Bo Liang, Shirin Munir, Emerito Amaro-Carambot, Sonja Surman, Natalie Mackow, Lijuan Yang, Ursula J. Buchholz, Peter L. Collins, Anne Schaap-Nutt RNA Viruses Section, Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA
ABSTRACT
A recombinant chimeric bovine/human parainfluenza type 3 virus (rB/HPIV3) vector expressing the respiratory syncytial virus (RSV) fusion F glycoprotein previously exhibited disappointing levels of RSV F immunogenicity and genetic stability in children (D. Bernstein et al., Pediatr. Infect. Dis. J. 31:109 –114, 2012; C.-F. Yang et al., Vaccine 31:2822–2827, 2013). To investigate parameters that might affect vaccine performance and stability, we constructed and characterized rB/HPIV3 viruses expressing RSV F from the first (pre-N), second (N-P), third (P-M), and sixth (HN-L) genome positions. There was a 30- to 69-fold gradient in RSV F expression from the first to the sixth position. The inserts moderately attenuated vector replication in vitro and in the upper and lower respiratory tracts of hamsters: this was not influenced by the level of RSV F expression and syncytium formation. Surprisingly, inserts in the second, third, and sixth positions conferred increased temperature sensitivity: this was greatest for the third position and was the most attenuating in vivo. Each rB/HPIV3 vector induced a high titer of neutralizing antibodies in hamsters against RSV and HPIV3. Protection against RSV challenge was greater for position 2 than for position 6. Evaluation of insert stability suggested that RSV F is under selective pressure to be silenced during vector replication in vivo, but this was not exacerbated by a high level of RSV F expression and generally involved a small percentage of recovered vector. Vector passaged in vitro accumulated mutations in the HN open reading frame, causing a dramatic increase in plaque size that may have implications for vaccine production and immunogenicity. IMPORTANCE
The research findings presented here will be instrumental for improving the design of a bivalent pediatric vaccine for respiratory syncytial virus and parainfluenza virus type 3, two major causes of severe respiratory tract infection in infants and young children. Moreover, this knowledge has general application to the development and clinical evaluation of other mononegavirus vectors and vaccines.
R
espiratory syncytial virus (RSV) and parainfluenza virus type 3 (PIV3) are members of genera Pneumovirus and Respirovirus, respectively, of the Paramyxoviridae family of the order Mononegavirales. RSV and PIV3 are cytoplasmic viruses, and each has a nonsegmented, negative-strand RNA genome that is encapsidated and is packaged in a lipid envelope. Both viruses cause acute lower respiratory infection (ALRI) in infants and children (1, 2). RSV-related ALRI causes an estimated 3.4 million hospitalizations and 60,000 to 199,000 deaths of children under age five every year worldwide. PIV3 is second only to RSV as a major cause of pneumonia and bronchiolitis in infants (1, 3). Morbidity and mortality due to these viruses are substantially greater in developing countries (3–6), and vaccines and effective antiviral drugs are not currently available. A formalin-inactivated pediatric RSV vaccine (FI-RSV) evaluated in the 1960s was poorly protective and primed for enhanced RSV disease upon subsequent natural RSV infection (7). Subunit vaccines composed of the RSV fusion F and attachment G glycoproteins, the two viral neutralization and major protective antigens, also caused vaccine-enhanced disease in animal models (8). Comparable enhancement of viral disease by protein-based vaccines also has been observed for several other paramyxoviruses, namely, measles virus in human vaccine recipients in the 1960s
April 2014 Volume 88 Number 8
and human parainfluenza virus type 3 (HPIV3) (9) and human metapneumovirus (9–11) in experimental animals. As a result, inactivated and subunit vaccines for these viruses are considered inappropriate for infants and children. In contrast, infection with live-attenuated measles vaccines and experimental live RSV, PIV3, and PIV3-vectored vaccines do not cause enhanced disease (12– 14) and are suitable for pediatric use. Live-attenuated RSV vaccines based on modified RSV strains containing various attenuating mutations are under development (reviewed in references 15 and 16). A second vaccine strategy is to use attenuated PIV vectors to express RSV antigen from one or two added genes. PIV-vectored RSV vaccines provide a bivalent vaccine that is more easily manufactured and has greater physical stability compared to attenuated RSV strains and may be essential
Received 25 November 2013 Accepted 21 January 2014 Published ahead of print 29 January 2014 Editor: T. S. Dermody Address correspondence to Bo Liang, [email protected]. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/JVI.03481-13
Journal of Virology
p. 4237– 4250
jvi.asm.org
4237
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
Chimeric Bovine/Human Parainfluenza Virus Type 3 Expressing Respiratory Syncytial Virus (RSV) F Glycoprotein: Effect of Insert Position on Expression, Replication, Immunogenicity, Stability, and Protection against RSV Infection
Liang et al.
4238
jvi.asm.org
above for MEDI-534, and expression from the first position appeared to be more difficult to recover and more restrictive to vector replication (19). Therefore, in the present study, we also examined positions 3 and 6 for comparison, since these are expected to be less deleterious to the vector and might confer increased stability. Positions 4 and 5 were avoided, since insertion in these sites could affect vector F and/or HN expression, potentially causing further attenuation and weaker immunogenicity. MATERIALS AND METHODS Viruses and cells. LLC-MK2 (ATCC CCL-7) rhesus monkey kidney and Vero (ATCC CCL-81) African green monkey kidney cell lines were maintained in Opti-MEM1 (1⫻) plus GlutaMax-1 medium (Gibco/Life Technologies, Grand Island, NY) supplemented with 5% fetal bovine serum (FBS; HyClone/Thermo Scientific, Atlanta, GA). BSR T7/5 hamster kidney cells that constitutively express T7 RNA polymerase were maintained as described previously (27). Recombinant (r) and wild-type (wt) RSV and rB/HPIV3 were previously described (18, 28). All rB/HPIV3 vectors were propagated at 32°C in LLC-MK2 cells or Vero cells (29). RSV sequences and virus are from strain A2 (GenBank accession no. M74568); HPIV3 and BPIV3 sequences are from strains JS (Z11575) and Kansas/ 15626/84 (AF178654), respectively. Construction of antigenomic cDNAs encoding rB/HPIV3-RSV F viruses. The full-length cDNA of rB/HPIV3 was previously modified to contain unique restriction sites using BlpI, AscI, NotI, and BsiWI at the first, second, third, and sixth gene positions, respectively (17) (Fig. 1). rB/HPIV3-F1 was constructed in an earlier study (17), using the BlpI site to insert the RSV F