Antiviral Research 111 (2014) 8–12

Contents lists available at ScienceDirect

Antiviral Research journal homepage: www.elsevier.com/locate/antiviral

Short Communication

Human cytomegalovirus (CMV) susceptibility to currently approved antiviral drugs does not impact on CMV terminase complex polymorphism Léa Pilorgé a,b, Sonia Burrel c,d,e, Zaïna Aït-Arkoub e, Henri Agut c,d,e, David Boutolleau c,d,e,⇑ a

Laboratoire Universitaire de Biodiversité et d’Ecologie Microbienne, EA3882, Faculté de Médecine, Université Européenne de Bretagne, F-29609 Brest, France Laboratoire de Virologie, CHRU de la Cavale Blanche, F-29609 Brest, France Sorbonne Universités, UPMC Univ Paris 06, CR7, Centre d’Immunologie et des Maladies Infectieuses (CIMI-Paris), F-75013 Paris, France d INSERM, U1135, CIMI-Paris, F-75013 Paris, France e AP-HP, Hôpitaux Universitaires Pitié-Salpêtrière – Charles Foix, Service de Virologie, F-75013 Paris, France b c

a r t i c l e

i n f o

Article history: Received 31 March 2014 Revised 8 August 2014 Accepted 13 August 2014 Available online 4 September 2014 Keywords: Human cytomegalovirus Resistance to DNA polymerase inhibitors Terminase complex Natural polymorphism

a b s t r a c t Currently approved anti-human cytomegalovirus (CMV) drugs, all targeting the viral DNA polymerase, are associated with significant toxicities and emergence of drug resistance. In this context, CMV terminase complex constitutes a promising target for novel antiviral compounds. In this study, we describe the low natural polymorphism (interstrain identity >97.7% at both nucleotide and amino acid levels) of the terminase subunits pUL56 and pUL89, and the portal protein pUL104, among 63 CMV clinical strains, and we show that the CMV resistance profile to current DNA polymerase inhibitors has no impact on the natural polymorphism of CMV terminase complex. These results support the idea that both CMV clinical strains exhibiting either susceptibility or resistance to current CMV DNA polymerase inhibitors are comparably sensitive to novel inhibitors of CMV terminase complex, such as letermovir. Ó 2014 Published by Elsevier B.V.

Currently approved antiviral drugs for the treatment of systemic human cytomegalovirus (CMV) infections in immunocompromised patients include the viral DNA polymerase inhibitors (val)ganciclovir, cidofovir, and foscarnet. However, these drugs have adverse effects, such as myelosuppression or nephrotoxicity, a poor oral bioavailability (except for valganciclovir), and may lead to the emergence of antiviral resistant CMV strains during longterm or repeated treatments (Lurain and Chou, 2010). Therefore, the development of new antivirals targeting other essential processes for virus replication is highly desired. The CMV terminase complex represents one of these promising targets. This viral complex consists of at least 2 essential proteins, pUL56 and pUL89, which interact with the portal protein pUL104 to achieve the cleavage/packaging of viral genomes (Bogner, 2002). Conserved regions and putative functional domains of pUL56 and pUL89 have been previously reported (Champier et al., 2007, 2008). Specific inhibitors of CMV terminase complex have been discovered, including the benzimidazole ribonucleoside BDCRB, that prevents the

⇑ Corresponding author at: Service de Virologie, Bâtiment CERVI, Groupe Hospitalier Pitié-Salpêtrière, 83 boulevard de l’Hôpital, F-75013 Paris, France. Tel.: +33 1 42 17 72 89; fax: +33 1 42 17 74 11. E-mail address: [email protected] (D. Boutolleau). http://dx.doi.org/10.1016/j.antiviral.2014.08.014 0166-3542/Ó 2014 Published by Elsevier B.V.

