Human megakaryocytes confer tissue factor to a subset of shed platelets to stimulate thrombin generation.

1

Platelets and Blood Cells

Human megakaryocytes confer tissue factor to a subset of shed platelets to stimulate thrombin generation Marta Brambilla1*; Laura Facchinetti1*; Paola Canzano1; Laura Rossetti1; Nicola Ferri2,3; Alessandra Balduini4; Vittorio Abbonante4; Daniela Boselli1; Luigi De Marco5; Matteo N. D. Di Minno6; Vincenzo Toschi7; Alberto Corsini2,3; Elena Tremoli1,2; Marina Camera1,2 1Centro

Cardiologico Monzino IRCCS, Milan, Italy; 2Department of Pharmacological and Biomolecular Sciences, Università degli Studi di Milano, Milan, Italy; 3Multimedia IRCCS, Milan Italy; 4Department of Molecular Medicine, University of Pavia, IRCCS Policlinico San Matteo Foundation, Pavia, Italy; 5Centro di Riferimento Oncologico, Aviano, Italy; 6Department of Clinical and Experimental Medicine, Federico II University, Naples, Italy; 7Division of Haematology and Blood Transfusion and Thrombosis Centre, AO Ospedale San Carlo Borromeo, Milan, Italy

Summary Tissue factor (TF), the main activator of the blood coagulation cascade, has been shown to be expressed by platelets. Despite the evidence that both megakaryocytes and platelets express TF mRNA, and that platelets can make de novo protein synthesis, the main mechanism thought to be responsible for the presence of TF within platelets is through the uptake of TF positive microparticles. In this study we assessed 1) whether human megakaryocytes synthesise TF and transfer it to platelets and 2) the contribution of platelet-TF to the platelet hemostatic capacity. In order to avoid the cross-talk with circulating microparticles, we took advantage from an in vitro cultured megakaryoblastic cell line (Meg-01) able to differentiate into megakaryocytes releasing platelet-like particles. We show that functionally active TF is expressed in human megakaryoblasts, increased in megakaryocytes, and is transferred to a subset of shed platelets where it contributes to Correspondence to: Marina Camera, Ph.D. Department of Pharmacological and Biomolecular Sciences Università degli Studi di Milano Via Balzaretti 9, 20133 Milan, Italy Tel. : +39 02 58 00 22 55, Fax: +39 02 58 00 23 42 E-mail: [email protected], [email protected]

clot formation. These data were all confirmed in human CD34posderived megakaryocytes and in their released platelets. The effect of TF silencing in Meg-megakaryoblasts resulted in a significant reduction of TF expression in these cells and also in Meg-megakaryocytes and Meg-platelets. Moreover, the contribution of platelet-TF to the platelet hemostatic capacity was highlighted by the significant delay in the kinetic of thrombin formation observed in platelets released by TF-silenced megakaryocytes. These findings provide evidences that TF is an endogenously synthesised protein that characterises megakaryocyte maturation and that it is transferred to a subset of newly-released platelets where it is functionally active and able to trigger thrombin generation.

Keywords Megakaryocytes, platelets, tissue factor, thrombin generation Financial support: This work was supported by the Fondazione Monzino (grant 2012–2013 to M. C.), and by a grant from Italian Ministry of Health (grant Ricerca Corrente 2013 to E. T. and M. C.). Received: October 4, 2014 Accepted after major revision: April 11, 2015 Epub ahead of print: June 11, 2015 http://dx.doi.org/10.1160/TH14-10-0830 Thromb Haemost 2015; 114: ■■■

* These authors contributed equally to this article.

Introduction At the end of the last century it was reported that, under physiological conditions, tissue factor (TF)-positive microparticles (MPs) circulate in the blood (blood-borne TF) and their number further increases in pathological conditions (1–3). These TF-positive MPs, which arise mainly from activated endothelial cells and monocytes, could fuse with other cells, including platelets (4), conferring on them the ability to activate coagulation (5, 6). Different research groups characterised TF in platelets by using various methodologies (confocal and electron microscopy, ELISA, Western blotting, flow cytometry, functional activity assays) (5, 7–12) and it was also shown that its expression increases in pathological conditions such as coronary artery disease, diabetes, essential thrombocitemia and cancer (12–15).

To date two main “cellular entities” may be responsible for the presence of TF in platelets: TF-positive MPs derived from different activated cell types, as previously mentioned (4), and megakaryocytes which may provide TF mRNA to platelets making them autonomous in the synthesis of the protein (9–11). In this regard, ten years ago we provided the evidence that human megakaryocytes contain TF mRNA (9). The proof of the transfer of TF mRNA from megakaryocytes to platelets is, however, still missing. Here we present for the first time the direct evidence that megakaryocytes transfer TF mRNA and protein to platelets and that platelet TF actively contributes to clot formation. To test these hypotheses we made use of a human megakaryoblastic cell line, Meg-01, which is enabled to differentiate into megakaryocytes (Meg-megakaryocytes) and to release platelets (Meg-platelets) in vitro (16). This approach allowed us to analyse

© Schattauer 2015

Thrombosis and Haemostasis 114.3/2015 Downloaded from www.thrombosis-online.com on 2015-06-15 | ID: 1000480351 | IP: 130.179.16.201 Note: Uncorrected proof, epub ahead of print online For personal or educational use only. No other uses without permission. All rights reserved.

2

Brambilla, Facchinetti et al. TF in human megakaryocytes and platelets

TF mRNA and protein expression during the differentiation from megakaryoblasts to megakaryocytes and in the released platelets in the complete absence of any other “contaminating” cell which might otherwise have been a source of MPs. Of note, the expression of TF protein by Meg-megakaryocytes and Meg-platelets was confirmed in human CD34pos-derived megakaryocytes and platelets, indicating that TF expression documented in Meg-01 cells is not a feature of the transformed cell line, but reflected a mechanism occurring in physiological conditions. Finally, the effect of TF silencing in Meg-megakaryoblasts resulted in a significant reduction of TF expression in these cells and also in Megmegakaryocytes and Meg-platelets, unequivocally demonstrating the presence of this protein in megakaryocytes and platelets and highlighting the contribution of platelet-TF to the global platelet haemostatic capacity.

Materials and methods Detailed methods are provided in the Suppl. Material (available online at www.thrombosis-online.com).

Meg-01 cell culture The human megakaryoblastic cell line Meg-01 was purchased from the American Type Culture Collection (Manassas, VA, USA) and cultured in RPMI 1640 with 10 % FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, at 37 °C in a 5 % CO2 humidified atmosphere as previously described (16).

Human cord blood-derived megakaryocytes Human cord blood was collected following normal pregnancies and deliveries upon informed consent of the parents, in accordance with the ethical committee of the IRCCS Policlinico San Matteo Foundation and the principles of the Declaration of Helsinki. CD34pos-cells were separated and cultured as previously described (17).