open reading frame (ORF; A2 strain) at the first position. RSV F was inserted in the other three restriction sites (AscI, NotI, and BsiWI) in the present study (Fig. 1); each site is positioned several nucleotides upstream of the N, P, or HN gene end (GE) signal, respectively. The RSV F ORF was modified using primers to add a BPIV3 GE signal, an intergenic (IG) region (“CTT”), and gene start (GS) signal placed before the RSV F ORF, as well as a pair of corresponding restriction sites flanking the insert. The following PCR primers were used to generate the insertions. For rB/HPIV3-F2, the forward primer was ATCATGGCGCGCCAAGTAAG AAAAACTTAGGATTAATGGACCTGCAGGATGGAGTTGCTAATCC TCAAAGCAAATG and the reverse primer was GAGATGGCGCGCCGC TAGCTATTAGTTACTAAATGCAATATTATTTATACCACTC. For rB/ HPIV3-F3, the forward primer was TCATGCGGCCGCAAGTAAGAAA AACTTAGGATTAATGGACCTGCAGGATGGAGTTGCTAATCCTCA AAGCAAATG, and the reverse primer was GAGATGCGGCCGCGC TAGCTATTAGTTACTAAATGCAATATTATTTATACCACTC. For rB/ HPIV3-F6, the forward primer was ATCATCGTACGTAAGTAAGAAAA ACTTAGGATTAATGGACCTGCAGGATGGAGTTGCTAATCCTCAA AGCAAATG, and the reverse primer was AGTATCGTACGGCTAGCTT ATTAGTTACTAAATGCAATATTATTTATACCACTC. In these sequences, the restriction sites are underlined, and the ORF translation initiation and termination codons are indicated in boldface. PCR products were generated using an Advantage HF 2 PCR kit (Clontech, Mountain View, CA) and cloned using a TOPO TA cloning kit (Life Technologies), and sequences were confirmed by automated sequencing. The RSV F was digested and ligated into full-length cDNA of rB/HPIV3 using corresponding restriction sites, and the sequence was confirmed. The genome nucleotide length for all constructs was a multiple of six (30, 31). Recovery of rB/HPIV3-RSV F chimeric viruses from cDNA. The rB/ HPIV3-RSV F viruses were recovered by reverse genetics (18) in BSR-T7/5 cells constitutively expressing T7 RNA polymerase (32). Recovered virus was amplified by two passages in LLC-MK2 cells at 32°C. Virus sequences were confirmed in their entirety (except for the last 30 and 120 nucleotides at the 3= and 5= terminal ends, respectively) by sequence analysis of uncloned reverse transcription-PCR (RT-PCR) products amplified from viral RNA isolated from the virus stocks using a Viral-Amp kit (Qiagen,
Journal of Virology
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
for extending RSV vaccines to resource-limited regions. One such PIV vector, a chimeric recombinant bovine/human PIV3 (rB/ HPIV3) expressing the RSV F glycoprotein, has been developed separately by the National Institute of Allergy and Infectious Disease (NIAID) (17, 18) and MedImmune (19) as an experimental bivalent vaccine against HPIV3 and RSV. The rB/HPIV3 vector consists of rBPIV3 in which the F and HN genes have been replaced by those of HPIV3. The HPIV3-derived F and HN proteins induce homologous immunity against HPIV3, whereas the BPIV3 backbone confers attenuation in the respiratory tract of primates due to host range restriction (18). rB/HPIV3 without an added insert was substantially attenuated and immunogenic in seronegative children (20). rB/HPIV3 expressing the RSV F protein from an insert in the second genome position, between the nucleoprotein N and phosphoprotein P genes, was previously evaluated clinically by MedImmune (12, 21). This construct, called MEDI-534, appeared to be substantially immunogenic and protective in rodents and nonhuman primates. However, when evaluated in seronegative children, it induced HPIV3-specific and RSV-specific serum antibodies in 100% and 50% of recipients, respectively, and thus had disappointing immunogenicity against RSV (12). Remarkably, 13 of 24 recipients shed vaccine virus variants containing mutations predicted to reduce or ablate RSV F expression, and in a number of cases the entire population of recovered virus consisted of variants (22). Furthermore, retrospective analysis showed that approximately 2.5% of the clinical trial material consisted of variants with compromised RSV F expression. It seems likely that this population of vaccine virus in which expression of RSV F was silenced gained a selective advantage for replication in vivo, although it also is possible that variants silenced for expression of RSV F also arose de novo during replication in vivo. These findings indicate a need to reevaluate factors affecting the expression and stability of the RSV F insert during vaccine production in vitro and vaccine use in vivo. This information would be generally pertinent to clinical development of mononegavirus vectors and vaccines. Mononegavirus gene transcription proceeds from the 3= leader to 5= trailer in a sequential start-stop mechanism that produces a decreasing gradient of gene expression (23). Therefore, the position of the RSV F insert in a PIV-vectored vaccine would play a major role in determining the level of expression and immunogenicity, since viral vectors expressing higher levels of antigen are more immunogenic (24). In addition, insertion of an additional gene can attenuate the vector due to a variety of factors that remain incompletely understood and include increased genome length, greater gene number, reduced expression of vector genes, altered vector protein stoichiometry, potential incorporation of the foreign protein into the vector particle (25), potential toxic effects such as fusion (26), and potential interference with the genesis of vector glycoproteins and particles. Such effects can provide selective pressure for silencing expression of the foreign gene. To further evaluate factors affecting the stability and immunogenicity of RSV F expressed by the rB/HPIV3 vector, we compared constructs in which the insert was placed in the first (pre-N), second (N-P), third (P-M), and sixth (HN-L) positions. Expression of RSV F from the first or second position should provide the highest level of this antigen but also has the greatest potential for interfering with vector replication and also could be detrimental due to the fusogenic nature of RSV F. Indeed, previous results identified instability associated with the second position, as noted
Live-Attenuated B/HPIV3-Vectored RSV Vaccines
positions. In the case of rB/HPIV3-F1, the insertion site was the BlpI site in the upstream nontranslated region of the N gene, and the insert consisted of the RSV F ORF, followed by a copy of the BPIV3 N gene-end (GE), intergenic (IG), and N gene-start (GS) sequences. In the case of rB/HPIV3-F2, rB/HPIV3-F3, and rB/HPIV3-F6, the insertion sites were, respectively, the AscI, NotI, and BsiWI sites in the downstream noncoding regions of the N, P, and HN genes, and the insert consisted of the RSV F ORF preceded by a copy of the BPIV3 N GE, IG, and P GS sequences. Thus, in each construct, the inserted RSV F ORF was under the control of a set of BPIV3 transcription signals such that it would be expressed as a separate mRNA.
