGGCACTGTGCACCCMTTCCT~GCACTCCTG~TTTMTGTTCT~~GC~CATAGMC~~TGCM OAMTCTGTTTGCTCTTTTTTCAGGGGGTGGGGTCTTTCTGCCCA~TGT~~TCCTCTCCT~CC~GGTCMCCCAGGG~CGAGG~GATGGCTGGTGCT~CATGTT~C~TC ACTGCTCTCTTCCMGGACTCC~~GTTMTGTCCCTGGGGCT~GCCTAG~~TTCCA~TCCCTGCCCAGGCCCM~TAGTTGCTGGCCT~TTCCCCTGG~TTCAG~CTG GMAGCAGCAGGAGGGGCAUCTACGCCGGCTCCUTCCTeCCTCCCCCCACCCCGCGTGCCTGCTTGG~TTCCT~CTClGTACCAGCTTCA~~CAGGGGTGGGGGTGGGTGCCAlTGG GTGTGWCACMAGCTAGTGMACMGACCATCACMGTCACTGGCCGGCTCAGACGTGTTTGTGTCTCTCTTTTCTTAGCTCAGTGAGTACTGGGTATGTGTCA~TTGCC~TCCCG GATCAUAGTCTCCATGMCTGCTGGTGAGCTAGGATMTMMCGCTGMGGAGC 1 10 20 MOIAIHHPUlRRPFFPFHSPSRLFOGF TGACCAGCCAGCTCACCCCTCACACTCACCTAGCCACCATGGACATCGCCATCCACCACCCCTG~TCCGCCGCCCCTTCTTTCCTTTCCACTCCCCCAGCCGCCTCTTT~CCAGTTCT 30 40 50 60 FGEHLLESDLFPTSTSLSPFYLRPPSFLRAPSUFDTGLSE TCGGAGAGCACCTGTTGGAGTCTGATCTTTTCCCGACGTCTACTTCCCTGAGTCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGTTTGACACTGGACTCTCA~GG TGAGTCTCCCCACAGCTAGGACGGGAGTCCTTACTCCTTACTGGMCCTCCTGG~CTTCTCCATCCATTTTCCTTTCCTACCCTGCCT~CCATTT~AGGCACATGTGTGTCC~TGT~ GMMATGAGWGGTTGCTAGTGCCTTCCTCCCCCATCACCTGTTTCTATTTGATAGTCCTCTGTATCCCATTTATTACATTTTTTCATGCACTGTCMGTTTATCCTCCGTCCCCTMC TTCTCTACAGtATACCCCTTTCTGGTTfGCTTCATGACMTCTGCAGG~MGAGCTGCCTTC~CTCCTTTGCTTATCTCTlCCMCACCTTGGACTCTTGACC~TTTTACCATCTC AGGTTTCAGAGCCAGGAGAGGCCCTGCCTCATCCTGAGCTGTTCATCCCCATGGGTATTTTCTGCCTTTCTATTCCCTCTTCTATGATTTTCTGGGTTTCTCAGGGCTACGACAGGGCG CTGGCCTGGGTCCMTCMGCCCTACCAGWMCMTATACCCAGAGCTGTCACAGATMCACTCTG GTTTMAMTATT~GTGTGAGTMACACGACCTGAGTCGGCTGAGTGGGCMGGGCTTTGGMG~CMGCAGGACCAGCAGMCATTCCAGATTGGGTGGGTG~CTGGC~~~CCTGAG CCAGMWUGAGGCCTTTGTCTCACAGACAAACCACAAAGCCAGGCATTGGAGTCAGAGAGGCAGCAGATGCCAGGCTTGCACCCATCCTTGC~CTGGTCCCCTGGGTGATCTGTCTTC TTCTCTGTCCCTGTAAATAMGTTTGGGTCTWITCACCATGAGCCTTAGGTATCACTCTGGTGGCTCCCTGAAGCAGACAGCTATGTTTATTTMMAGCAGATTTTTTMGCACAGMG