Assessment of the functional capacity of Megplatelets Thromboelastometry (ROTEM) Thrombelastometry was performed with the ROTEM coagulation analyse r (Tem International GmbH, Munich, Germany). Briefly, 300 µl of platelet-depleted blood or platelet-poor plasma (PPP), prepared as described in the Suppl. Material (available online at www.thrombosis-online.com), were reconstituted with 200,000 Meg-platelets (shRNA NegCTRL- or shRNA TF–silenced platelets)/µl or with 200,000 autologous human platelets/µl. All measurements were performed at 37 °C after recalcification of the samples with 20 µl of 0.2M CaCl2, according to the manufacturer’s instructions.

Thrombin generation assay Samples were solubilised with 15 mM octyl-β-D-glycopyranoside at 37 °C for 10 minutes (min), diluted with 25 mM HEPES–saline buffer (β-octyl-Hepes buffer) and tested for their capacity to promote thrombin generation using the Calibrated Automated Thrombogram (CAT) assay. Twenty µl of cell sample (1,300 Megmegakaryoblasts, Meg-megakaryocytes, CD34pos-MK/µl or 50,000 Meg-platelets/µl) were incubated for 10 min with 20 µl of plateletfree normal pooled plasma (Pool Norm) in round-bottomed 96-well microtitre plates (Immulon 2HB, Thermo LabSystems Inc, Beverly, MA, USA). To assess TF dependent contribution to thrombin generation, the CAT assay was performed after pre-incubation of cell samples with a neutralising anti-TF antibody (AD4501, 100 µg/ml final concentration selected on the basis of dose-finding experiments) or in the presence of FVII- and FXdeficient plasma (STA®-deficient VII and STA®-deficient X, Diagnostica Stago, Asnieres, France). Thrombin generation was started by the addition of a CaCl2/fluorogenic substrate mixture (FluCa Kit, Diagnostica Stago) and fluorescence was read for 60 min in a Fluoroskan Ascent® reader (Thermo Labsystems Inc) equipped with a 390/460 filter set. In order to correct for inner filter effects and substrate consumption, each thrombin generation measurement was calibrated against the fluorescence curve obtained in the same sample to which a fixed amount of thrombin-α2-macroglobulin complex was added (Thrombin Calibrator). Thrombin generation curves were analysed by dedicated software (Thrombinoscope BV, Maastricht, The Netherlands). Lag time (min), Peak height (nM Thrombin), Endogenous Thrombin Potential (ETP, nM Thrombin*min) and Time-to-Peak (ttPeak, min) were used as main parameters describing thrombin generation.

shRNA knockdown of tissue factor in Meg-01 cells The GIPZ lentiviral vectors are characterised by a bicistronic transcript containing turboGFP and shRNAmir, allowing the visual marking of shRNAmir. For infection, three different target vectors were utilised: clone ID V2LHS_151505 target sequence CTGTTATTACCATTAGCAT (shTF505); clone ID V3LHS_371301 target sequence AAGTCTACACTGTTCAAAT (shTF301) and clone ID V3LHC_410106 target sequence: TGGAGAGCTACTGCAAATGCT (shTF106). Scrambled lentiviral particles were used as control (shRNA NegCTRL). For infection Megmegakaryoblasts were seeded into a 25 cm2 flask and incubated for 48 hours (h) with viral particles diluted into growth media (1:200). After 48 h, transduced cells were selected with medium containing puromycin (10 µg/ml) using, as selection end point, the enrichment of GFP positive cells up to 95–100 %, determined by FACS analysis, and elimination of all MEG-01 cells from an non-transduced control culture as selection end points.

Statistical analysis Data are expressed as the means ± SD. Differences between group were analysed by Student’s paired t-test (SPSS statistical package,

Thrombosis and Haemostasis 114.3/2015

© Schattauer 2015

Downloaded from www.thrombosis-online.com on 2015-06-15 | ID: 1000480351 | IP: 130.179.16.201 Note: Uncorrected proof, epub ahead of print online For personal or educational use only. No other uses without permission. All rights reserved.


Chicago, IL, USA). Differences were considered significant for p< 0.05.

Results Meg-megakaryocytes release functionally active platelets We first verified that the cell system and the experimental conditions we used produced cells with the characteristics closest to human megakaryocytes and that the released Meg-platelets were functionally active. Meg-01 megakaryoblasts proliferate as single-cell suspension (16). Treatment of Meg-01 megakaryoblasts with valproic acid induced cell differentiation that resulted in cell adhesion with acquisition of the characteristic phenotype of megakaryocytes such as polyploidy with a prevalence of the 8n chromosome content (▶ Figure 1 A-B) and expression of population markers such as GpIIb, GpIIIa (▶ Figure 1 C-D), and von Willebrand Factor (▶ Figure 1 D), in agreement with previously published data (18). The emission of proplatelets (▶ Figure 1 D) preceded platelet release which occurred in a constant manner during culture (10 ± 3×106 platelets/1×106 megakaryocytes/day; Suppl. Figure 1, avail-

able online at www.thrombosis-online.com). Flow cytometry analysis showed that the physical (side and forward scatter) and the antigenic (GpIb, GpIIb, GpIIIa, α2β1, GpVI) properties of Megplatelets were remarkably similar to those of human circulating platelets (▶ Figure 2 A). GpIb, GpIIb, GpIIIa, α2β1, GpVI expression in Meg-platelets was modulated by thrombin receptor activating peptide (TRAP-6) similar to what occurs in human platelets (▶ Figure 2 B). In addition, Meg-platelets adhere to fibrinogen (▶ Figure 2 C), aggregate in response to TRAP-6 and collagen (▶ Figure 2 D) and, when used to reconstitute a platelet-depleted whole blood, their haemostatic capacity assessed by PFA-100 system was comparable to that obtained with whole blood (▶ Figure 2 E). Thus, in our experimental conditions, we show that Meg-platelets are functionally active.

Meg-megakaryoblasts and Meg-megakaryocytes express TF mRNA and protein Then, using different approaches we assessed TF mRNA and protein expression and function in Meg-megakaryoblasts and Megmegakaryocytes. TF mRNA was detected by quantitative real-time PCR in Megmegakaryocytes, a result which supports our previous findings in

Figure 1: Characterisation of cultured Megmegakaryocytes. A) Meg-megakaryocytes differentiated upon treatment of Meg-megakaryoblasts with valproic acid (VPA, 2 mM) for 10 days show the typical multinucleated morphology. Representative phase contrast micrograph acquired with a AxioObserver Z.1 microscope equipped with LD Plan-NEOFLUAR 40x/0.6 objective, AxioCam MRm camera and AxioVision 4.7 software (Carl Zeiss). Scale bar=20 µm. B) Polyploidy assessment in Meg-megakaryocytes. Cells were harvested, ethanol (70 %) fixed overnight at –20 °C, stained with propidium iodide followed by flow cytometry analysis as described in Suppl. Methods (available online at www.thrombosis-online.com). The histogram of polyploidy evaluation is representative of three independent experiments. C) Evaluation of GpIIb and GpIIIa surface expression in Meg-megakaryocytes by flow cytometry. Representative analysis of Meg-megakaryocytes stained with mouse anti-human CD41 (GpIIb) and CD61 (GpIIIa) antibodies. D) Evaluation of GpIIIa and vWF expression in Meg-megakaryocytes by immunocytochemistry. Staining was performed on permeabilised Meg-megakaryocytes to visualise both cell surface and intracellular pools of the proteins. After labelling with specific antibodies, samples were analysed with a LSM710 Confocal microscope equipped with 63x/1.4 Plan-Apochromat oil-immersion objective and with ZEN2011 software (Carl Zeiss). Scale bar=20 µm.