Valencia, CA). Control RT-PCRs lacking reverse transcriptase indicated that the sequencing results were not derived from the input antigenomic cDNAs (data not shown). Analysis of RSV F expression by Western blotting. Vero cells (2 ⫻ 105) were infected with rB/HPIV3-RSV F viruses at a multiplicity of infection (MOI) of 10 50% tissue culture infective doses (TCID50) and incubated at 32°C. At 48 h postinfection (p.i.), monolayers were washed twice with ice-cold phosphate-buffered saline (PBS) and lysed with 200 l of ice-cold radioimmunoprecipitation assay buffer containing 1⫻ Complete cocktail protease inhibitor (Roche, Indianapolis, IN). Lysates were mixed with 1⫻ LDS buffer (Life Technologies) and 1⫻ reducing reagent (Life Technologies) and then boiled at 95°C for 5 min. A 30-l portion of reduced, denatured lysate was loaded onto 4 to 12% NuPAGE gels (Novex-Life Technologies). Membranes were probed with murine monoclonal anti-RSV F antibody (Ab43812; Abcam, Cambridge, MA), goat polyclonal anti-GAPDH antibody (sc-20357; Santa Cruz, Dallas, TX), and two types of HPIV3-specific antibodies: (i) anti-HPIV3 hyperimmune serum generated in rabbits immunized with sucrose-gradient-purified rHPIV3 (33) and (ii) anti-HPIV3 HN antibodies generated in rabbits immunized with a synthetic peptide representing HN amino acids 3 to 19 plus an added C-terminal cysteine residue, YWKHTNHGKDAGNEL ETC. The following fluorescent dye-conjugated secondary antibodies
April 2014 Volume 88 Number 8
were used: donkey anti-rabbit IRDye680, donkey anti-mouse IRDye 800CW, or donkey anti-goat IRDye 800CW (LiCor, Lincoln, NE). Membranes were scanned, and the fluorescence intensities of the protein bands were quantified by using an Odyssey infrared imaging system (LiCor). Analysis of cell surface RSV F expression by flow cytometry. Infected cells were harvested by incubation in PBS containing 1 mM EDTA at 37°C for 5 min and then washed twice in ice-cold fluorescence-activated cell sorting (FACS) buffer (1⫻ PBS, 2% FBS), followed by incubation with a previously optimized dilution of Alexa Fluor 488 (AF488)-conjugated RSV F monoclonal antibody (MAb) 1129 (34). The AF488-conjugated RSV F MAb was prepared using an Alexa Fluor 488 antibody labeling kit (Life Technologies) according to the kit instructions. Labeled cells were washed twice in ice-cold FACS buffer and incubated in Far-Red Live/Dead dye (Life Technologies) to discriminate dead cells. Stained cells were analyzed by using a BD FACSCanto II flow cytometer. Hamster studies. All animal studies were approved by the National Institutes of Health (NIH) Institutional Animal Care and Use Committee (IACUC). Six-week-old Golden Syrian hamsters, which were confirmed to be seronegative for HPIV3 and RSV by a hemagglutination inhibition assay (HAI) and an RSV-specific neutralization assay, respectively (35, 36), were anesthetized and inoculated intranasally with 0.1 ml containing 106 TCID50 of rB/HPIV3-RSV F virus or with 106 PFU of wt RSV (A2
jvi.asm.org 4239
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
FIG 1 Construction of antigenomic cDNAs of rB/HPIV3 containing the RSV F insert placed in the first (F1), second (F2), third (F3), and sixth (F6) genome
Liang et al.
0.01 TCID50 with rB/HPIV3, rB/HPIV3-F1, rB/HPIV3-F2, rB/HPIV3-F3, and rB/HPIV3-F6. The plates were incubated at 32°C. Aliquots of cell culture medium (0.5 ml out of 2 ml total) were harvested and replaced at 24-h intervals and virus titers (log10 TCID50/ml) were determined by serial dilution on LLC-MK2 cells and hemadsorption assay (52). Mean titers with the standard errors of the mean (SEM) are shown. The statistical significance between the titer of each rB/HPIV3-RSV F virus versus the empty rB/HPIV3 vector on day 2 was determined by using the Student t test and is indicated by asterisks as follows: *, P ⱕ 0.05; **, P ⱕ 0.01; ***, P ⱕ 0.001; or ns, not significant.
strain). Nasal turbinate and lung tissues were harvested separately for virus quantification by serial dilution on LLC-MK2 cells (rB/HPIV3-RSV F viruses) or plaque assays on Vero cells (RSV) (27, 37). Sera were collected from hamsters 3 days prior to and 28 days after inoculation. Titers of RSV- and HPIV3-specific neutralizing antibodies (NAbs) were determined by complement-enhanced 60% plaque reduction neutralization assay on Vero cells (38). Challenge was performed by intranasal infection with 106 PFU of RSV in 0.1 ml at 31 days after immunization. The viral loads of the challenge RSV in the nasal turbinates and lungs were determined 3 days after challenge by plaque assays on Vero cells. Double-staining plaque assays. Plaques of rB/HPIV3 RSV-F viruses were detected on infected Vero cell monolayers by immunostaining with RSV F-specific MAbs, as previously described (27). Wells containing fewer than 50 plaques were chosen for quantification, and the positions of plaques were marked with a pen on the back of the plates. After a washing step with 1⫻ PBS to remove the peroxidase substrate, immunostaining was performed on the same plates using HPIV3 hyperimmune serum diluted 1:1,000, followed by anti-rabbit horseradish peroxidase-conjugated antibody (KPL) diluted 1:1,000 and 4 CN peroxidase detection. Plaques that had not been stained with the RSV-specific antibody and only became evident with HPIV3 hyperimmune serum were identified and were indicative of a loss of RSV F expression. From the total number of plaques, the percentage positive for RSV F was calculated. Deep sequencing. The RSV F inserts in rB/HPIV3-F3 and -F6 virus present in a hamster lung or nasal turbinate tissue suspension, respectively, were amplified by RT-PCR, together with approximately 150 to 200 nucleotides of flanking vector gene sequence on either side, using the Advantage HF 2 PCR kit (Clontech). PCR primers for rB/HPIV3-F3 were ACCTAGCGGGAGGACATCC and GGTGATGCTCATTGTTTCGG AGG; the primers for rB/HPIV3-F6 were CAGCTGGATATACAACAAC AAGCTGC and TTGGAACATTTCACTAGACATCTCTGG. PCR products were analyzed using an Ion-Torrent sequencer according to the manufacturer’s instructions (Life Technologies).
RESULTS
Generation of recombinant chimeric rB/HPIV3 viruses bearing the RSV F ORF as an additional gene. We constructed a series of rB/HPIV3 viruses in which the RSV F ORF was placed under the control of a set of BPIV3 gene-start (GS) and gene-end (GE) signals and inserted as the first (pre-N, rB/HPIV3-F1), second (N-P,
4240
jvi.asm.org
rB/HPIV3-F2), third (P-M, rB/HPIV3-F3), and 6th (HN-L, rB/ HPIV3-F6) gene in the rB/HPIV3 genome (Fig. 1). As shown in Fig. 1, we designed the RSV F insert in the F2, F3, and F6 constructs so that the gene junction preceding the next downstream vector gene was unchanged (this could not be done for F1 because BPIV3 N is not normally preceded by a gene junction). This would avoid changes in stop-start transcription leading into the vector gene, and should eliminate this as a possible cause of altered downstream expression. All constructs were designed to conform to the “rule of six” (30). In addition, the hexamer phasing was maintained for each B/HPIV3 gene, and the phasing for each RSV insert was consistent with its gene position (31). The rB/HPIV3RSV F viruses were readily recovered by reverse genetics. The sequence of each virus was confirmed in its entirety except for the last 30 and 120 nucleotides at the 3= and 5= terminal ends, respectively, confirming the lack of adventitious mutations. Replication of rB/HPIV3-RSV F viruses in vitro. Multistep growth kinetics were determined in LLC-MK2 and Vero cells (Fig. 2). Monolayers were infected at an MOI of 0.01 TCID50 and incubated at 32°C. Medium supernatant was harvested at 24-h intervals over a 5-day period, and virus titers were determined by TCID50 assay. In both cell types (Fig. 2A and B), replication of the empty rB/HPIV3 vector was significantly more rapid than the F1, F2 and F3 viruses during the period of exponential growth (e.g., day 2). In MK2 cells, the F6 virus replicated slightly slower than the empty rB/HPIV3 vector during exponential growth, but faster than the F1, F2 and F3 viruses (Fig. 2A); in Vero cells, F6 replicated at a rate similar to empty rB/HPIV3 vector, and faster than the F1, F2, and F3 viruses (Fig. 2B). These observations suggested that insertion of RSV F at position 6 was less restrictive than at positions 1, 2 and 3 in vitro. Also, in both cell types, replication of F3 virus during exponential growth was significantly slower than the other viruses, suggesting the F3 virus was more restricted. All vectors grew to final titers (day 5) higher than 8.4 log10 TCID50/ml in LLC-MK2 cells (Fig. 2A) and 8.2 log10 TCID50/ml in Vero cells (Fig. 2B). The highest titers were observed with the empty vector and the F1 and F2 viruses, while the final titers of the
Journal of Virology
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
FIG 2 (A and B) Multistep growth kinetics in LLC-MK2 (A) and Vero (B) cells. Triplicate wells of cell monolayers in six-well plates were infected at an MOI of
Live-Attenuated B/HPIV3-Vectored RSV Vaccines
infected at an MOI of 10 TCID50. Total cell lysates were harvested at 48 h p.i. and analyzed by Western blotting under denaturing or reducing conditions. The experiment was performed with a total of four wells per virus in two independent experiments. (A) Representative example of the Western blot profiles visualized by reaction with fluorescent antibodies and detected by infrared imaging, with positions indicated for viral proteins and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as a loading control. Lanes 1 to 6 are identified by the corresponding rB/HPIV3 vector or mock-infection. (B) Relative level of RSV F expression from the blot in panel A, normalized to expression by the F6 virus set at 1.0. (C to E) Relative levels of expression of the HPIV3 HN (C), BPIV3 P (D), and BPIV3 N (E) proteins normalized to the F6 vector set at 1.0; plotted data were obtained from the four samples in two experiments per virus, and error bars represent the SEM. Bars marked 1 to 6 correspond to lanes 1 to 6 in panel A.