-709 -509 -469 -349 -229 -109 +12

+I32

l 252 +372 +492 +612 +732 +a52 +972 +I092 +I212 I4

+1213

+I333 +1453 +I573 +1693 +I813 +I933 l 2053 l 2173 +2293 +2413 +2533 42653

+2773

l 2893 +3013 +3133 +3253

AGAAGGATWUTTACCCGGACAGAAAGCAGCTCTGCAGAATMGA~GCACCTGTGTAATCAGTATTTTTGCCCTCTTTCTCCCATCCCATTCCCTTACCTTGCTATTTCTA~TGCGCC 70 80 90 100 LEKDRFSVNLDVKHFSPEELKVKVLGDVIEVHGKHEERG TGGACMGGACAGGTTCTCTGTCAACCTGGATGTGMGCACTTCTCCCCAGAGGMCT~GTTMGGTGTTGGGAGATGTGATTGAGGTGCATGG~CAT~GAGC~CCAGGTAT GTAGCTTGTTTTTTTGTTTTCTGCTCATTCATTCAGTGATACTGTMTAGTCCAGGTAGTGCTATCAGCTTTGGAGGCTGGCTACATTCCAGTCCCMGCCATMCAGTCGGGATCAGGG GTTACMATCMTGTCTAGMGACTMGTTAGGATAGACATATTGCTGTTGTTACTATTATGGCCAGACATGTGGCCTTTGATTTGATCGCCTTAGATGGGATW\TGGGATGCTGATGCC CCATTTMGCCAGTGGTTCTGMTCTGGGCCACATTAGMTCACCAGGGGMCTTTC~CCTMTGCTCGGG~TCCTCCA~CCMTTAGCATATGTGCTGCC~GC~GCACTA CTCCAGACCMTTMATCAGCATTTTTMGGGTGGGACCCAGGCATCAGCMTTTTTMGGTMTTCTMTCTACAGTCMGGTTGAGMCCACTGATTAGGTATAGGGCTGTCA~CAC CTAGTTGCTTTGCATMTTACATTMCTACAGGTACCCTAAAAGCACTTGAGTTGTGACTTCTCTTTTAGCTGTGCMGMTCCGTGTCTCTTCTTTAGCCCATCTTMTGCTWUCTAC TTGGTTTGTCTMATTl~GAGCTGTGCTCAGTCTTTAATCCCCTACAGCCCATGTGGTMTCAGTTMCGAGAGCCTGTTTGGCTACATGCTTGACAGTCAGCAGGCATACGGGTTMG GTCATCTACTCTTTGGGGGAGTTCTGAGAMTGGMCAGCTTGTTATGACTTTATMGAGGGCTTTMAATTGCTTCTCACCATTTMCWTAGCTCAWACCTGTGCCTGTGCGTCMCCAGTAC AGTTTGTCCTCAGTAATGTCCTCAGGCTGTTTCAATTTTGCTTATATGATTTAGGTTTGGGTCATAGTCTCCTTGGATGGAGTCATTTTTTTTTTTTTTTMTTTCAG~GCAGTCCTAT TGTTCTGGMCCTTCTGGGACATTCCTGMGAGTCAGGACMTTTCAGGGCTTCCTCAGGGACTCAGATTCTAAATGAGATTCCMATTCTGTAGGCCCAGCCMCATTGATCTAAACCT TTGGGMATACCCCTAMCATATCTATGCCTCAGGGTTTGAAAAACMTGAAGTGTTGGACTGTTTCAGACTTCTCAGATTCTCACTGGTAGGAGTGACTACCTAGGCMTTTCATCTTC GCTGCMCCCTGMACGMGCTCTATTTATTTTlCCTATGTTGTCATGGCATTTGGTCTCACCTAAGGGGAMTCAGGATGCCTGAGTTCTGGGCAGGTGATAATAGTTCCTGTTCTTAT 130 110 120 OEHGFISREFHRKYRIPADVDPLTITSSL CTCTCTGCCTCTTTCCTCATTCTTTTGGGTTAGGATGAACATGGTTTCATCTCCAGGGAGTTCCACAGGAMTACCGGATCCCAGCTGATGTAGACCCTCTCACCATTACTTCATCCCTG 150 160 170 140 SSDGVLTVNGPRKQVSGPERTIPITREEKPAVTAAPKK* TCATCTGATGGGGTCCTCACTGTGAATGGACCAAGGAAACAGGTCTCTGGCCCTGAGCGCACCATTCCCATCACCCGTGAAGAGAAGCCTCCTGTCACCGCAGCCCCCAAGAAATACATG CCCTTTCTTCAATTGCATTTTTTAAAACAAGAAAGTTTCCCCACCAGTGAATGAAAGTCTTGTGACTAGTGCTGAAGCTTATTAATGCTAAGGGCAGGCCCAAATTATC~GCTAATAAA ATATCATTCAGCAACAGATAACTGTCTTGTGTTTGAATATTCCACACACTTTTAAATAAATATACAGATACCACAGATCTATTTATGATTGCATTATGAlTTAGAGGGCTCCAA~ TAGAGT