© Schattauer 2015


3

4


Figure 2: Characterisation of the physical, antigenic and functional properties of in vitro released Meg-platelets. A) The physical properties (side and forward scatter, SSC and FSC) of Meg-platelets released in vitro are virtually identical to those of human platelets in a platelet-rich plasma. Histograms represent flow cytometry evaluation of GpIb, GpIIb, GpIIIa, α2β1 and GpVI expression in Meg- and human platelets. Data are means ± SD (n=7). B) Modulation of GpIb, GpIIb, GpIIIa, α2β1 and GpVI expression in Megplatelets and in human platelets. The histograms show the expression levels of GpIb, GpIIb, GpIIIa, α2β1 and GpVI in Meg-platelets and in human platelets both under resting conditions and upon TRAP-6 stimulation. Data are means ± SD (n=7). C, Representative image of Meg-platelet spreading onto fibrinogen-coated glass surface upon stimulation with TRAP-6 (25 µM, n=3).

Picture was taken with a LSM710 Confocal microscope equipped with a DIC 63x/1.4 Plan APOCHROMAT oil-immersion objective and with ZEN2011 software. Scale bar=50 µm. D) Representative aggregation curves of Megplatelets stimulated with TRAP-6 or collagen in the presence of 40 mg/ml fibrinogen. The changes in optical density indicative of platelet aggregation were recorded for 6 min with ChronoLog model 490 (n=3). The picture shows aggregates at the end of the assay. E) Haemostatic capacity of plateletdepleted whole blood reconstituted with autologous platelets or with Megplatelets assessed by PFA-100® system. Closure Time of whole blood and platelet-depleted whole blood were used for comparison. Data are means ± SD (n=3).

human megakaryocytes (9). Notably, TF mRNA was expressed also in Meg-megakaryoblasts, albeit at lower levels, and its expression gradually increased (three-fold) during differentiation (1 ± 0.05 and 3.15 ± 0.25 in Meg-megakaryoblasts and Meg-megakaryocytes respectively; ▶ Figure 3 A). The latter is a feature common to other transcripts, such as GpIIIa and ciclooxygenase-1, which showed an even much greater increase during differentiation (▶ Figure 3 B). TF protein, measured by ELISA, was significantly more abundant in Meg-megakaryocytes than in Meg-megakaryoblasts (90 ± 15 and 50 ± 10 pg/mg cell protein, respectively; ▶Figure 3C), in line with the PCR results. To better characterise TF distribution at the cellular level, TF surface and intracellular localisation was analysed by flow cyto-

metry. TF was present on the surface of ~45 % of Meg-megakaryoblasts and ~70 % of Meg-megakaryocytes; when analysed intracellularly, ~65 % of Meg-megakaryoblasts and ~85 % of Megmegakaryocytes were TF-positive. Saturation of the antibody with recombinant TF protein before labelling completely abolished the staining, confirming the specificity of the antibody (▶ Figure 3 D and Suppl. Figure 2, available online at www.thrombosis-online. com). In order to assess whether TF expressed by Meg-megakaryoblasts and Meg-megakaryocytes was functionally active we performed the thrombin generation assay. The procoagulant capacity of Meg-megakaryocytes was significantly higher than that of Megmegakaryoblasts (Lag-Time: 10.8 ± 4 vs 18.5 ± 1.2 min; ETP: 1,683


© Schattauer 2015



Figure 3: TF is expressed in Meg-megakaryoblasts and in Meg-megakaryocytes. A) TF mRNA expression, evaluated by real-time PCR, in Megmegakaryoblasts and in Meg-megakaryocytes at five and 10 days of differentiation with VPA. Histograms represent the fold change increase of TF mRNA expression in Meg-megakaryocytes compared to Meg-megakaryoblasts arbitrarily set to 1 (n=3 RNA extractions from independent experiments). B) Comparison of the relative amounts of TF, GpIIIa and COX-1 mRNAs in Meg-megakaryoblasts and Meg-megakaryocytes at 10 days differentiation with VPA (setting to 1 the expression of each gene in megakaryoblasts; n=5 RNA extractions from independent experiments). C) TF protein level assessed by ELISA in Meg-megakaryoblasts and Meg-megakaryocytes at 10 days differentiation with VPA (n=5). D) Flow cytometry evaluation of

surface and intracellular (IC) TF expression (n=11). Cells were stained with mAb TF4509 labelled with Alexa Fluor® 488. IC labelling was also performed upon saturation of the antibody with recombinant TF protein (IC+AgSatAbTF; n=4). E) Cell lysates of Meg-megakaryoblasts and Meg-megakaryocytes were assessed for the thrombin generation capacity by the calibrated automated thrombogram (CAT) assay performed in the absence and in the presence of 100 µg/ml neutralising anti-TF antibody. Curves generated in a representative experiment are shown. Histograms show the effect of a neutralizing anti-TF antibody on the Lag-time and on the Time-to-Peak of Megmegakaryoblasts and Meg-megakaryocytes (setting to 100 the mean values of the respective parameter). Data are means ± SD (n=5).

© Schattauer 2015


5

6


± 106 vs 1,283 ± 71 nM*min; Peak: 191 ± 58 vs 131 ± 16 nM; Time-To-Peak: 15.2 ± 2 vs 23 ± 0.8 min, respectively; p< 0.05 for all comparisons). The contribution of cell associated-TF to the kinetic of thrombin generation was assessed performing CAT assay with cell lysates pre-incubated with a neutralising anti-TF antibody. In this experimental conditions, a delay in the kinetic of thrombin generation was recorded, accounting for a TF contribution of ~50 % and ~75 % (both for Lag-time and Time-to-peak) in Megmegakaryoblasts and Meg-megakaryocytes, respectively (▶ Figure 3 E). As expected, no effect was observed on the total amount of thrombin generated since, as previously shown, TF contributes to the initiation of blood coagulation without affecting the amplification of thrombin generation (19). All these data confirm the presence of TF in Meg-megakaryocytes. They also support the concept that during megakaryocyte differentiation an increase of both the mRNA and the functionally active TF expression occurs. This feature is independent of the differentiating agent as it was also observed in Meg-01 differentiated with thrombopoietin (Suppl. Figure 3, available online at www. thrombosis-online.com).