F3 virus in particular were lower. The Tukey-Kramer multiple comparison test showed that several of the differences were significant: the peak titer of the empty vector (9.7 log10 TCID50/ml) in LLC-MK2 cells (Fig. 2A) was significantly higher than the F3 (8.4 log10 TCID50/ml, P ⬍ 0.01) and F6 (8.7 log10 TCID50/ml, P ⬍ 0.05) viruses. The peak titer of the F2 virus (9.2 log10 TCID50/ml) in Vero cells (Fig. 2B) was significantly higher than the F3 (8.2 log10 TCID50/ml, P ⬍ 0.05) and F6 (8.2 log10 TCID50/ml, P ⬍ 0.05) viruses, but none of the peak titers in Vero cells of the rB/ HPIV3-RSV F viruses were statistically different from the empty vector. Expression of RSV F and vector proteins by the rB/HPIV3RSV F viruses. Expression of RSV F and vector proteins was determined by Western blotting of infected Vero cell lysates in two experiments involving four monolayers per virus (Fig. 3). The findings reported below for Vero cells also were reproduced in LLC-MK2 cells (data not shown). RSV F is synthesized as an F0 precursor that is cleaved twice by cellular protease to generate disulfide-linked F1 and F2 chains (39). Both the uncleaved 70kD F0
April 2014 Volume 88 Number 8
precursor and the cleaved 48kD F1 chain of RSV F were detected under these conditions (Fig. 3A). As expected, expression of RSV F was greater when its gene was inserted at an earlier position in the rB/HPIV3 genome. In one experiment in Vero cells, compared to the level of RSV F expressed by the F6 virus, that expressed by the F1, F2, and F3 viruses was increased 30-fold, 15-fold, and 5-fold, respectively (Fig. 3A, lanes 2 to 5; Fig. 3B). In a second experiment in Vero cells, the relative values were 69-, 29-, and 6-fold (not shown). We also examined the expression of the vector HPIV3-derived HN protein and the vector BPIV3-derived N and P proteins using antibodies against HPIV3, which cross-reacted with the BPIV3 proteins. This showed that the insertion of RSV F reduced the expression of downstream genes but had little effect on the expression of upstream genes (Fig. 3A, C, D, and E). Thus, the F1 insert reduced expression of the vector N, P, and HN genes. The F2 insert reduced expression of the P and HN genes. The F3 insert reduced expression of the HN gene, and the F6 insert did not affect the expression of the N, P, or HN genes. The level of reduction of
jvi.asm.org 4241
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
FIG 3 Western blot analysis of the expression of RSV F, HPIV3 HN, and BPIV3 P and N proteins in Vero cells infected with the rB/HPIV3 vectors. Cells were
Liang et al.
rB/HPIV3-F6, or wt RSV at an MOI of 5 TCID50 for the rB/HPIV3 vectors and 5 PFU for wt RSV. At 24 h p.i., infected cells were harvested and stained with Far-Red Live/Dead dye and AF488-conjugated anti-RSV F MAb without permeabilization as described in Materials and Methods. The cell population was gated to include only single, live cells. (A) Histogram plot of RSV F expression. The x axis shows intensity of RSV F expression, and the y axis is the percentage of cell count normalized to the maximum count (100%) in a distribution. Gating of RSV F-positive cells is indicated by the box with dashed lines. (B) Median fluorescence intensity (MFI) of RSV F expression on the surface of RSV F⫹ gated cells (gate shown in panel A).
downstream expression was reproducibly greater for the F3 virus, implying that this insert had a particularly greater effect on the transcriptional gradient. Expression of RSV F on the cell surface was analyzed by flow cytometry. Unpermeabilized, infected Vero cells (MOI ⫽ 5 TCID50) were stained with AF488-conjugated RSV F antibody at 24 h p.i. Similar to the total RSV F protein expression detected by Western blotting (Fig. 3), the surface expression of RSV F was stronger when it was inserted at sites closer to the 3= leader (Fig. 4A
and B). Later time points could not be reliably evaluated because the extensive syncytia formed by the F1 and F2 viruses (see below) were excluded by the gating parameters, thus excluding the cells with the greatest expression of RSV F. A characteristic of RSV infection in monolayer cell cultures is the formation of syncytia mediated by RSV F, while extensive syncytium formation is not typically observed in B/HPIV3-infected cultures (Fig. 5A). The formation of syncytia by rB/HPIV3 expressing RSV F from different positions was monitored on Vero
FIG 5 Formation of syncytia on cell monolayers infected with the rB/HPIV3 vectors. Vero cells were infected at an MOI of 10 TCID50 for 48 h, at which time syncytium formation was captured under a light microscope. Photomicrographs of the empty rB/HPIV3 vector (A), rB/HPIV3-F1 (B), rB/HPIV3-F2 (C), rB/HPIV3-F3 (D), rB/HPIV3-F6 (E), and mock infection (F) are shown. Representative syncytia are marked by dotted lines in panels B and C.