R +I332

+1452 +1572 +1692 +I812 +I932 +2052 +2172 +2292 +2412 +2532 +2652 +2772

+2892

+3012 +3132 +3252 +325a

FIG. 1. Sequence of the human aB-crystallin gene. The sequence of the human orB-crystallin gene was determined as described (Materials and Methods) and extends from -948 to f3258 relative to the transcription initiation site. A number of important sequences (see text) are underlined: the transcription initiation site (+l), TATAA box (-25 to -19), polyadenylation addition signal (+3127 to +3132), potential muscle-specific elements (-745 to -739; and -290 to -284), heat-shock element (-418 to -404), AP-2-like element (-367 to -360), human U6 snRNA sequence similarity (complement of +1810 to +1783). The numbers to the right and left of the sequence indicate base pairs relative to the site of transcription initiation; numbers above the sequence indicate amino acid residues of the predicted protein sequence. The symbol (I) indicates the stop codon.

+1838 in Fig. l), the proximal regulatory element required for expression of the U6 gene (Kunkel and Pederson, 1988; Lobo and Hernandez, 1989) does not appear to be present. The significance of this sequence within the aB-crystallin gene remains unknown. The aA-crystallin gene is alternatively spliced in rodents and other selected mammals (Hendricks et al., 1988), with approximately S-10% of the cuA mRNA containing an additional exon inserted between exons I and II (the insert exon; King and Piatigorsky, 1984). This alternatively spliced mRNA encodes a protein (&tins) which is slightly larger than the more abundant cuA polypeptide. While the insert exon is conserved in the human crA-crystallin gene, it has mutated and

probably is not expressed (Jaworski and Piatigorsky, 1989). No such larger protein has been reported for aB as it has for aA. Consistent with this observation, there is no sequence homology between the rodent insert exon and the human cYB-crystallin gene sequence. By examination of the sequence in Fig. 1, we have identified a number of potential cis-acting regulatory elements within the 5’ flanking sequence of the human nB-crystallin gene. As initially described by de Jong et al. (1989) in other cYB-crystallin promoters, an almost perfect heat-shock consensus sequence (CNNGAANNTTCNNG; Tanguay, 1988) is also found in the human cuB-crystallin promoter (-418 to -404 in Fig. 1). A sequence similar to that of the transcription factor

598

DUBIN

ET

AL.

experimentation and thus we used non-human lens cells for our transfection experiments described below. As seen in Fig. 3, the level of cYB-crystallin RNA varies with each cell type. Both primary chick lens cells (Fig. 3B1, lane 3) and the rabbit lens cell line N/N1003A (Fig. 3A1, lanes 5 and 6) accumulate significant amounts of aB RNA. In contrast, primary chick fibroblasts (Fig. 3B1, lane 2) and the rabbit kidney cell line RK13 (Fig. 3A1, lane 7) accumulate only very low levels of this transcript (not visible in these photographs). It is interesting to note that the human aB-crystallin exon 3 fragment used to probe Northern Al (in Fig. 3) failed to detect the chick czB RNA in cultured PLE

123110-

go-

1

2

3

4

5

6

FIG. 2.

Primer extension analysis. (Lanes 1 and 2) Two micrograms of total RNA isolated from human adult lens (lane 1) and E. coli tRNA (lane 2) was hybridized with radiolabeled oligonucleotide CS-220 (complementary to nucleotides +77 to +98 on Fig. l), extended in the presence of reverse transcriptase and dNTP, and resolved on a polyacrylamide/urea sequencing gel. An extended product of 98 bases is expected if the RNA initiates at $1 on Fig. 1. (Lanes 3-6) Twenty micrograms of total RNA isolated from cultured chick lens cells (PLE, lanes 3 and 4) or rabbit lens cells N/N1003A (lanes 5 and 6) either transfected with plasmid pB5F35 (lanes 3 and 6) or not transfected (lanes 4 and 5) was hybridized to radiolabeled oligonucleotide CS-135 (complementary to CAT) and extended as described. An extended product of 124 bases is expected if initiation is at +l. Markers were radiolabeled, MspI-restricted pBR322 fragments.