Human platelets have been previously shown to contain TF pre-mRNA and mature mRNA which can be used to make de novo protein synthesis (9–11). By RT-PCR both types of TF RNAs were detected in Meg-platelets, the pre-mRNA being the most abundant of the two (▶ Figure 4 D). Taking advantage of the SmartFlare™ RNA detection probes, we found that TF pre-mRNA and mRNA were present in 32.8 ± 10.9 % and 17 ± 7.2 % Meg-platelets (Suppl. Figure 7, available online at www.thrombosis-online.com). Of interest, when the expression of the two RNA species was studied among the TF antigen positive and negative Meg-platelets, we observed that they were mainly present in the TF antigen negative Meg-platelets (▶ Figure 4E). Unfortunately, due to the limited number of fluorochromes so far available with the SmartFlare™ technology, the colocalisation of the TF pre-mRNA and mRNA in the single cell is not possible at present. Taken together these data suggest that TF protein and transcripts are transferred from megakaryocytes to different subset of platelets.

Meg-megakaryocytes transfer TF mRNA and protein to a subset of shed platelets

To confirm that TF expression documented in Meg-01 was not a feature of the transformed cell line, but reflected a mechanism occurring in physiological conditions, we analysed TF expression in human CD34pos-derived megakaryocytes (CD34pos-MK) and in their released platelets (CD34pos-platelets). TF distribution in CD34pos-MK, assessed by immunocytochemistry (▶ Figure 5 A and Suppl. Figure 8, available online at www.thrombosis-online. com) and flow cytometry (▶ Figure 5 B), was similar to that measured in Meg-megakaryocytes (see ▶ Figure 4 A and ▶ Figure 3 D, respectively). This was paralleled by an amount of TF protein (124 ± 27 pg/mg protein, by ELISA) and a thrombin generation capacity (▶ Figure 5 C) comparable in the two cell systems (see ▶Figure 3E). Finally, flow cytometry analysis of the intracellular TF expression in CD34pos-platelets showed a distribution as in Meg-platelets (▶ Figure 5 D). Comprehensively, these data further support our proposed mechanisms of TF transfer from megakaryocytes to platelets.

Immunostaining and confocal microscopy analysis performed in Meg-megakaryocytes showed that TF was present both in the cell body as well as in the proplatelet tips (▶ Figure 4 A, Suppl. Video 1, available online at www.thrombosis-online.com). Specificity of the TF 4509 antibody used was confirmed by staining with antihuman TF9–10H10 antibody which gave a similar pattern of distribution (Suppl. Figure 4, available online at www.thrombosisonline.com). In order to verify whether this localisation could support the concept of a transfer of TF from megakaryocytes to nascent platelets, we evaluated TF expression in Meg-platelets. Flow cytometry analysis showed that TF was indeed detectable in the cytoplasm of ~40 % of Meg-platelets (▶ Figure 4 B), thus suggesting that the protein is transferred from Meg-megakaryocytes to a subset of platelets. Similar data were obtained when staining was performed with anti-human TF9–10H10 antibody (Suppl. Figure 5, available online at www.thrombosis-online.com). These data reflect well the in vivo condition in humans where the percentage of TF-positive platelets, assessed by intracellular staining, amounts to ~30–35 % (▶ Figure 4 B). The experimental protocol used to perform TF intracellular staining in human blood (blood is fixed within a few minutes after withdrawl) rules out the possibility that de novo TF protein can take place in a so short time affecting the results. Assessment of the thrombin generation capacity of Meg-platelets, as well as of human platelets, showed that TF was functionally active and its contribution was significantly blunted by a neutralising anti-TF antibody (▶ Figure 4 C). Experiments performed with FVII- or FX-depleted plasma showed no thrombin generation, further supporting the key role of the Megplatelet associated TF (Suppl. Figure 6, available online at www. thrombosis-online.com).

CD34pos-derived megakaryocytes transfer TF to their released platelets

TF silencing in Meg-megakaryoblasts impairs TF antigen and activity expression in Meg-megakaryocytes and Meg-platelets In order to elucidate the contribution of platelet-TF to the platelet haemostatic capacity, we silenced TF in Meg-01 and assessed its expression and function in Meg-megakaryoblasts, Meg-megakaryocytes and Meg-platelets. Infection of Meg-01 with GIPZ lentiviral shRNA particles against human TF significantly reduced TF antigen expression by 70 % in the three Meg-megakaryoblast cell lines generated with three different target vectors (▶ Figure 6 A and Suppl. Figure 9, available online at www.thrombosis-online. com). The protein was hardly detectable by immunocytochemistry in Meg-megakaryocytes (▶ Figure 6 B) and this resulted in a negligible TF expression in the released Meg-platelets. Indeed, the percentage of TFpos platelets derived from shRNA NegCTRL megaka-


© Schattauer 2015



Figure 4: TF localised in the proplatelet tips of Meg-megakaryocytes is transferred to nascent platelets. A) Representative intracellular immunofluorescence staining and confocal microscopy analysis of TF expression in a Meg-megakaryocyte extending a proplatelet. TF was detected with mAb TF4509. Samples were analysed with a LSM710 Confocal microscope equipped with 63x/1.4 Plan-Apochromat oil-immersion objective and with ZEN2011 software (Carl Zeiss). Scale bar=20 µm. B) Flow cytometry evaluation of intracellular expression of TF in Meg-platelets and in human platelets. Platelets were fixed, permeabilised and stained with mAb TF4509 labelled with Alexa Fluor® 488. Representative dot plots of stained Megplatelets are reported: TF positive population was identified by using quadrant gates settled on the sample stained with mouse IgG labelled with Alexa Fluor® 488. The istograms showed the percentage of TF positive Megplatelets and human platelets; data are means ± SD (n=11). C) Thrombin

generation capacity of Meg-platelets and human platelets. Representative curves generated in a CAT assay are shown. Inhibition of thrombin formation after pre-incubation with a neutralising anti TF antibody (100 µg/ml) was calculated setting 100 the values of the the Lag-time and the Time-to-Peak of the untreated Meg-platelet samples Data are expressed as means ± SD (n=5; *p< 0,001 and #p< 0,02 vs untreated samples). D) TF pre-mRNA and TFmRNA expression, evaluated by RT-PCR, in Meg-megakaryocytes and in Meg-platelets. A representative gel analysis is shown. Bars represent the densitometric analysis of band intensity (Adj Vol, means ± SD) performed on four independent samples of each cell type. E) Single cell detection of TF premRNA and mRNA in Meg-platelets. Meg-platelets, incubated overnight with SmartFlareTM TF pre-mRNA and mRNA probes, were co-stained with mAb TF4509 labelled with Alexa Fluor® 488 and analysed by flow cytometry. Dot plots representative of five independent experiments are shown.