4242
jvi.asm.org
Journal of Virology
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
FIG 4 Expression of RSV F on the surface of cells infected with the rB/HPIV3 vectors. Vero cells were infected with rB/HPIV3-F1, rB/HPIV3-F2, rB/HPIV3-F3,
Live-Attenuated B/HPIV3-Vectored RSV Vaccines
TABLE 1 Temperature sensitivity of recombinant viruses on LLC-MK2 cell monolayersa
35°C
36°C
37°C
38°C
39°C
40°C
rB/HPIV3 rB/HPIV3-F1 rB/HPIV3-F2 rB/HPIV3-F3 rB/HPIV3-F6
6.9 7.6 7.6 6.8 7.5
6.6 7.6 7.5 6.9 7.3
6.4 7.5 7.4 6.2 7.5
6.6 7.5 7.2 5.7 7.2
6.4 6.7 6.5
ABSTRACT
A recombinant chimeric bovine/human parainfluenza type 3 virus (rB/HPIV3) vector expressing the respiratory syncytial virus (RSV) fusion F glycoprotein previously exhibited disappointing levels of RSV F immunogenicity and genetic stability in children (D. Bernstein et al., Pediatr. Infect. Dis. J. 31:109 –114, 2012; C.-F. Yang et al., Vaccine 31:2822–2827, 2013). To investigate parameters that might affect vaccine performance and stability, we constructed and characterized rB/HPIV3 viruses expressing RSV F from the first (pre-N), second (N-P), third (P-M), and sixth (HN-L) genome positions. There was a 30- to 69-fold gradient in RSV F expression from the first to the sixth position. The inserts moderately attenuated vector replication in vitro and in the upper and lower respiratory tracts of hamsters: this was not influenced by the level of RSV F expression and syncytium formation. Surprisingly, inserts in the second, third, and sixth positions conferred increased temperature sensitivity: this was greatest for the third position and was the most attenuating in vivo. Each rB/HPIV3 vector induced a high titer of neutralizing antibodies in hamsters against RSV and HPIV3. Protection against RSV challenge was greater for position 2 than for position 6. Evaluation of insert stability suggested that RSV F is under selective pressure to be silenced during vector replication in vivo, but this was not exacerbated by a high level of RSV F expression and generally involved a small percentage of recovered vector. Vector passaged in vitro accumulated mutations in the HN open reading frame, causing a dramatic increase in plaque size that may have implications for vaccine production and immunogenicity. IMPORTANCE
The research findings presented here will be instrumental for improving the design of a bivalent pediatric vaccine for respiratory syncytial virus and parainfluenza virus type 3, two major causes of severe respiratory tract infection in infants and young children. Moreover, this knowledge has general application to the development and clinical evaluation of other mononegavirus vectors and vaccines.
R
espiratory syncytial virus (RSV) and parainfluenza virus type 3 (PIV3) are members of genera Pneumovirus and Respirovirus, respectively, of the Paramyxoviridae family of the order Mononegavirales. RSV and PIV3 are cytoplasmic viruses, and each has a nonsegmented, negative-strand RNA genome that is encapsidated and is packaged in a lipid envelope. Both viruses cause acute lower respiratory infection (ALRI) in infants and children (1, 2). RSV-related ALRI causes an estimated 3.4 million hospitalizations and 60,000 to 199,000 deaths of children under age five every year worldwide. PIV3 is second only to RSV as a major cause of pneumonia and bronchiolitis in infants (1, 3). Morbidity and mortality due to these viruses are substantially greater in developing countries (3–6), and vaccines and effective antiviral drugs are not currently available. A formalin-inactivated pediatric RSV vaccine (FI-RSV) evaluated in the 1960s was poorly protective and primed for enhanced RSV disease upon subsequent natural RSV infection (7). Subunit vaccines composed of the RSV fusion F and attachment G glycoproteins, the two viral neutralization and major protective antigens, also caused vaccine-enhanced disease in animal models (8). Comparable enhancement of viral disease by protein-based vaccines also has been observed for several other paramyxoviruses, namely, measles virus in human vaccine recipients in the 1960s
April 2014 Volume 88 Number 8
and human parainfluenza virus type 3 (HPIV3) (9) and human metapneumovirus (9–11) in experimental animals. As a result, inactivated and subunit vaccines for these viruses are considered inappropriate for infants and children. In contrast, infection with live-attenuated measles vaccines and experimental live RSV, PIV3, and PIV3-vectored vaccines do not cause enhanced disease (12– 14) and are suitable for pediatric use. Live-attenuated RSV vaccines based on modified RSV strains containing various attenuating mutations are under development (reviewed in references 15 and 16). A second vaccine strategy is to use attenuated PIV vectors to express RSV antigen from one or two added genes. PIV-vectored RSV vaccines provide a bivalent vaccine that is more easily manufactured and has greater physical stability compared to attenuated RSV strains and may be essential
Received 25 November 2013 Accepted 21 January 2014 Published ahead of print 29 January 2014 Editor: T. S. Dermody Address correspondence to Bo Liang, [email protected]. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/JVI.03481-13
Journal of Virology
p. 4237– 4250
jvi.asm.org
4237
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
Chimeric Bovine/Human Parainfluenza Virus Type 3 Expressing Respiratory Syncytial Virus (RSV) F Glycoprotein: Effect of Insert Position on Expression, Replication, Immunogenicity, Stability, and Protection against RSV Infection
Liang et al.
4238
jvi.asm.org
above for MEDI-534, and expression from the first position appeared to be more difficult to recover and more restrictive to vector replication (19). Therefore, in the present study, we also examined positions 3 and 6 for comparison, since these are expected to be less deleterious to the vector and might confer increased stability. Positions 4 and 5 were avoided, since insertion in these sites could affect vector F and/or HN expression, potentially causing further attenuation and weaker immunogenicity. MATERIALS AND METHODS Viruses and cells. LLC-MK2 (ATCC CCL-7) rhesus monkey kidney and Vero (ATCC CCL-81) African green monkey kidney cell lines were maintained in Opti-MEM1 (1⫻) plus GlutaMax-1 medium (Gibco/Life Technologies, Grand Island, NY) supplemented with 5% fetal bovine serum (FBS; HyClone/Thermo Scientific, Atlanta, GA). BSR T7/5 hamster kidney cells that constitutively express T7 RNA polymerase were maintained as described previously (27). Recombinant (r) and wild-type (wt) RSV and rB/HPIV3 were previously described (18, 28). All rB/HPIV3 vectors were propagated at 32°C in LLC-MK2 cells or Vero cells (29). RSV sequences and virus are from strain A2 (GenBank accession no. M74568); HPIV3 and BPIV3 sequences are from strains JS (Z11575) and Kansas/ 15626/84 (AF178654), respectively. Construction of antigenomic cDNAs encoding rB/HPIV3-RSV F viruses. The full-length cDNA of rB/HPIV3 was previously modified to contain unique restriction sites using BlpI, AscI, NotI, and BsiWI at the