Al -16s

1

2

3

4

5

6

7

6

9

10

11

12

13

14

A2

81

AP-2 consensus binding site (CCCCAGGC; Imagawa et aZ., 1987; Mitchell and Tjian, 1989) is present between -367 and -360 (Fig. 1). In addition, the sequence TGCCTGG, recently identified as a promoter element required for muscle-specific expression of the acetylcholine receptor (d-subunit) gene (Baldwin and Burden, 1989), is present between -745 and -739 and a similar sequence is present between -290 and -284 in the human cwB-crystallin gene and may play a role in expression of aB in muscle. Establishing a role for these putative regulatory sites requires demonstration of function through both mutational analysis and protein binding. Functional Analysis Promoter

of the Human

cd-Crystallin

A 558-bp DNA fragment extending from -537 to +21 (Fig. 1) and containing the human cyB-crystallin promoter was placed upstream of the bacterial CAT gene and its ability to direct expression following transient transfection into cultured cells was determined. Prior to this, a variety of potentially useful cell lines and primary cells were examined for their ability to accumulate endogenous aB-crystallin RNA. Unfortunately, cultured human lens cells are impractical for

82

FIG. 3. Northern blot analysis. (Al) Either 0.5 pg (lanes 1 and 2) or 20 pg (lanes 3-14) of total RNA was electrophoresed on formaldehyde/agarose gels, transferred to nitrocellulose, and hybridized with a human orB-crystallm probe containing much of exon III (+2849 to +3092 in Fig. 1). RNAs were isolated from the following sources: Lane 1, a-month-old mouse lens; lane 2, human adult lens; lane 3, cultured chick lens cells (PLE); lane 4, chick fibroblasts; lanes 6 and 6, rabbit lens cell line N/N1003A, lane 7, rabbit kidney epithelial cell line RK13, lane 8, glioblastoma-astrocytoma cell line U-373MG; lane 9, astrocytoma cell line CCF-STTGl; lane 10, glioblastomaastrocytoma cell line U-87MG; lane 11, glioblastoma cell line U138MG; lane 12, neuroblastoma cell line SK-N-S& lane 13, neuroblastoma cell line SK-N-MC; lane 14, HeLa cells. (Bl) Total RNA, 2 fig (lane l), 20 pg (lanes 2 and 3), 0.25 pg (lane 4), or 2.5 pg (lane 6), was treated as described above and probed with an aBcrystallin cDNA derived from duck lens RNA. RNAs were from, lane 1, 13-day-old embryonic chick lens; lane 2, cultured chick fibroblasts; lane 3. cultured chick lens cells (PLE); lanes 4 and 5, 2month-old mouse lens. (A2 and B2) To ensure RNA integrity, blots were reprobed with a human p-actin cDNA.

HUMAN

aB-CRYSTALLIN

TABLE Activity

of the Human

aB-Crystallin

pRD3OA pB5F35 pB5 pRSVCAT pSV2CAT

1” 171C + 45d 0.2 rt 0.1 1146 N.D.

(YB RNA’

+

Chick fibroblasts

Promoter

1 35 k 25 N.D. 1093 N.D. +/-

N/N1003A 1 97 2 9 N.D. N.D. 607

599

1 in Lenticular

Relative

PLE

GENE

CAT

1 18 + 3 N.D. N.D. 463 +/-

Cells

activity”

RK13

+-I-+

and Nonlenticular

U-373MG

U-138MG

1 3+1 N.D. 541 N.D.

1 12 f 3 N.D. 634 N.D.

+++

+

SK-N-SH 1 11 + 2 N.D. 235 N.D.

’ CAT activity normalized to cotransfected /3-gaiactosidase. * Normalized CAT activity expressed as fold above pRD3OA for each cell type. ’ Mean. d Standard deviation. e N.D., not done. ‘Relative level of endogenous cYB-crystallin RNA, data are taken from Fig. 3.