© Schattauer 2015


7

8


Figure 5: Characterisation of TF expression in CD34pos-MK and CD34pos-platelets. A) Representative intracellular immunofluorescence staining and confocal microscopy analysis of TF expression in a CD34pos-MK. TF was detected with mAb TF4509. Samples were analysed with a LSM710 Confocal microscope equipped with 63x/1.4 Plan-Apochromat oil-immersion objective and with ZEN2011 software (Carl Zeiss). Scale bar=20 µm. B) Surface and intracellular expression of TF in CD34pos-MK analysed by flow cytometry. Cells were 1 % paraformaldehyde fixed, permeabilised and stained

with mAb TF4509 labelled with Alexa Fluor® 488. Sample were acquired with a BD FACSCalibur (n=3). C) Thrombin generation capacity of CD34posMK. Representative curves generated in a CAT assay are shown. The effect of a neutralising anti-TF antibody on the Lag-time and on the Time-to-Peak are reported (n=3). D) Flow cytometry evaluation of intracellular expression of TF in CD34pos-platelets. The cells were stained with mAb TF4509 labelled with Alexa Fluor® 488 and then analysed with a BD FACSCalibur (n=3). The percentage of TF-positive platelets is similar to that observed in Meg-platelets.

ryocytes (40 ± 2.7 %) was almost abolished in shTF Meg-platelets (3.7 ± 1.1 %, p< 0.001; ▶ Figure 6 C). As a consequence of TF silencing, a significant increase in the kinetic of thrombin formation was observed: both the Lag-Time (▶ Figure 7 A-C) as well as the Time-to-peak (Suppl. Figure 10, available online at www.thrombosis-online.com) were significantly increased by 50 % and 60 % in Meg-megakaryoblasts and Meg-megakaryocytes, respectively. Similarly, the thrombin generation capacity of platelets released by TF-silenced Meg-megakaryocytes was significantly impaired (63 % increase in Lag-Time and 54 % increase in Time-to-peak) compared to that of platelets released by shRNA NegCTRL Meg-megakaryocytes. The residual

TF activity present in all the silenced cells was further consistently inhibited by the anti-TF antibody (▶ Figure 7 A-C). In order to assess the contribution of platelet-TF to the haemostatic capacity of blood we took advantage from thromboelastometry. shRNA TF-silenced platelets or shRNA NegCTRL-treated platelets were used to reconstitute platelet-depleted blood from healthy subjects. Samples were then recalcified in the Rotem coagulation analyse r and the dynamic of clot formation was monitored for 60 min. Blood samples containing shRNA TF-silenced platelets showed a reduced dynamic of clot formation as evidenced by a significantly increased clot formation time (CFT; +20 %), and reduced maximum clot firmness (MCF; -6 %) and alpha angle


© Schattauer 2015



Figure 6: Characterisation of TF expression in TF-silenced Megmegakaryoblasts, Meg-megakaryocytes and Meg-platelets. A) TF protein levels, assessed by ELISA, in wild-type Meg-megakaryoblasts (WT) and in Meg-megakaryoblasts infected with shRNA NegCTRL, shTF301, shTF106, shTF505 vectors (n=5). B) Representative intracellular immunofluorescence staining and confocal microscopy analysis of TF, green fluorescence protein (GFP) and nuclei of WT, shRNA NegCTRL- and shTF301-treated Meg-megakaryocytes. After labelling with specific antibodies samples were analysed

with a LSM710 Confocal microscope equipped with 63x/1.4 Plan-Apochromat oil-immersion objective and with ZEN2011 software (Carl Zeiss; n=5). Scale bar=20 µm. C) Representative flow cytometry evaluation of intracellular TF expression in Meg-platelets derived from shRNA NegCTRL- and shTF301-treated Meg-megakaryocytes. Meg-platelets were stained with mAb TF4509 labelled with Alexa Fluor® 633 and then analysed with a BD FACSCalibur.

© Schattauer 2015


9

10



© Schattauer 2015



(-18.6 %) (▶ Figure 7 D). The contribution of platelet-TF to the platelet haemostatic capacity was further highlighted when shRNA TF-silenced platelets were tested by thromboelastometric assays in a PPP (in order to mimic a platelet-rich plasma sample): a significantly increased CFT (+144 %) and reduced MCF (-9 %) and alpha angle (-34 %) were indeed observed.

Meg-megakaryocytes and Meg-platelets release TFpositive microparticles As previously stated, TF-positive MPs have been found in vivo (20, 21). Since both megakaryocytes and platelets release MPs (22), we characterised them for TF expression. Flow cytometry analysis showed that the majority (75 ± 7 %) of MPs released in the medium were from megakaryocytes (CD61pos/CD107aneg events; ▶ Figure 8 A-B). The TFpos MPs accounted for 18 ± 2 %, 13 ± 0.9 % being from megakaryocytes and 5 ± 0.4 % from platelets (▶ Figure 8 C). Conversely, TF expression on MPs derived from shTF silenced Meg-megakaryocytes was almost negligible (6.3 ± 0.5 %; ▶ Figure 8 D). Thus, these data suggest that circulating CD61pos/TFpos MPs may take up TF not only from activated endothelial cells and monocytes, but they also bring it directly from the parental cells (megakaryocytes and platelets).

Discussion Although the issue of platelet-associated TF has been a matter of controversy in the past (23–29), using the Meg-01 cell line, a well characterised in vitro model able to recapitulate human megakaryocyte differentiation and platelet biogenesis, here we provide unequivocal evidence that TF is an endogenously synthesised protein that characterises megakaryocyte maturation. Since the cell system used allowed us to study mRNA and protein expression in the absence of any crosstalk with other cells or MPs, we also provide the evidence for the direct transfer of TF mRNA and protein from megakaryocytes to a subset of platelets where it contributes to their thrombin generation capacity (▶ Figure 8 E). The same

Figure 7: Evaluation of TF contribution to the global haemostatic capacity. A-C) Thrombin generation capacity of TF-silenced Meg-megakaryoblasts, Meg-megakaryocytes and Meg-platelets was assessed by CAT assay and compared to that of WT and shRNA NegCTRL-treated samples. Representative curves are shown in left panels; the effect of TF-silencing and of a neutralising anti TF antibody on the Lag-time was calculated setting 100 the value obtained in wild-type Meg-megakaryoblasts, Meg-megakaryocytes and Meg-platelets. Data are means ± SD (*p< 0.005, **p< 0.003, n=4). D) Global platelet haemostatic capacity analysed by thromboelastometry. Representative thrombograms of platelet-depleted whole blood or plasma, reconstituted with shRNA NegCTRL- or shTF301-treated Meg-platelets are shown. Quantification of the haemostatic capacity was reported in the table (means ± SD; *p< 0.05, n=3). CT=clotting time; CFT=clot formation time; MCF=maximum clot firmness; α=alpha angle.