first, second, third, and sixth gene positions, respectively (17) (Fig. 1). rB/HPIV3-F1 was constructed in an earlier study (17), using the BlpI site to insert the RSV F open reading frame (ORF; A2 strain) at the first position. RSV F was inserted in the other three restriction sites (AscI, NotI, and BsiWI) in the present study (Fig. 1); each site is positioned several nucleotides upstream of the N, P, or HN gene end (GE) signal, respectively. The RSV F ORF was modified using primers to add a BPIV3 GE signal, an intergenic (IG) region (“CTT”), and gene start (GS) signal placed before the RSV F ORF, as well as a pair of corresponding restriction sites flanking the insert. The following PCR primers were used to generate the insertions. For rB/HPIV3-F2, the forward primer was ATCATGGCGCGCCAAGTAAG AAAAACTTAGGATTAATGGACCTGCAGGATGGAGTTGCTAATCC TCAAAGCAAATG and the reverse primer was GAGATGGCGCGCCGC TAGCTATTAGTTACTAAATGCAATATTATTTATACCACTC. For rB/ HPIV3-F3, the forward primer was TCATGCGGCCGCAAGTAAGAAA AACTTAGGATTAATGGACCTGCAGGATGGAGTTGCTAATCCTCA AAGCAAATG, and the reverse primer was GAGATGCGGCCGCGC TAGCTATTAGTTACTAAATGCAATATTATTTATACCACTC. For rB/ HPIV3-F6, the forward primer was ATCATCGTACGTAAGTAAGAAAA ACTTAGGATTAATGGACCTGCAGGATGGAGTTGCTAATCCTCAA AGCAAATG, and the reverse primer was AGTATCGTACGGCTAGCTT ATTAGTTACTAAATGCAATATTATTTATACCACTC. In these sequences, the restriction sites are underlined, and the ORF translation initiation and termination codons are indicated in boldface. PCR products were generated using an Advantage HF 2 PCR kit (Clontech, Mountain View, CA) and cloned using a TOPO TA cloning kit (Life Technologies), and sequences were confirmed by automated sequencing. The RSV F was digested and ligated into full-length cDNA of rB/HPIV3 using corresponding restriction sites, and the sequence was confirmed. The genome nucleotide length for all constructs was a multiple of six (30, 31). Recovery of rB/HPIV3-RSV F chimeric viruses from cDNA. The rB/ HPIV3-RSV F viruses were recovered by reverse genetics (18) in BSR-T7/5 cells constitutively expressing T7 RNA polymerase (32). Recovered virus was amplified by two passages in LLC-MK2 cells at 32°C. Virus sequences were confirmed in their entirety (except for the last 30 and 120 nucleotides at the 3= and 5= terminal ends, respectively) by sequence analysis of uncloned reverse transcription-PCR (RT-PCR) products amplified from viral RNA isolated from the virus stocks using a Viral-Amp kit (Qiagen,
Journal of Virology
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
for extending RSV vaccines to resource-limited regions. One such PIV vector, a chimeric recombinant bovine/human PIV3 (rB/ HPIV3) expressing the RSV F glycoprotein, has been developed separately by the National Institute of Allergy and Infectious Disease (NIAID) (17, 18) and MedImmune (19) as an experimental bivalent vaccine against HPIV3 and RSV. The rB/HPIV3 vector consists of rBPIV3 in which the F and HN genes have been replaced by those of HPIV3. The HPIV3-derived F and HN proteins induce homologous immunity against HPIV3, whereas the BPIV3 backbone confers attenuation in the respiratory tract of primates due to host range restriction (18). rB/HPIV3 without an added insert was substantially attenuated and immunogenic in seronegative children (20). rB/HPIV3 expressing the RSV F protein from an insert in the second genome position, between the nucleoprotein N and phosphoprotein P genes, was previously evaluated clinically by MedImmune (12, 21). This construct, called MEDI-534, appeared to be substantially immunogenic and protective in rodents and nonhuman primates. However, when evaluated in seronegative children, it induced HPIV3-specific and RSV-specific serum antibodies in 100% and 50% of recipients, respectively, and thus had disappointing immunogenicity against RSV (12). Remarkably, 13 of 24 recipients shed vaccine virus variants containing mutations predicted to reduce or ablate RSV F expression, and in a number of cases the entire population of recovered virus consisted of variants (22). Furthermore, retrospective analysis showed that approximately 2.5% of the clinical trial material consisted of variants with compromised RSV F expression. It seems likely that this population of vaccine virus in which expression of RSV F was silenced gained a selective advantage for replication in vivo, although it also is possible that variants silenced for expression of RSV F also arose de novo during replication in vivo. These findings indicate a need to reevaluate factors affecting the expression and stability of the RSV F insert during vaccine production in vitro and vaccine use in vivo. This information would be generally pertinent to clinical development of mononegavirus vectors and vaccines. Mononegavirus gene transcription proceeds from the 3= leader to 5= trailer in a sequential start-stop mechanism that produces a decreasing gradient of gene expression (23). Therefore, the position of the RSV F insert in a PIV-vectored vaccine would play a major role in determining the level of expression and immunogenicity, since viral vectors expressing higher levels of antigen are more immunogenic (24). In addition, insertion of an additional gene can attenuate the vector due to a variety of factors that remain incompletely understood and include increased genome length, greater gene number, reduced expression of vector genes, altered vector protein stoichiometry, potential incorporation of the foreign protein into the vector particle (25), potential toxic effects such as fusion (26), and potential interference with the genesis of vector glycoproteins and particles. Such effects can provide selective pressure for silencing expression of the foreign gene. To further evaluate factors affecting the stability and immunogenicity of RSV F expressed by the rB/HPIV3 vector, we compared constructs in which the insert was placed in the first (pre-N), second (N-P), third (P-M), and sixth (HN-L) positions. Expression of RSV F from the first or second position should provide the highest level of this antigen but also has the greatest potential for interfering with vector replication and also could be detrimental due to the fusogenic nature of RSV F. Indeed, previous results identified instability associated with the second position, as noted
Live-Attenuated B/HPIV3-Vectored RSV Vaccines
positions. In the case of rB/HPIV3-F1, the insertion site was the BlpI site in the upstream nontranslated region of the N gene, and the insert consisted of the RSV F ORF, followed by a copy of the BPIV3 N gene-end (GE), intergenic (IG), and N gene-start (GS) sequences. In the case of rB/HPIV3-F2, rB/HPIV3-F3, and rB/HPIV3-F6, the insertion sites were, respectively, the AscI, NotI, and BsiWI sites in the downstream noncoding regions of the N, P, and HN genes, and the insert consisted of the RSV F ORF preceded by a copy of the BPIV3 N GE, IG, and P GS sequences. Thus, in each construct, the inserted RSV F ORF was under the control of a set of BPIV3 transcription signals such that it would be expressed as a separate mRNA.