(lane 4) and only poorly hybridized to this transcript in RNA isolated from chick lens (not shown). Analysis using a duck aB-crystallin cDNA as probe more accurately revealed the abundance of aB-crystallin RNA in chick cells (Fig. 3Bl). Further, chick PLE and lens clearly express two very differently sized (YBRNAs (Fig. 3B1, lanes 1 and 3); lower levels of both transcripts are also observed in cultured fibroblasts (Fig, 3B1, lane 2) and 13-day-old embryonic chick thigh muscle (not shown). The presence of two aB-crystallin transcripts in duck lens has previously been demonstrated (Dodemont et al., 1985). Also, murine brain and lung tissue synthesize a larger aB-crystallin RNA than that found in lens, muscle, and kidney (Dubin et cd., 1989); the molecular basis for this difference remains unknown. Goldman and co-workers (Iwaki et al., 1989) have demonstrated that excessive accumulation of CYB-crystallin in astrocytes is associated with Alexander’s disease. They also showed that the glioblastoma-astrocytoma cell line U-373MG synthesizes large amounts of aB-crystallin RNA and protein. We have examined expression of cwB-crystallin RNA in a variety of human tumor cell lines (Fig. 3A1, lanes 8-14), particularly tumors of the central nervous system, and chose cell lines U-373MG, U-138MG (glioblastoma), and SK-N-SH (neuroblastoma) as examples of cells that accumulate high, intermediate, and no cuB-crystallin RNA, respectively, for further study. Following transfection into lens and non-lens cells, promoter strength was indirectly determined by measuring CAT activity. The 558-bp human aB-crystallin fragment (-537 to +21) was capable of promoting transcription of the CAT gene and this ability was clearly orientation specific. Following transfection into chicken PLE cells, plasmid pB5F35 (which contains

the promoter fragment in the correct orientation with respect to the nB-crystallin gene) expressed CAT at significantly higher levels than the promoterless vector pRD30A, while pB5 (which contained the insert in the opposite orientation) did not (Table 1). When compared to pRD3OA, plasmid pB5F35 promoted CAT expression best in chick and rabbit lens cells (PLE and N/N1003A, respectively; Table 1). Primer extension analysis revealed that CAT RNA isolated from chick and rabbit lens cells transfected with pB5F35 initiated at (or very near) the same initiation site used by the endogenous aB-crystallin RNA in human lens (Fig. 2, lanes 3-6). Plasmid pB5F35 functioned less efficiently in two non-human, non-lens cells. In rabbit kidney cell line RK13 and in chick fibroblasts, CAT activity was approximately four- to fivefold less than in lens cells (Table 1). These results correlate with a high level of expression of aB-crystallin RNA in chick PLE and N/ N1003A cells and a much lower level in chick fibroblasts and RK13 cells. The preferential expression of the human aB-crystallin promoter in lens cells is probably underestimated in our experiments since we used non-human lens cells for transfection. By analogy with our transgenic mouse experiments using the CXA(Overbeek et al., 1985) and (YB- (Dubin et al., 1989) crystallin promoters, it is likely that the homologous combination of human promoter in human lens cells would accentuate the greater promoter activity in lens than in non-lens cells. Since overexpression of aB-crystallin in astrocytes is associated with Alexander’s disease, we sought to determine whether this promoter fragment was sufficient for expression in this cell type. CAT constructs were introduced into astrocytoma cell line U-373MG and two other human cell lines and the results are