mechanism was observed also in human CD34pos-derived megakaryocytes and in their released platelets: this finding render us confident that the TF expression documented in Meg-01 cells truly reflects a mechanism occurring in physiological conditions, and is not a feature of the transformed cell line. In this regard, it is worth mentioning how Meg-platelets, in our experimental conditions, are phenotypically similar to circulating human platelets (expression of GpIb, GpIIb, GpIIIa, α2β1, GpVI, vWF), functionally active (adhesion to fibrinogen-coated surface and aggregation in response to TRAP-6 and collagen), and with a haemostatic capacity comparable to that of human platelets. In 2003 we first provided the evidence that human CD34posMK express TF mRNA, which was also present in human platelets (9). In the same year Gnatenko et al. reported the first characterisation of the human platelet transcriptome and studies showing the capacity of platelets to synthesise new proteins were also accumulating (30–33). With respect to this, in 2006 and 2007, two independent groups showed the ability of platelets to make TF de novo synthesis (10, 11). Despite these findings, it is still commonly believed that quiescent platelets contain TF pre-mRNA, but they do not contain TF mRNA or TF protein and the only mechanism responsible for the presence of TF in platelets is through the uptake of TF-positive MPs released mainly by activated monocytes (25). Although the microparticle-transfer mechanism may contribute to the presence of TF in platelets, the data here reported indicate that platelets also express TF (pre-mRNA, mRNA and protein) independently of the interaction with other cells, through a megakaryocyte-dependent mechanism which provides platelets with the capacity to control themselves the generation of thrombin. In addition, the in vitro culture system allowed us also to show that both megakaryocytes as well as platelets release TF positive MPs, dispelling the stereotypic viewpoint that only monocytes and endothelial cells may be the main source of TF positive MPs. TF pre-mRNA is the most abundant TF transcript species found in Meg-platelets by RT-PCR, but TF mRNA is also detectable. The presence of TF mRNA in platelets has been associated with platelet activation during isolation (25). Our group has a long-lasting experience in experimental manipulation of platelets. We use the appropriate inhibitors of platelet activation during cell separation and, more importantly, we always verify platelet activation and leucocyte contamination by flow cytometry in each single preparation. Our published data refer to results obtained from platelet preparations that meet the quality controls (9, 12, 23, 24). Based on the experience we gained in this specific area we are more likely to believe that a degree of variability exist among healthy subjects, which may account for variation in the amount of TF protein, pre-mRNA and mRNA detectable in platelets. This feature, on the other hand, should not be surprising given that variability in the expression of TF has also been previously reported for human monocytes (34). The results obtained with the SmartFlare™ RNA detection probes technology -that allows detection of RNA inside living cells- convincingly support our theory showing that a small percentage of Meg-platelets released in an unpertubed environment do contain the TF mRNA. Even more

© Schattauer 2015


11

12


Figure 8: Characterisation of TF expression in MPs derived from Meg-megakaryocytes and Meg-platelets. A) Physical properties (side and forward scatter, SSC and FSC) of MPs released in the medium by Meg-megakaryocytes and Meg-platelets analysed by flow cytometry. 1 µm calibrated beads were used to set the threshold size and to draw the MP gate. B) MPs were defined as VPD and CD61 positive events among the population gated in panel A. C-D) The expression of CD107a and TF was evaluated on MPs derived from cultures of shRNA NegCTRL- (C), and shTF301-treated (D), Megmegakaryoctes. CD107a positive MPs were from platelets, whereas CD107a negative MPs were from megakaryocytes. E) Schematic view summarising TF biosynthesis in human megakaryoblasts and megakaryocytes and its transfer to a subset of released platelets. TF is an endogenously synthesised protein that characterizes megakaryocyte maturation. In the absence of “contaminating” TF+ MPs coming from activated monocytes or endothelial cells, megakaryocytes can account for the presence of TF (pre-mRNA, mRNA and protein) in different subsets of platelets.

relevant is the finding that the majority of the TF antigen positive Meg-platelets are devoided of the TF RNA species. Our finding that the subset of TF positive platelets that we observe in vitro (both with Meg-platelets and with CD34pos-platelets) is so similar to what is found in human blood ex vivo is particularly fascinating. The latter circumstance sustains the hypothesis that a finely-tuned mechanism could be responsible for the controlled delivery of TF protein and TF RNAs from megakaryocytes to different subsets of platelets. This, however, deserves further in-

vestigations to elucidate the regulatory molecular pathways involved. This notion is of particular relevance in view of the observation that under pathological conditions, characterised by a high thrombotic risk, the number of TF positive platelets significantly increases (12–15). In this regard, we have previously shown a significantly higher amount of TF mRNA in platelets from patients with non-ST-elevation myocardial infarction (NSTEMI) compared to patients with stable angina or healthy subjects (12). Based on the considerations above, it is plausible that different amounts


© Schattauer 2015



of TF mRNA reflect a well-defined intrinsic condition of platelets and megakaryocytes, rather than a methodological artifact. Based on the mechanism here proposed, it is indeed possible to speculate that in those clinical settings alterations of megakaryocyte behavior may result in a higher number of TF-positive platelets released into the circulation or in a higher amount of TF transcript and protein provided to each single platelet. Altogether these events may influence the thrombotic risk, taking into account the contribution of platelet TF to the thrombin generation capacity. Indeed, when CAT experiments were performed in the presence of a specific neutralising anti-TF antibody or in the presence of FVIIor FX-deficient plasma TF contribution was significantly blunted. This mechanism may therefore represent a potential target for therapeutic intervention. Since under physiological conditions circulating TF is encrypted, i. e. non coagulant, it should also be pointed out that mechanisms leading to decryption, dithiol/disulfide switch and exposure of phosphatidylserine, may also take place under pathological conditions, affecting the global platelet prothrombotic capacity (35, 36). The selective delivery of TF to platelets fit particularly well with the concept of the heterogeneity of the platelet population released by megakaryocytes into the blood stream: different subsets of platelets are committed, by virtue of the transcriptome and proteome provided to them by megakaryocytes, to fulfill different functions. In this regard, Stalker et al. recently proposed a new model of thrombus formation, suggesting that the thrombus is not a homogeneous mass in which all platelets express the same activationspecific antigens (i. e. activated GpIIbIIa, P-selectin), but it is constituted by a core of fully activated platelets overlaid by a shell of less activated platelets (37). Interestingly, Palmerini et al. showed that in coronary thrombi isolated from patients with ST elevation myocardial infarction (STEMI) some platelet aggregates stained positive for tissue factor, whereas others did not (38). They also provided direct evidence that TF present in the coronary thrombi is functionally active, thus triggering the coagulation cascade that leads to coronary thrombosis. A major issue related to the finding of platelet-associated TF is the demonstration of its relative contribution to the in vivo thrombus formation. By taking advantage of a TF silencing approach, we developed three megakaryoblast cell lines stably under-expressing TF. This strategy allowed us to prove that 1) TF expression in silenced megakaryocytes and platelets and MPs derived from them is almost undetectable by flow cytometry as well as by immunocytochemistry, dispelling any doubt about the quality of the antibodies used to identify TF, which in the past was one of the most frequent criticisms raised in the TF dispute (26, 27, 29); 2) plateletassociated TF is functionally active and contributes to platelet thrombin generation since the kinetic of thrombin formation significantly increases in platelets released by silenced megakaryocytes. The contribution of platelet-TF to the haemostatic capacity of blood was assessed in thromboelastometry experiments. The data from latter experiments showed that silenced platelets added to platelet-depleted human blood slightly reduced, although significantly, the dynamics of clot formation compared to shRNA negative control-treated platelets. The contribution of platelet-TF