Valencia, CA). Control RT-PCRs lacking reverse transcriptase indicated that the sequencing results were not derived from the input antigenomic cDNAs (data not shown). Analysis of RSV F expression by Western blotting. Vero cells (2 ⫻ 105) were infected with rB/HPIV3-RSV F viruses at a multiplicity of infection (MOI) of 10 50% tissue culture infective doses (TCID50) and incubated at 32°C. At 48 h postinfection (p.i.), monolayers were washed twice with ice-cold phosphate-buffered saline (PBS) and lysed with 200 l of ice-cold radioimmunoprecipitation assay buffer containing 1⫻ Complete cocktail protease inhibitor (Roche, Indianapolis, IN). Lysates were mixed with 1⫻ LDS buffer (Life Technologies) and 1⫻ reducing reagent (Life Technologies) and then boiled at 95°C for 5 min. A 30-l portion of reduced, denatured lysate was loaded onto 4 to 12% NuPAGE gels (Novex-Life Technologies). Membranes were probed with murine monoclonal anti-RSV F antibody (Ab43812; Abcam, Cambridge, MA), goat polyclonal anti-GAPDH antibody (sc-20357; Santa Cruz, Dallas, TX), and two types of HPIV3-specific antibodies: (i) anti-HPIV3 hyperimmune serum generated in rabbits immunized with sucrose-gradient-purified rHPIV3 (33) and (ii) anti-HPIV3 HN antibodies generated in rabbits immunized with a synthetic peptide representing HN amino acids 3 to 19 plus an added C-terminal cysteine residue, YWKHTNHGKDAGNEL ETC. The following fluorescent dye-conjugated secondary antibodies
April 2014 Volume 88 Number 8
were used: donkey anti-rabbit IRDye680, donkey anti-mouse IRDye 800CW, or donkey anti-goat IRDye 800CW (LiCor, Lincoln, NE). Membranes were scanned, and the fluorescence intensities of the protein bands were quantified by using an Odyssey infrared imaging system (LiCor). Analysis of cell surface RSV F expression by flow cytometry. Infected cells were harvested by incubation in PBS containing 1 mM EDTA at 37°C for 5 min and then washed twice in ice-cold fluorescence-activated cell sorting (FACS) buffer (1⫻ PBS, 2% FBS), followed by incubation with a previously optimized dilution of Alexa Fluor 488 (AF488)-conjugated RSV F monoclonal antibody (MAb) 1129 (34). The AF488-conjugated RSV F MAb was prepared using an Alexa Fluor 488 antibody labeling kit (Life Technologies) according to the kit instructions. Labeled cells were washed twice in ice-cold FACS buffer and incubated in Far-Red Live/Dead dye (Life Technologies) to discriminate dead cells. Stained cells were analyzed by using a BD FACSCanto II flow cytometer. Hamster studies. All animal studies were approved by the National Institutes of Health (NIH) Institutional Animal Care and Use Committee (IACUC). Six-week-old Golden Syrian hamsters, which were confirmed to be seronegative for HPIV3 and RSV by a hemagglutination inhibition assay (HAI) and an RSV-specific neutralization assay, respectively (35, 36), were anesthetized and inoculated intranasally with 0.1 ml containing 106 TCID50 of rB/HPIV3-RSV F virus or with 106 PFU of wt RSV (A2
jvi.asm.org 4239
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
FIG 1 Construction of antigenomic cDNAs of rB/HPIV3 containing the RSV F insert placed in the first (F1), second (F2), third (F3), and sixth (F6) genome
Liang et al.
0.01 TCID50 with rB/HPIV3, rB/HPIV3-F1, rB/HPIV3-F2, rB/HPIV3-F3, and rB/HPIV3-F6. The plates were incubated at 32°C. Aliquots of cell culture medium (0.5 ml out of 2 ml total) were harvested and replaced at 24-h intervals and virus titers (log10 TCID50/ml) were determined by serial dilution on LLC-MK2 cells and hemadsorption assay (52). Mean titers with the standard errors of the mean (SEM) are shown. The statistical significance between the titer of each rB/HPIV3-RSV F virus versus the empty rB/HPIV3 vector on day 2 was determined by using the Student t test and is indicated by asterisks as follows: *, P ⱕ 0.05; **, P ⱕ 0.01; ***, P ⱕ 0.001; or ns, not significant.
strain). Nasal turbinate and lung tissues were harvested separately for virus quantification by serial dilution on LLC-MK2 cells (rB/HPIV3-RSV F viruses) or plaque assays on Vero cells (RSV) (27, 37). Sera were collected from hamsters 3 days prior to and 28 days after inoculation. Titers of RSV- and HPIV3-specific neutralizing antibodies (NAbs) were determined by complement-enhanced 60% plaque reduction neutralization assay on Vero cells (38). Challenge was performed by intranasal infection with 106 PFU of RSV in 0.1 ml at 31 days after immunization. The viral loads of the challenge RSV in the nasal turbinates and lungs were determined 3 days after challenge by plaque assays on Vero cells. Double-staining plaque assays. Plaques of rB/HPIV3 RSV-F viruses were detected on infected Vero cell monolayers by immunostaining with RSV F-specific MAbs, as previously described (27). Wells containing fewer than 50 plaques were chosen for quantification, and the positions of plaques were marked with a pen on the back of the plates. After a washing step with 1⫻ PBS to remove the peroxidase substrate, immunostaining was performed on the same plates using HPIV3 hyperimmune serum diluted 1:1,000, followed by anti-rabbit horseradish peroxidase-conjugated antibody (KPL) diluted 1:1,000 and 4 CN peroxidase detection. Plaques that had not been stained with the RSV-specific antibody and only became evident with HPIV3 hyperimmune serum were identified and were indicative of a loss of RSV F expression. From the total number of plaques, the percentage positive for RSV F was calculated. Deep sequencing. The RSV F inserts in rB/HPIV3-F3 and -F6 virus present in a hamster lung or nasal turbinate tissue suspension, respectively, were amplified by RT-PCR, together with approximately 150 to 200 nucleotides of flanking vector gene sequence on either side, using the Advantage HF 2 PCR kit (Clontech). PCR primers for rB/HPIV3-F3 were ACCTAGCGGGAGGACATCC and GGTGATGCTCATTGTTTCGG AGG; the primers for rB/HPIV3-F6 were CAGCTGGATATACAACAAC AAGCTGC and TTGGAACATTTCACTAGACATCTCTGG. PCR products were analyzed using an Ion-Torrent sequencer according to the manufacturer’s instructions (Life Technologies).
RESULTS
Generation of recombinant chimeric rB/HPIV3 viruses bearing the RSV F ORF as an additional gene. We constructed a series of rB/HPIV3 viruses in which the RSV F ORF was placed under the control of a set of BPIV3 gene-start (GS) and gene-end (GE) signals and inserted as the first (pre-N, rB/HPIV3-F1), second (N-P,
4240
jvi.asm.org
rB/HPIV3-F2), third (P-M, rB/HPIV3-F3), and 6th (HN-L, rB/ HPIV3-F6) gene in the rB/HPIV3 genome (Fig. 1). As shown in Fig. 1, we designed the RSV F insert in the F2, F3, and F6 constructs so that the gene junction preceding the next downstream vector gene was unchanged (this could not be done for F1 because BPIV3 N is not normally preceded by a gene junction). This would avoid changes in stop-start transcription leading into the vector gene, and should eliminate this as a possible cause of altered downstream expression. All constructs were designed to conform to the “rule of six” (30). In addition, the hexamer phasing was maintained for each B/HPIV3 gene, and the phasing for each RSV insert was consistent with its gene position (31). The rB/HPIV3RSV F viruses were readily recovered by reverse genetics. The sequence of each virus was confirmed in its entirety except for the last 30 and 120 nucleotides at the 3= and 5= terminal ends, respectively, confirming the lack of adventitious mutations. Replication of rB/HPIV3-RSV F viruses in vitro. Multistep growth kinetics were determined in LLC-MK2 and Vero cells (Fig. 2). Monolayers were infected at an MOI of 0.01 TCID50 and incubated at 32°C. Medium supernatant was harvested at 24-h intervals over a 5-day period, and virus titers were determined by TCID50 assay. In both cell types (Fig. 2A and B), replication of the empty rB/HPIV3 vector was significantly more rapid than the F1, F2 and F3 viruses during the period of exponential growth (e.g., day 2). In MK2 cells, the F6 virus replicated slightly slower than the empty rB/HPIV3 vector during exponential growth, but faster than the F1, F2 and F3 viruses (Fig. 2A); in Vero cells, F6 replicated at a rate similar to empty rB/HPIV3 vector, and faster than the F1, F2, and F3 viruses (Fig. 2B). These observations suggested that insertion of RSV F at position 6 was less restrictive than at positions 1, 2 and 3 in vitro. Also, in both cell types, replication of F3 virus during exponential growth was significantly slower than the other viruses, suggesting the F3 virus was more restricted. All vectors grew to final titers (day 5) higher than 8.4 log10 TCID50/ml in LLC-MK2 cells (Fig. 2A) and 8.2 log10 TCID50/ml in Vero cells (Fig. 2B). The highest titers were observed with the empty vector and the F1 and F2 viruses, while the final titers of the
Journal of Virology
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
FIG 2 (A and B) Multistep growth kinetics in LLC-MK2 (A) and Vero (B) cells. Triplicate wells of cell monolayers in six-well plates were infected at an MOI of
Live-Attenuated B/HPIV3-Vectored RSV Vaccines
infected at an MOI of 10 TCID50. Total cell lysates were harvested at 48 h p.i. and analyzed by Western blotting under denaturing or reducing conditions. The experiment was performed with a total of four wells per virus in two independent experiments. (A) Representative example of the Western blot profiles visualized by reaction with fluorescent antibodies and detected by infrared imaging, with positions indicated for viral proteins and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as a loading control. Lanes 1 to 6 are identified by the corresponding rB/HPIV3 vector or mock-infection. (B) Relative level of RSV F expression from the blot in panel A, normalized to expression by the F6 virus set at 1.0. (C to E) Relative levels of expression of the HPIV3 HN (C), BPIV3 P (D), and BPIV3 N (E) proteins normalized to the F6 vector set at 1.0; plotted data were obtained from the four samples in two experiments per virus, and error bars represent the SEM. Bars marked 1 to 6 correspond to lanes 1 to 6 in panel A.