interaction of pUL56 with pUL104 (Dittmer et al., 2005), and the phenylenediamine–sulfonamide BAY 38-4766, that targets pUL89 and pUL104 (Reefschlaeger et al., 2001). Mutations conferring resistance to BDCRB have been mapped to both pUL56 and pUL89, and mutations in pUL104 may compensate for conformational changes in pUL56 and pUL89 inducing CMV resistance to these drugs (Dittmer et al., 2005; Komazin et al., 2004; Krosky et al., 1998). Regarding BAY 38-4766, resistance mutations have been described in pUL89 and pUL104 (Reefschlaeger et al., 2001). However, the development of these 2 compounds was discontinued (Lischka and Zimmermann, 2008). Recently, letermovir (AIC246) has shown a potent anticytomegaloviral activity in vitro through a specific antiviral mechanism involving the pUL56 subunit of CMV terminase complex (Goldner et al., 2011; Lischka et al., 2010). Marker transfer experiments permitted the identification of 7 different mutations located in pUL56 and conferring resistance to letermovir (Goldner et al., 2011, 2014). This molecule, that is active against CMV isolates resistant to nucleoside analogs, was effective in an immunocompromised patient with multidrugresistant CMV disease (Kaul et al., 2001; Marshall et al., 2012). Moreover, 2 different phase 2 clinical trials showed recently that letermovir is efficacious and safe for preemptive treatment of CMV infection in kidney transplant recipients and prophylactic

9

L. Pilorgé et al. / Antiviral Research 111 (2014) 8–12 Table 1 Primers used for amplification and sequencing of CMV full-length UL56, UL89, and UL104 genes. Gene

Function

Name

Sequence (50 ? 30 )

UL56

First-round PCR (outer primers)

UL56-F1 UL56-R1 UL56-F2 UL56-R2 UL56-A UL56-B UL56-C UL56-D UL56-E UL56-G UL56-H UL56-I +UL56-F2/UL56-R2

F: TCCGTACTTGAGGGTAGTGTTG R: ACAGCTTCGGGAGCAGAAC F: TAGACTGACCGGGTTTGAGC R: TTATTTGTGCACCGACTCCA R: AACGTGCTGCAGAAGGAGAT F: ACGCGATCGAGAGTTGTTTC R: CCTACCTGCAGAAGGTCTCG F: AACGGATCACCTTGCCATAG R: CATCACCATCCAGCAGCTAA F: ACGAAGATGTCCTCCACGTC R: GTCCGTTTCAGCGTCAGTCT F: TCGACGTACACTTCCTGACG

UL89A-F1 UL89A-R1 UL89A-F2 UL89A-R2 UL89A-A UL89A-B UL89A-C UL89A-I +UL89A-F2/UL89A-R2

F: CCGTTATTATCGCAGTCACG R: CGACGACGACACTTTCGTTT F: GGCTTTGTTAGCCGACTACG R: ATTGGTTCCGGTTTTCAGGT R: CACATGATCATCTCGGTGCT F: GTAGAAGAGCACGCGGATG R: GAAGAGCACCTGCACAGCTT F: TTATTGGTACCGCCGATGAT

UL89B-F1 UL89B-R1 UL89B-F2 UL89B-R2 UL89B-A UL89B-I +UL89-F2/UL89-R2

F: TGGGACCTGGTCAAGGTAGA R: ACGACACCACTAGGGACGAC F: GGAACCTGTGTCACGTATGAT R: GCAACAACGTGGTTTTCG R: GACTCGAACCGTTTCAAAAGA F: GGGATCTTGGTCACGGCTAT

UL104-F1 UL104-R1 UL104-F2 UL104-R2 UL104-A UL104-B UL104-C UL104-D UL104-E UL104-I +UL104-F2/UL104-R2

F: TAGCCTAGAAAGGCCGAGGT R: AGACGCGGTAGATGGTCTTG F: GCACCGTAAAGTCGAGCACT R: GGCAGAGGGGTTGTTATCTG R: ACGCCGAACTCTACCACCT F: AACTGCGAGAAGAAGCTGTTG R: TCAACTGCAAGAAGCTGGTG F: GATTTGCTGTCCGAGACGTT R: CGCTCCGCGACATTTTAT F: TGGTCTTCACGTCCAGCA