600

DUBIN

shown in Table 1. Plasmid pB5F35 functioned poorly (relative to pRD30A) in all three human cell lines examined. Most notably, CAT activity did not correlate with the levels of endogenous crB-crystallin RNA present in these cell lines, particularly U-37’3MG. Since qualitative and quantitative differences exist in the levels of aB-crystallin RNA and protein in a variety of tissues (Bhat and Nagineni, 1989; Dubin et al., 1989, Iwaki et al., 1989; 1990), it would not be surprising to find complex regulatory mechanisms controlling expression of this gene. Previously, we demonstrated that a murine cuB-crystallin mini-gene (containing -666 bp upstream of the initiation site, 2.4 kbp downstream of the poly(A) addition site, and no introns) was expressed in a manner similar to that of the endogenousgene in transgenic mice (Dubin et al., 1989). Here we demonstrate that the human aB-crystallin promoter fragment extending from -537 to +21 functions best in cultured lens cells, suggesting that regulatory elements necessary for expression in lens reside within this region. In similar experiments analyzing a series of murine cYB-crystallin mini-gene deletion mutants, it was shown that sequencesdownstream of -222 were required for expression in chick PLE (Dubin et al., 1989). While the previously reported murine aB mini-gene experiments did not completely eliminate a requirement for some 3’ sequences, further work has shown that a murine (YB promoter-CAT construct containing sequences extending from -661 to +44 functions efficiently in lens, both in cultured cells (PLE and N/N1003A) and in transgenic mice (R. A. Dubin, E. F. Wawrousek, and J. Piatigorsky, unpublished observations) . While cell line U-373MG accumulates high levels of endogenous aB-crystallin RNA, plasmid pB5F35 functioned poorly in this cell line. One possibility is that structural alterations at the aB-crystallin gene in strain U-373MG are responsible for the high level of (YB expression (and would not be expected to stimulate transcription from pB5F35). Alternatively, additional regulatory elements may be required for expression of aB-crystallin in this glial cell. Studies of transgenic mice carrying a murine (YB promoter-CAT construct (-661 to +44) are consistent with the existence of additional regulatory elements outside of the promoter. In seven independent transgenic mice lines, this construct always expressed CAT efficiently in lens and lesswell in skeletal muscle; expression in other tissues was either not detected or else observed, usually at low levels, in a nonreproducible manner (R. A. Dubin, E. F. Wawrousek, and J. Piatigorsky, unpublished observations). Taken together with previous studies of the murine aB-crystallin mini-gene (Dubin et al., 1988), these results suggest that 3’ flanking sequencesare involved in regulating aB expression in some tissues. In addition, although relatively low, the levels of CAT

ET AL.

activity expressed by pB5F35 were higher than expected following transfection into chick fibroblasts, rabbit kidney cell line RK13, and the neuroblastoma line SK-N-SH, which accumulate little or no endogenous crB-crystallin RNA (Table 1 and Figs. 3Al and Bl). While the reason for this effect remains unclear, it is possible that negative regulatory sequences have been removed or perhaps the chromatin structure of the episomal plasmid during transient transfection is involved. ACKNOWLEDGMENTS We thank Drs. H. Bloemendal and G. Wistow for providing aBcrystallin cDNAs and members of our laboratory, particularly B. Norman, C. M. Sax, J. F. Klement, A. B. Chepelinsky, and G. Thomas, for helpfnl advice and materials. Note added in proof. Recent work of Baldwin and Burden [1990, Nature (London) 345: 364) indicates that the muscle-specific elements identified in Fig. 1 are not sufficient to confer muscle-specific gene expression, thus bringing into question any role these sequences might play in the expression of aB-crystallin.

REFERENCES 1. BALDWIN, T. J., AND BURDEN, S. J. (1989). Muscle-specific gene expression controlled by a regulatory element lacking a MyoDlbinding site. Nature (London) 341: 716-720. 2. BARNA, B. P., BAY, J. W., CHOU, S. M., HOELTGE, G. A., AND JACOBS,B. (1983). Characterization of cell cultures from normal and neoplastic human brain tissue. In Vitro 19: 276. 3. BEALE, A. J., CHRISTOFINIS, G. C., AND FURMINGER, I. G. S. (1963). Rabbit cells susceptible to rubella virus. Lancer 2: 640641. 4. BECKMAN, G., BECKMAN, L., PONTEN, J., AND WESTERMARK, B. (1971). G-6-PD and PGM phenotypes of 16 continuous human tumor cell lines. Hum. Hered. 21: 238-241. 5. BHAT, S. P., AND NAGINENI, C. N. (1989). aB subunit of lensspecific protein cu-crystallin is present in other ocular and nonocular tissues. Biochem. Biophys. Res. Commun. 158: 319-325. 6. BLOEMENDAL, H. (1977). The vertebrate eye lens. Science 197: 127-138. I. BORRAS, T., PETERSON, C. A., AND PIATIGORSKY, J. (1988). Evidence for positive and negative regulation in the promoter of the chicken 81-crystallin gene. Dev. Biol. 127: 209-219. 8. CHOMCZYNSKI, P., AND SACCHI, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal. Biochem. 162: 156-159. 9. DE JONG, W. W., HENDRIKS, W., MULDERS, J. W. M., AND BLOEMENDAL, H. (1989). Evolution of eye lens crystallins: The stress connection. Trends Biol. Sci. 14: 365-368. 10. DODEMONT, H., GROENEN, M., JANSEN, L., SCHOENMAKERS, J., AND BLOEMENDAL, H. (1985). Comparison of the crystallin mRNA populations from rat, calf and duck lens: Evidence for a longer aA2-mRNA and two distinct aB2-mRNAs in the birds. Biochim.