F3 virus in particular were lower. The Tukey-Kramer multiple comparison test showed that several of the differences were significant: the peak titer of the empty vector (9.7 log10 TCID50/ml) in LLC-MK2 cells (Fig. 2A) was significantly higher than the F3 (8.4 log10 TCID50/ml, P ⬍ 0.01) and F6 (8.7 log10 TCID50/ml, P ⬍ 0.05) viruses. The peak titer of the F2 virus (9.2 log10 TCID50/ml) in Vero cells (Fig. 2B) was significantly higher than the F3 (8.2 log10 TCID50/ml, P ⬍ 0.05) and F6 (8.2 log10 TCID50/ml, P ⬍ 0.05) viruses, but none of the peak titers in Vero cells of the rB/ HPIV3-RSV F viruses were statistically different from the empty vector. Expression of RSV F and vector proteins by the rB/HPIV3RSV F viruses. Expression of RSV F and vector proteins was determined by Western blotting of infected Vero cell lysates in two experiments involving four monolayers per virus (Fig. 3). The findings reported below for Vero cells also were reproduced in LLC-MK2 cells (data not shown). RSV F is synthesized as an F0 precursor that is cleaved twice by cellular protease to generate disulfide-linked F1 and F2 chains (39). Both the uncleaved 70kD F0
April 2014 Volume 88 Number 8
precursor and the cleaved 48kD F1 chain of RSV F were detected under these conditions (Fig. 3A). As expected, expression of RSV F was greater when its gene was inserted at an earlier position in the rB/HPIV3 genome. In one experiment in Vero cells, compared to the level of RSV F expressed by the F6 virus, that expressed by the F1, F2, and F3 viruses was increased 30-fold, 15-fold, and 5-fold, respectively (Fig. 3A, lanes 2 to 5; Fig. 3B). In a second experiment in Vero cells, the relative values were 69-, 29-, and 6-fold (not shown). We also examined the expression of the vector HPIV3-derived HN protein and the vector BPIV3-derived N and P proteins using antibodies against HPIV3, which cross-reacted with the BPIV3 proteins. This showed that the insertion of RSV F reduced the expression of downstream genes but had little effect on the expression of upstream genes (Fig. 3A, C, D, and E). Thus, the F1 insert reduced expression of the vector N, P, and HN genes. The F2 insert reduced expression of the P and HN genes. The F3 insert reduced expression of the HN gene, and the F6 insert did not affect the expression of the N, P, or HN genes. The level of reduction of
jvi.asm.org 4241
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
FIG 3 Western blot analysis of the expression of RSV F, HPIV3 HN, and BPIV3 P and N proteins in Vero cells infected with the rB/HPIV3 vectors. Cells were
Liang et al.
rB/HPIV3-F6, or wt RSV at an MOI of 5 TCID50 for the rB/HPIV3 vectors and 5 PFU for wt RSV. At 24 h p.i., infected cells were harvested and stained with Far-Red Live/Dead dye and AF488-conjugated anti-RSV F MAb without permeabilization as described in Materials and Methods. The cell population was gated to include only single, live cells. (A) Histogram plot of RSV F expression. The x axis shows intensity of RSV F expression, and the y axis is the percentage of cell count normalized to the maximum count (100%) in a distribution. Gating of RSV F-positive cells is indicated by the box with dashed lines. (B) Median fluorescence intensity (MFI) of RSV F expression on the surface of RSV F⫹ gated cells (gate shown in panel A).
downstream expression was reproducibly greater for the F3 virus, implying that this insert had a particularly greater effect on the transcriptional gradient. Expression of RSV F on the cell surface was analyzed by flow cytometry. Unpermeabilized, infected Vero cells (MOI ⫽ 5 TCID50) were stained with AF488-conjugated RSV F antibody at 24 h p.i. Similar to the total RSV F protein expression detected by Western blotting (Fig. 3), the surface expression of RSV F was stronger when it was inserted at sites closer to the 3= leader (Fig. 4A
and B). Later time points could not be reliably evaluated because the extensive syncytia formed by the F1 and F2 viruses (see below) were excluded by the gating parameters, thus excluding the cells with the greatest expression of RSV F. A characteristic of RSV infection in monolayer cell cultures is the formation of syncytia mediated by RSV F, while extensive syncytium formation is not typically observed in B/HPIV3-infected cultures (Fig. 5A). The formation of syncytia by rB/HPIV3 expressing RSV F from different positions was monitored on Vero
FIG 5 Formation of syncytia on cell monolayers infected with the rB/HPIV3 vectors. Vero cells were infected at an MOI of 10 TCID50 for 48 h, at which time syncytium formation was captured under a light microscope. Photomicrographs of the empty rB/HPIV3 vector (A), rB/HPIV3-F1 (B), rB/HPIV3-F2 (C), rB/HPIV3-F3 (D), rB/HPIV3-F6 (E), and mock infection (F) are shown. Representative syncytia are marked by dotted lines in panels B and C.
4242
jvi.asm.org
Journal of Virology
Downloaded from http://jvi.asm.org/ on March 24, 2015 by SUNY HSCB MEDICAL RESEARCH LIBRARY
FIG 4 Expression of RSV F on the surface of cells infected with the rB/HPIV3 vectors. Vero cells were infected with rB/HPIV3-F1, rB/HPIV3-F2, rB/HPIV3-F3,
Live-Attenuated B/HPIV3-Vectored RSV Vaccines
TABLE 1 Temperature sensitivity of recombinant viruses on LLC-MK2 cell monolayersa
35°C
36°C
37°C
38°C
39°C
40°C
rB/HPIV3 rB/HPIV3-F1 rB/HPIV3-F2 rB/HPIV3-F3 rB/HPIV3-F6
6.9 7.6 7.6 6.8 7.5
6.6 7.6 7.5 6.9 7.3
6.4 7.5 7.4 6.2 7.5
6.6 7.5 7.2 5.7 7.2
6.4 6.7 6.5