What is known about this topic?

• •

Tissue factor (TF), the key activator of the blood coagulation cascade, is expressed by circulating platelets. The main mechanism thought to be responsible for the presence of TF within platelets is through the uptake of TF-positive microparticles, despite the evidence that both megakaryocytes and platelets express TF mRNA, and that platelets can make de novo protein synthesis.

What does this paper add?

• • •

TF is an endogenously synthesised protein that characterises megakaryocyte maturation. In the absence of any crosstalk with other cells or microparticles a direct transfer of TF RNA species and protein from megakaryocytes to different subsets of platelets exists. The significant delay in the kinetic of thrombin formation observed in platelets released by TF-silenced megakaryocytes highlights the contribution of platelet-TF to the global platelet haemostatic capacity.

was further highlighted when the kinetic of clot formation was assessed by thromboelastometry in a platelet-rich plasma. It is worth mentioning that skepticism about the presence and the pathophysiological relevance of platelet TF has been also fostered in the past by the fact that TF detection in mouse platelets did not provide positive results (39). A few months ago Tyagi et al. published evidence that TF is expressed in rat platelets, and also that its expression is modulated by hypoxia, shedding some light on the mechanism of thrombosis induced by a high altitude, hypoxic environment (40). In conclusion, we provide strong evidence that platelets express TF independently of the interaction with other cells, and that platelets can also control the generation of thrombin contributing to both the initiation and propagation of the clotting cascade. TF is not the only coagulation factor present in platelets. Indeed, platelets contain several coagulation factors (FV, FVIII, FXI, FXIII, fibrinogen, vWF, TFPI, etc) which are promptly released on the cell surface upon platelet activation. It is important to note that for some of the coagulation factors (FV, FVIII, FXIII, TFPI, vWF) the presence of the corresponding mRNA has also been reported and this is of particular relevance in considering the biosynthetic capacity of platelets (41–43). Overall we believe that the three main mechanisms responsible for the presence of TF in platelets (MKtransfer mechanism, MP-transfer mechanism, de novo protein synthesis) are not mutually exclusive, and one mechanism may dominate over the other depending on the pathophysiologic conditions. Acknowledgments

We thank Dr. D.C. Cottell, Dr. P. Maderna, Dr. C. Banfi for helpful discussions on the manuscript and F. Villa and D. Talluri (Carl Zeiss S. p. A. Italy) for technical assistance.

© Schattauer 2015


13

14


Conflicts of interest

None declared.

References 1. Mallat Z, Benamer H, Hugel B, et al. Elevated levels of shed membrane microparticles with procoagulant potential in the peripheral circulating blood of patients with acute coronary syndromes. Circulation 2000; 101: 841–843. 2. Nieuwland R, Berckmans RJ, McGregor S, et al. Cellular origin and procoagulant properties of microparticles in meningococcal sepsis. Blood 2000; 95: 930–935. 3. Hughes M, Hayward CP, Warkentin TE, et al. Morphological analysis of microparticle generation in heparin-induced thrombocytopenia. Blood 2000; 96: 188–194. 4. Giesen PL, Rauch U, Bohrmann B, et al. Blood-borne tissue factor: another view of thrombosis. Proc Natl Acad Sci USA 1999; 96: 2311–2315. 5. Muller I, Klocke A, Alex M, et al. Intravascular tissue factor initiates coagulation via circulating microvesicles and platelets. FASEB J 2003; 17: 476–478. 6. Del Conde I, Shrimpton CN, Thiagarajan P, et al. Tissue-factor-bearing microvesicles arise from lipid rafts and fuse with activated platelets to initiate coagulation. Blood 2005; 106: 1604–1611. 7. Zillmann A, Luther T, Muller I, et al. Platelet-associated tissue factor contributes to the collagen-triggered activation of blood coagulation. Biochem Biophys Res Commun 2001; 281: 603–609. 8. Siddiqui FA, Desai H, Amirkhosravi A, et al. The presence and release of tissue factor from human platelets. Platelets 2002; 13: 247–253. 9. Camera M, Frigerio M, Toschi V, et al. Platelet activation induces cell-surface immunoreactive tissue factor expression, which is modulated differently by antiplatelet drugs. Arterioscl Thromb Vasc Biol 2003; 23: 1690–1696. 10. Schwertz H, Tolley ND, Foulks JM, et al. Signal-dependent splicing of tissue factor pre-mRNA modulates the thrombogenicity of human platelets. J Exp Med 2006; 203: 2433–2440. 11. Panes O, Matus V, Saez CG, et al. Human platelets synthesize and express functional tissue factor. Blood 2007; 109: 5242–5250. 12. Brambilla M, Camera M, Colnago D, et al. Tissue factor in patients with acute coronary syndromes: expression in platelets, leukocytes, and platelet-leukocyte aggregates. Arterioscl Thromb Vasc Biol 2008; 28: 947–953. 13. Gerrits AJ, Koekman CA, van Haeften TW, et al. Platelet tissue factor synthesis in type 2 diabetic patients is resistant to inhibition by insulin. Diabetes 2010; 59: 1487–1495. 14. Falanga A, Marchetti M, Vignoli A, et al. V617F JAK-2 mutation in patients with essential thrombocythemia: relation to platelet, granulocyte, and plasma hemostatic and inflammatory molecules. Exp Hematol 2007; 35: 702–711. 15. Tilley RE, Holscher T, Belani R, et al. Tissue factor activity is increased in a combined platelet and microparticle sample from cancer patients. Thromb Res 2008; 122: 604–609. 16. Ogura M, Morishima Y, Ohno R, et al. Establishment of a novel human megakaryoblastic leukemia cell line, MEG-01, with positive Philadelphia chromosome. Blood 1985; 66: 1384–1392. 17. Balduini A, Pallotta I, Malara A, et al. Adhesive receptors, extracellular proteins and myosin IIA orchestrate proplatelet formation by human megakaryocytes. J Thromb Haemost 2008; 6: 1900–1907. 18. Schweinfurth N, Hohmann S, Deuschle M, et al. Valproic acid and all trans retinoic acid differentially induce megakaryopoiesis and platelet-like particle formation from the megakaryoblastic cell line MEG-01. Platelets 2010; 21: 648–657. 19. Ollivier V, Wang J, Manly D, et al. Detection of endogenous tissue factor levels in plasma using the calibrated automated thrombogram assay. Thromb Res 2010; 125: 90–96. 20. Mallat Z, Hugel B, Ohan J, et al. Shed membrane microparticles with procoagulant potential in human atherosclerotic plaques: a role for apoptosis in plaque thrombogenicity. Circulation 1999; 99: 348–353.