Second-round PCR (inner primers)

Sequence reaction

UL89Aa

First-round PCR (outer primers) Second-round PCR (inner primers)

Sequence reaction

UL89Ba

First-round PCR (outer primers) Second-round PCR (inner primers) Sequence reaction

UL104

First-round PCR (outer primers) Second-round PCR (inner primers) Sequence reaction

F: forward; R: reverse. a The 2 exons encoding the full-length UL89 subunit of CMV terminase complex were amplified using 2 distinct PCR systems (A and B).

treatment in hematopoietic stem cell transplant recipients (Chemaly et al., 2014; Stoelben et al., 2014). In this context of growing interest for CMV terminase inhibitors as potential novel anti-CMV drugs, the present study aimed at describing the natural polymorphism of CMV terminase complex among clinical strains exhibiting either susceptibility or resistance to currently approved CMV DNA polymerase inhibitors. This study included the analysis of 63 CMV positive whole blood samples (median CMV load, 13,702 international units/mL) collected from unrelated immunocompromised patients (41 men, 22 women, median age: 52 years old) including solid organ transplant recipients (n = 41), hematopoietic stem cell transplant recip-

ients (n = 16), and HIV-infected patients (n = 6). These patients received antiviral treatment with approved CMV DNA polymerase inhibitors, as follows: prophylactic/preemptive treatment with valganciclovir (n = 31), and curative treatment with ganciclovir, foscarnet, and/or cidofovir, alone or in combination (n = 32). Genotypic testing for the detection of CMV drug resistance, performed as previously reported (Boutolleau et al., 2009, 2011), revealed 33 drug-sensitive and 30 drug-resistant strains. CMV resistance profiles were as follows: ganciclovir alone (n = 22), ganciclovir + cidofovir (n = 6), foscarnet alone (n = 1), ganciclovir + cidofovir + foscarnet (n = 1). None of the patients received CMV terminase inhibitors. Amplification and sequencing of UL56, UL89 and

Table 2 Variations of CMV terminase complex, both at nucleotide and amino acid levels, among 63 CMV clinical strains in comparison with reference strain AD169 (GenBank accession number BK000394). Parameter

UL56 subunit

UL89 subunit

UL104 portal protein

Nucleotide identity (%) Nucleotide mutations (No.) Frequency per strain (mean) Silent mutations (%) Amino acid identity (%) Amino acid changes (No.) Frequency per strain (mean) Variation of the total codons (%)

98.0–100 159 0–52 (25.4) 118 (74.2) 98.8–100 41 0–10 (4.6) 4.8

98.8–99.9 95 3–25 (16.0) 85 (89.4) 99.3–99.7 10 2–5 (3.4) 1.5

97.7–99.9 183 3–44 (22.7) 145 (74.9) 99.4–100 38 0–4 (0.8) 5.5

10

L. Pilorgé et al. / Antiviral Research 111 (2014) 8–12 E393K A425V G436E* M442T A444G* S445N Del N446 N446S* Del NSS 449-451 Del SSTH 450-453* T452I S454N G460V A464V * A464T* V471A V476A R507C E485G H509N*