Biophys.

Acta 824:

284-294.

11. DUBIN, R. A., WAWROUSEK, E. F., AND PIATIGORSKY, J. (1989). Expression of the murine aB-crystallin gene is not restricted to the lens. Mol. Cell. Biol. 9: 1083-1091.

HUMAN

nB-CRYSTALLIN

12. DUGUID, J. R., ROHWER, R. G., AND SEED, B. (1988). Isolation of cDNAs of scrapie-modulated RNAs by subtractive hybridization of a cDNA library. Proc. Natl. Acad, Sci. USA 86: 5733 5742. 13. GORMAN, M. G., MOFFAT, L. F., AND HOWARD, B. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2: 1044-1051. 14. GUNNING, P., PONTE, P., OKAYAMA, H., ENGEL, J., BLAU, H., AND KEDES, L. (1983). Isolation and characterization of fulllength cDNA clones for human (Y-, fi-, and -actin mRNAs: Skeletal but not cytoplasmic actins have an amino-terminal cysteine that is subsequently removed. Mol. Cell. Biol. 3: 787795.

15. HARDING, J. J., AND CRABBE, M. J. C. (1984). The lens: Development, proteins, metabolism and cataract. In “The Eye” (H. Davson, Ed.), pp. 207-492, Academic Press, New York. 16. HENDRICKS, W., SANDERS, J., LEIJ, L., RAMAEKERS, F., BLOEMENDAL, H., AND DE JONG, W. W. (1988). Monoclonal antibodies reveal evolutionary conservation of alternative splicing of the aA-crystallin primary transcript. Eur. J. Biochem. 174: 133-137. 17. HERBOMEL, P., BOURACHOT, B., AND YANIV, M. (1984). Two distinct enhancers with different cell specificities coexist in the regulatory region of polyoma. Cell 39: 653-662. 18. IMAGAWA, M., CHIU, R., AND KARIN, M. (1987). Transcription factor AP-2 mediates induction by two different signal-transduction pathways: Protein kinase C and CAMP. CelZ 61: 251260. 19. INGOLIA, T. D., AND CRAIG, E. A. (1982). Four small Drosophila heat shock proteins are related to each other and to mammalian ol-crystallin. Proc. Natl. Acad. Sci. USA 79: 2360-2364. 20. IWAKI, T., KUME-IWAKI, A., LEIM, R. K. H., AND GOLDMAN, J. E. (1989). otB-Crystallin is expressed in non-lenticular tissues and accumulates in Alexander’s disease brain. Cell 57: 71-78. 21. IWAKI, T., KUME-IWAKI, A., AND GOLDMAN, J. E. (1990). Cellular distribution of aB-crystallin in non-lenticular tissues. J. Histochem. Cytochem. 38: 31-39. JAWORSKI, C. J., AND PIATIGORSKY, J. (1989). A pseudo-exon 22. in the functional human aA-crystallin gene. Nature fLondon) 337: 752-754. 23. KING, C. R., AND PIATIGORSKY, J. (1984). Alternative splicing of cY-crystallin RNA. J. Biol. Chem. 259: 1822-1826. 24. KRAMPS, J. A., DE MAN, B. M., AND DE JONG, W. W. (1977). The primary structure of the B2 chain of human cu-crystallin. FEBS

L&t.

74: 82-84.

25. KUNKEL, G. R., MASER, R. L., CALVET, J. P., AND PEDERSON, T. (1986). U6 small nuclear RNA is transcribed by RNA polymerase III. Proc. Natl. Acad. Sci. USA 83: 8575-8579. 26. KUNKEL, G. R., AND PEDERSON, T. (1988). Upstream elements required for efficient transcription of a human U6 RNA gene resemble those of Ul and U2 genes even though a different polymerase is used, Genes Dev. 2: 196-204. 27. LOBO, S. M., AND HERNANDEZ, M. (1989). A 7bp mutation converts a human RNA polymerase II snRNA promoter into an RNA polymerase III promoter. Cell 58: 55-67. 28. MITCHELL, P. J., AND TJIAN, R. (1989). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245: 371-378. 29. NENE, V., DUNNE, D. W., JOHNSON, K. S., TAYLOR, D. W., AND CORDINGLY, J. S. (1986). Sequence and expression of a major