21. Soejima H, Ogawa H, Yasue H, et al. Heightened tissue factor associated with tissue factor pathway inhibitor and prognosis in patients with unstable angina. Circulation 1999; 99: 2908–2913. 22. Flaumenhaft R, Dilks JR, Richardson J, et al. Megakaryocyte-derived microparticles: direct visualisation and distinction from platelet-derived microparticles. Blood 2009; 113: 1112–1121. 23. Camera M, Brambilla M, Toschi V, et al. Tissue factor expression on platelets is a dynamic event. Blood 2010; 116: 5076–5077. 24. Camera M, Brambilla M, Boselli D, et al. Functionally active platelets do express tissue factor. Blood 2012; 119: 4339–4341. 25. Mackman N, Luther T. Platelet tissue factor: To be or not to be. Thromb Res 2013; 132: 3–5. 26. Bouchard BA, Mann KG, Butenas S. No evidence for tissue factor on platelets. Blood 2010; 116: 854–855. 27. Bouchard BA, Krudysz-Amblo J, Butenas S. Platelet tissue factor is not expressed transiently after platelet activation. Blood 2012; 119: 4338–4339; author reply 4339–4341. 28. Bouchard BA, Gissel MT, Whelihan MF, et al. Platelets do not express the oxidized or reduced forms of tissue factor. Biochim Biophys Acta 2014; 1840: 1188–1193. 29. Osterud B, Olsen JO. Human platelets do not express tissue factor. Thromb Res 2013; 132: 112–115. 30. Gnatenko DV, Dunn JJ, McCorkle SR, et al. Transcript profiling of human platelets using microarray and serial analysis of gene expression. Blood 2003; 101: 2285–2293. 31. Weyrich AS, Dixon DA, Pabla R, et al. Signal-dependent translation of a regulatory protein, Bcl-3, in activated human platelets. Proc Natl Acad Sci USA 1998; 95: 5556–5561. 32. Lindemann S, Tolley ND, Dixon DA, et al. Activated platelets mediate inflammatory signaling by regulated interleukin 1beta synthesis. J Cell Biol 2001; 154: 485–490. 33. Evangelista V, Manarini S, Di Santo A, et al. De novo synthesis of cyclooxygenase-1 counteracts the suppression of platelet thromboxane biosynthesis by aspirin. Circulation Res 2006; 98: 593–595. 34. Egorina EM, Sovershaev MA, Bjorkoy G, et al. Intracellular and surface distribution of monocyte tissue factor: application to intersubject variability. Arterioscler Thromb Vasc Biol 2005; 25: 1493–1498. 35. Rao LV, Pendurthi UR. Regulation of tissue factor coagulant activity on cell surfaces. J Thromb Haemost 2012; 10: 2242–2253. 36. Chen VM, Hogg PJ. Encryption and decryption of tissue factor. J Thromb Haemost 2013; 11 (Suppl 1): 277–284. 37. Stalker TJ, Traxler EA, Wu J, et al. Hierarchical organisation in the hemostatic response and its relationship to the platelet-signaling network. Blood 2013; 121: 1875–1885. 38. Palmerini T, Tomasi L, Barozzi C, et al. Detection of tissue factor antigen and coagulation activity in coronary artery thrombi isolated from patients with STsegment elevation acute myocardial infarction. PLoS One 2013; 8: e81501. 39. Pawlinski R, Wang JG, Owens AP, 3rd, et al. Hematopoietic and nonhematopoietic cell tissue factor activates the coagulation cascade in endotoxemic mice. Blood 2010; 116: 806–814. 40. Tyagi T, Ahmad S, Gupta N, et al. Altered expression of platelet proteins and calpain activity mediate hypoxia-induced prothrombotic phenotype. Blood 2014; 123: 1250–1260. 41. Bugert P, Dugrillon A, Gunaydin A, et al. Messenger RNA profiling of human platelets by microarray hybridisation. Thromb Haemost 2003; 90: 738–748. 42. Podmore A, Smith M, Savidge G, et al. Real-time quantitative PCR analysis of factor XI mRNA variants in human platelets. J Thromb Haemost 2004; 2: 1713–1719. 43. Rox JM, Bugert P, Muller J, et al. Gene expression analysis in platelets from a single donor: evaluation of a PCR-based amplification technique. Clin Chem 2004; 50: 2271–2278.


© Schattauer 2015


Glomerular tissue factor stimulates thromboxane synthesis in human platelets via thrombin generation.

Generation of Megakaryocytes and Platelets from Human Pluripotent Stem Cells.

Multiphasic generation of diacylglycerol in thrombin-activated human platelets.

Manipulating megakaryocytes to manufacture platelets ex vivo.

PPACK-thrombin is a noncompetitive inhibitor of alpha-thrombin binding to human platelets.

The perturbation of thrombin binding to human platelets by anions.

Tissue factor-independent inhibition of thrombin generation by tissue factor pathway inhibitor-α.

Platelets contain tissue factor pathway inhibitor-2 derived from megakaryocytes and inhibits fibrinolysis.

Equilibrium binding of thrombin to platelets.

Expression of adhesion antigens of human bone marrow megakaryocytes, circulating megakaryocytes and blood platelets.

Targeting hypoxia-inducible factor 1 to stimulate tissue vascularization.

Thrombin induced surface changes of human platelets.

Interaction of thrombin with human platelets.

The hypersensitivity to thrombin of platelets from diabetic rats is not due to increased thrombin binding.

Thrombin-induced protein phosphorylation in human platelets.

Megakaryocytes and the heterogeneity of circulating platelets.

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin.

Generation of HLA-universal iPSCs-derived megakaryocytes and platelets for survival under refractoriness conditions.

Thrombin induces a biphasic 1,2-diacylglycerol production in human platelets.

Hypersensitivity of diabetic human platelets to platelet activating factor.

Binding of coagulation factor XIa to receptor on human platelets.

Selective release of archidonic acid from the phospholipids of human platelets in response to thrombin.

Events occurring after thrombin-induced fibrinogen binding to platelets.

Tissue Factor Surfaces.