A

E2K V12L

H2N

V33A* L122P* A36V* E75G* R129H*

I

II

21-31 41-62

A221V D242G

III

IV

V

VI

VII

134-141

191-220

272-300

356-374

514-572

V231L V236M L241P

B

I

48-52

II

VIII

H698Q* C721Y S749N

IX

X

590-600 617-658

XI

676-713

COOH

XII

732-744 755-764

R369M C325Y R369G R369S

Q249H K253Q K253T E254A G239C R258P N294D H216R Q244H A283P S345A

L89P D94N K95E

T37A L38M

H2N

A327V

A648R A648S G649D* L658F

Q577R V582M D586N

V778A A779T A779V* A788T* V793A V793P* P800L P803A Y806T* T811P* A812E A812G G813A* A820Q* L831M G840A S848N

III

IV

155-170 203-221 239-246

V

VI

VII

290-370 382-418

G635S

I531V L562F* C511F L548V

T448I

VIII

IX

X

437-455 458-480 688-512 532-549

A663V D665E A668P F671S R672K V673I

A659V*

XI

XII

COOH

575-624 649-662

Fig. 1. Polymorphism map of (A) pUL56 and (B) pUL89 subunits of CMV terminase complex. Conserved regions are represented by the boxes. The positions (codon numbers) of these conserved regions are indicated under each box (Champier et al., 2007, 2008). All amino acid positions related to natural polymorphism reported so far in the literature are indicated above. Natural polymorphisms newly described in this study are underlined. ⁄Natural polymorphisms described in this study only in drug-resistant CMV strains. Regarding pUL56 map, amino acid changes conferring resistance to letermovir are indicated in bold below (Goldner et al., 2014).

UL104 full-length genes were performed according to previous procedures (Boutolleau et al., 2009, 2011). Primers are listed in Table 1. Nucleotide and amino acid sequences were compared with that of CMV reference strain AD169 (GenBank accession number BK000394) using SeqScape v2.5 software (Applied Biosytems). All sequences determined in this study have been deposited in the GenBank database under accession numbers KF805152 through KF805340.

At the nucleotide level, the interstrain identity of UL56, UL89, and UL104 genes ranged from 97.7% to 100% among the 63 CMV strains investigated (Table 2). In comparison with AD169 reference sequences, 159, 95, and 183 nucleotide mutations were identified within the coding sequence for UL56, UL89, and UL104, respectively, corresponding to an average number of 25.4, 16.0, and 22.7 per strain, respectively. The majority (>74%) of these nucleotide mutations were silent. Thus, at the amino acid

Table 3 Comparison of CMV terminase complex variations, both at nucleotide and amino acid levels, according to CMV susceptibility profile to current CMV DNA polymerase inhibitors.

a

p valuea

CMV terminase complex

Study level

Drug-sensitive CMV strains (n = 33)

Drug-resistant CMV strains (n = 30)

UL56 subunit

Nucleotide Amino acid

98.9 (98.0–100) 99.5 (98.9–100)

98.9 (98.5–100) 99.4 (98.8–100)

0.91 0.99

UL89 subunit

Nucleotide Amino acid

99.2 (98.8–99.5) 99.4 (99.3–99.6)

99.2 (98.9–99.9) 99.6 (99.3–99.7)

0.19 0.45

UL104 portal protein

Nucleotide Amino acid

98.9 (97.9–99.9) 99.9 (99.4–100)

98.9 (98.4–99.9) 100 (99.6–100)

0.77 0.57

Mann–Whitney U test.

Median identity (range)