601

GENE

egg antigen from Schistosoma mansoni: Homologies to heat shock proteins and alpha-crystallins. Mol. Biochem. Parasitol. 21: 179-188. 30. NEUMANN, J. R., MORENCY, C. A., AND RUSSIAN, K. 0. (1987). A novel rapid assay for chloramphenicol acetyltransferase gene expression. BioTechniques 6: 444-447. 31. NGO, J. T., KLISAK, I., DUBIN, R. A., PIATIGORSKY, J., MoHANDAS, T., SPARKES, R. S., AND BATEMAN, J. B. (1989). ASsignment of the oB-crystallin gene to human chromosome 11. Genomics

5: 665-669.

32. NICKERSON, J. M., WAWROUSEK, E. F., BORRAS, T., HAWKINS, J. W., NORMAN, B. L., FLIPULA, D. R., NAGEL, J. W., ALLY, A. H., AND PIATIGORSKY, J. (1986). Sequence of the chicken 62 crystallin gene and its intergenie spacer. J. Biol. Chem. 261: 552-557. 33. OVERBEEK, P. A., CHEPELINSKY, A. B., KHILLAN, J. S., PIATIGORSKY, J., AND WESTPHAL, H. (1985). Lens-specific expression and developmental regulation of the bacterial chloramphenicol acetyltransferase gene driven by the murine orA-crystallin promoter in transgenic mice. PFOC. Natl. Acad. Sci. USA 82: 7815-7819. 34. PARKER, B. A., AND STARK, G. R. (1979). Regulation of simian virus 40 transcription: Sensitive analysis of the RNA species present early in infections by virus or viral DNA. J. Virol. 31: 360-369. 35. PIATIGORSKY, J., AND WISTOW (1989). Enzyme/crystallins: Gene sharing as an evolutionary strategy. Cell 57: 197-199. 36. PONTEN, J., AND MACINTYRE, E. H. (1968). Long term culture of normal and neoplastic human glia. Acta Pathol. Microbial. Stand.

74: 465-486.

37. QUAX-JEUKEN, Y., QUAX, W., VAN RENS, G., KHAN, P. M., AND BLOEMENDAL, H. (1985). Complete structure of the cYB-crystallin gene: Conservation of the exon-intron distribution in the two nonlinked a-crystallin genes. Proc. Natl. Acad. Sci. USA 82: 5819-5823. 38. REDDAN, J. R., CHEPELINSKY, A. B., DZIEDZIC, D. C., PIATIGORSKY,J., AND GOLDENBERG, E. M. (1986). Retention of lens specificity in long-term cultures of diploid rabbit lens epithelial cells. Diferentiation 33: 168-174. 39. SCARPULLA, R. C. (1984). Processed pseudogenes for rat cytochrome C are preferentially derived from one of three alternate mRNAs. Mol. Cell. Biol. 4: 2279-2288. 40. SPENGLER, B. A., BIEDLER, J. L., HELSON, L., AND FREEDMAN, L. S. (1973). Morphology and growth, tumorigenicity, and cytogenetics of human neuroblastoma cells established in vitro. In Vitro 3: 410. 41. TANGUAY, R. M. (1988). Transcriptional activation of heatshock genes in eukaryotes. Biochem. Cell Biol. 66: 584-593. 42. VAN DEN HEUVEL, R., HENDRIKS, W., QUAX, W., AND BLOEMENDAL, H. (1985). Complete structure of the hamster aAcrystallin gene. J. Mol. Biol. 185: 273-284. 43. VAN DER OUDERAA, F. J., DE JONG, W. W., HELDERINK, A., AND BLOEMENDAL, H. (1974). The amino-acid sequence of the olBx chain of bovine a-crystallin. Eur. J. Biochem. 49: 157168. 44. WAWROUSEK, E. F., CHEPELINSKY, A. B., MCDERMOTT, J. B., AND PIATIGORSKY, J. (1990). Regulation of the murine aAcrystallin promoter in transgenic mice. Dev. Biol. 137: 68-76. 45. WISTOW, G. J., AND PIATIGORSKY, J. (1988). Lens crystallins: The evolution and expression of proteins for a highly specialized tissue. Annu. Rev. B&hem. 67: 479-504.