L. Pilorgé et al. / Antiviral Research 111 (2014) 8–12

level, the interstrain identity of pUL56, pUL89, and pUL104 was >98.8%, with the identification of 41, 10, and 38 amino acid changes, respectively, corresponding to 4.8%, 1.5%, and 5.5% of the total codons of the proteins, respectively (Table 2). Each CMV strain harbored a mean number of 4.6 (pUL56), 3.4 (pUL89) and 0.8 (pUL104) amino acid changes. Overall, the frequency of these amino acid changes related to natural polymorphism of CMV terminase complex ranged from 3.3% to 100% (Supplementary Tables 1–3). The most frequent changes observed (i.e., in at least 70% of CMV strains) were V471A, V476A, and V793A for pUL56, T37A, K95E, and S345A for pUL89. Among the natural polymorphisms newly described in this study, 2/23 were located within conserved regions for pUL56 (G649D, region IX; H698Q, region X), and 1/4 for pUL89 (A659V, region XII). Conversely, the higher frequency of amino acid changes observed for the portal protein pUL104 did not exceed 10% of CMV strains (Supplementary Table 3). The new data provided by this work together with the data reported so far in the literature enabled to provide the polymorphism maps of CMV pUL56 and pUL89 subunits (Champier et al., 2007, 2008) (Fig. 1). For both proteins, natural polymorphisms clustered mainly in 2 variable regions corresponding to codon ranges 393–485 and 778–848 for pUL56, and 249–283 and 663–673 for pUL89. Regarding pUL104 portal protein, natural polymorphisms clustered mainly in 3 distinct regions: codon ranges 240–300, 401–443, and 637–688 (Supplementary Table 3). The potential impact of CMV genotypic resistance profile to current DNA polymerase inhibitors on terminase complex polymorphism was investigated. As illustrated in Table 3, UL56, UL89, and UL104 sequence variations did not differ significantly between drug-sensitive and drug-resistant CMV strains, and no specific distribution according to drug susceptibility profile was evidenced by the phylogenetic analysis of the concatenated gene sequences (Fig. 2). Of note, the 3 newly described polymorphisms of pUL56 (G469D and H698Q) and pUL89 (A659V) were found in CMV strains resistant to DNA polymerase inhibitors (Fig. 1). This work aimed to describe extensively the natural polymorphism of CMV terminase complex, a promising target for novel antiviral drugs. Our results obtained from 63 CMV clinical strains demonstrated a very high level of conservation of UL56, UL89, and UL104 sequences. The weak variability of CMV terminase complex observed in this study (>97.7% interstrain identity at both nucleotide and amino acid levels) is similar to the ones previously reported for viral targets of current anti-CMV drugs, i.e., UL97 phosphotransferase and UL54 DNA polymerase (Boutolleau et al., 2011; Chou et al., 1999; Fillet et al., 2004). In this study, 18/41 and 6/10 amino acid changes within pUL56 and pUL89 subunits, respectively, were previously reported in CMV strains from patients who never received terminase inhibitors (Champier et al., 2007, 2008). Furthermore, among the remaining 27 changes newly described in this study, all but 3 were located outside the conserved regions of the viral proteins: G649D, H698Q, and A659V changes were located in regions IX and X of pUL56, and in region XII of pUL89, respectively (Fig. 1). However, other natural polymorphisms have been previously described in these domains (Champier et al., 2007, 2008). The localization of polymorphisms throughout pUL56 and pUL89 is similar to what was previously reported, confirming the existence of hypervariable regions in CMV terminase subunits (Champier et al., 2007, 2008). Moreover, the similar natural polymorphism of CMV terminase complex reported in this study among both drug-sensitive and drug-resistant clinical strains supports the idea that CMV terminase inhibitors should exert an antiviral activity against both types of CMV strains. Therefore, letermovir could constitute an efficient alternative anti-CMV strategy to currently approved drugs (Marschall et al., 2012).

11

Fig. 2. Phylogenetic analysis of concatenated UL89, UL56, and UL104 gene sequences. CMV full-length UL56, UL89, and UL104 gene sequences were concatenated head-to-tail to form a super-gene alignment and the phylogenetic tree was then constructed by the use of the neighbor-joining method using MEGA 4Ò program. Scale represents the number of nucleotide substitutions per site (bottom). The genotypic resistance profile of CMV clinical strains to DNA polymerase inhibitors is indicated as follows: S for susceptibility, and R (framed) for resistance.

12

L. Pilorgé et al. / Antiviral Research 111 (2014) 8–12

Seven mutations conferring resistance to letermovir have been recently reported within codon range 230–370 of pUL56 (Fig. 1A) (Goldner et al., 2014). It is noteworthy that 2 of them (L241P and C325Y) are located close to polymorphisms previously reported: D242G and A327V (Champier et al., 2008). This phenomenon of vicinity of resistance and natural polymorphisms has been previously reported for CMV UL97 phosphotransferase (Boutolleau et al., 2011). The data on pUL104 natural polymorphism, provided for the first time in the present work, may be useful for studies concerning compounds targeting CMV terminase. It is noteworthy that besides the 2 genuine terminase subunits pUL56 and pUL89 and the portal protein pUL104, at least 4 additional CMV proteins may contribute to the cleavage/packaging of viral genomes: pUL51, pUL52, pUL77, and pUL93 (Borst et al., 2008, 2013). Further studies are therefore required to improve our knowledge concerning the natural polymorphism of these viral proteins. In conclusion, this work enabled to extend the catalog of CMV terminase complex natural polymorphisms, and may provide therefore a useful basis for the monitoring of CMV genotypic resistance to the different potential compounds that inhibit the cleavage/packaging of viral genomes achieved by the CMV terminase complex, including the promising inhibitor letermovir. Acknowledgements This work was supported in part by the Association pour la Recherche sur les Infections Virales (ARIV). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.antiviral.2014.08. 014. References Bogner, E., 2002. Human cytomegalovirus terminase as a target for antiviral chemotherapy. Rev. Med. Virol. 12, 115–127. Borst, E.M., Wagner, K., Binz, A., Sodeik, B., Messerle, M., 2008. The essential human cytomegalovirus gene UL52 is required for cleavage-packaging of the viral genome. J. Virol. 82, 2065–2078. Borst, E.M., Kleine-Albers, J., Gabaev, I., Babic, M., Wagner, K., Binz, A., Degenhardt, I., Kalesse, M., Jonjic, S., Bauerfeind, R., Messerle, M., 2013. The human cytomegalovirus UL51 protein is essential for viral genome cleavagepackaging and interacts with the terminase subunits pUL56 and pUL89. J. Virol. 87, 1720–1732. Boutolleau, D., Deback, C., Bressollette-Bodin, C., Varnous, S., Dhedin, N., Barrou, B., Vernant, J.P., Gandjbakhch, I., Imbert-Marcille, B.M., Agut, H., 2009. Resistance pattern of cytomegalovirus (CMV) after oral valganciclovir therapy in transplant recipients at high-risk for CMV infection. Antiviral Res. 81, 174–179. Boutolleau, D., Burrel, S., Agut, H., 2011. Genotypic characterization of human cytomegalovirus UL97 phosphotransferase natural polymorphism in the era of ganciclovir and maribavir. Antiviral Res. 91, 32–35. Champier, G., Hantz, S., Couvreux, A., Stuppfler, S., Mazeron, M.C., Bouaziz, S., Denis, F., Alain, S., 2007. New functional domains of human cytomegalovirus pUL89 predicted by sequence analysis and three-dimensional modeling of the catalytic site DEXDc. Antivir. Ther. 12, 217–232.

Champier, G., Couvreux, A., Hantz, S., Rametti, A., Mazeron, M.C., Bouaziz, S., Denis, F., Alain, S., 2008. Putative functional domains of human cytomegalovirus pUL56 involved in dimerization and benzimidazole D-ribonucleoside activity. Antivir. Ther. 13, 643–654. Chemaly, R.F., Ullmann, A.J., Stoelben, S., Richard, M.P., Bornhäuser, M., Groth, C., Einsele, H., Silverman, M., Mullane, K.M., Brown, J., Nowak, H., Kölling, K., Stobernack, H.P., Lischka, P., Zimmermann, H., Rübsamen-Schaeff, H., Champlin, R.E., Ehninger, G., AIC246 Study Team, 2004. Letermovir for cytomegalovirus prophylaxis in hematopoietic-cell transplantation. N. Engl. J. Med. 370, 1781– 1789. Chou, S., Lurain, N.S., Weinberg, A., Cai, G.Y., Sharma, P.L., Crumpacker, C.S., Adult AIDS Trials Group CMV Laboratories, 1999. Interstrain variation in the human cytomegalovirus DNA polymerase sequence and its effect on genotypic diagnosis of antiviral drug resistance. Antimicrob. Agents Chemother. 43, 1500–1502. Dittmer, A., Drach, J.C., Townsend, L.B., Fischer, A., Bogner, E., 2005. Interaction of the putative cytomegalovirus portal protein pUL104 with the large terminase subunit pUL56 and its inhibition by benzimidazole-D-ribonucleosides. J. Virol. 79, 14660–14667. Fillet, A.M., Auray, L., Alain, S., Gourlain, S., Imbert, B.M., Najioullah, F., Champier, G., Gouarin, S., Carquin, J., Houhou, N., Garrigue, I., Ducancelle, A., Thouvenot, D., Mazeron, M.C., 2004. Natural polymorphism of cytomegalovirus DNA polymerase lies in two nonconserved regions located between domains deltaC and II and between III and I. Antimicrob. Agents Chemother. 48, 1865–1868. Goldner, T., Hewlett, G., Ettischer, N., Ruebsamen-Schaeff, H., Zimmermann, H., Lischka, P., 2011. The novel anticytomegalovirus compound AIC246 (Letermovir) inhibits human cytomegalovirus replication through a specific antiviral mechanism that involves the viral terminase. J. Virol. 85, 10884– 10893. Goldner, T., Hempel, C., Ruebsamen-Schaeff, H., Zimmermann, H., Lischka, P., 2014. Geno- and phenotypic characterization of human cytomegalovirus mutants selected in vitro after letermovir (AIC246) exposure. Antimicrob. Agents Chemother. 58, 610–613. Kaul, D.R., Stoelben, S., Cober, E., Ojo, T., Sandusky, E., Lischka, P., Zimmermann, H., Ruebsamen-Schaeff, H., 2001. First report of successful treatment of multidrugresistant cytomegalovirus disease with the novel anti-CMV compound AIC246. Am. J. Transplant. 11, 1079–1084. Komazin, G., Townsend, L.B., Drach, J.C., 2004. Role of a mutation in human cytomegalovirus gene UL104 in resistance to benzimidazole ribonucleosides. J. Virol. 78, 710–715. Krosky, P.M., Underwood, M.R., Turk, S.R., Feng, K.W., Jai, R.K., Ptak, R.G., Westerman, A.C., Biron, K.K., Towsend, L.B., Drach, J.C., 1998. Resistance of human cytomegalovirus to benzimidazole ribonucleosides maps to two open reading frames: UL89 and UL56. J. Virol. 72, 4721–4728. Lischka, P., Zimmermann, H., 2008. Antiviral strategies to combat cytomegalovirus infections in transplant recipients. Curr. Opin. Pharmacol. 8, 541–548. Lischka, P., Hewlett, G., Wunberg, T., Baumeister, J., Paulsen, D., Goldner, T., Ruebsamen-Schaeff, H., Zimmermann, H., 2010. In vitro and in vivo activities of the novel anticytomegalovirus compound AIC246. Antimicrob. Agents Chemother. 54, 1290–1297. Lurain, N.S., Chou, S., 2010. Antiviral drug resistance of human cytomegalovirus. Clin. Microbiol. Rev. 23, 689–712. Marschall, M., Stamminger, T., Urban, A., Wildum, S., Ruebsamen-Schaeff, H., Zimmermann, H., Lischka, P., 2012. In vitro evaluation of the activities of the novel anticytomegalovirus compound AIC246 (Letermovir) against herpesviruses and other human pathogenic viruses. Antimicrob. Agents Chemother. 56, 1135–1137. Reefschlaeger, J., Bender, W., Hallenberger, S., Weber, O., Eckenberg, P., Goldmann, S., Haerter, M., Buerger, I., Trappe, J., Herrington, J.A., Haebich, D., RuebsamenWaigmann, H., 2001. Novel non-nucleoside inhibitors of cytomegaloviruses (BAY 38-4766): in vitro and in vivo antiviral activity and mechanism of action. J. Antimicrob. Chemother. 48, 757–767. Stoelben, S., Arns, W., Renders, L., Hummel, J., Mühlfeld, A., Stangl, M., Fischereder, M., Gwinner, W., Suwelack, B., Witzke, O., Dürr, M., Beelen, D., Michel, D., Lischka, P., Zimmermann, H., Ruebsamen-Schaeff, H., Budde, K., 2014. Preemptive treatment of cytomegalovirus infection in kidney transplant recipients with letermovir: results of a phase 2a study. Transpl. Int. 27, 77–86.