brain research 1594 (2015) 293–304

Available online at www.sciencedirect.com

www.elsevier.com/locate/brainres

Research Report

Human umbilical cord mesenchymal stem cells protect against ischemic brain injury in mouse by regulating peripheral immunoinflammation Qiantao Chenga,b,1, Zhuo Zhanga,c,d,1, Shenyang Zhanga,c,d, Hui Yanga,c,d, Xin Zhanga,c,d, Jie Pana,c,d, Leihua Wenga,c,d, Dujuan Shaa,c,d, Min Zhua,f, Xiang Hug, Yun Xua,c,d,e,n a

Department of Neurology, Affiliated Drum Tower Hopital, Nanjing University Medical School, PR China Department of Neurology, Affiliated Huai'an First People's Hospital of Nanjing Medical University, Huai'an, Jiangsu Province, PR China c Jiangsu Key Laboratory for Molecular Medicine, Nanjing University Medical School, Nanjing, PR China d Jiangsu Province Stroke Center for Diagnosis and Therapy, PR China e Nanjing Neuropsychiatry Clinic Medical Center, PR China f Department of Neurology and Rehabilitation, Nanjing Children's Hospital of Nanjing Medical University, Nanjing, PR China g Shenzhen Beike Stem cell Engineering Institute, PR China b

art i cle i nfo

ab st rac t

Article history:

Current treatments for ischemic stroke are limited, stem cell transplantation offers great

Accepted 28 October 2014

potential as a therapeutic strategy. The present study was undertaken to determine

Available online 6 November 2014

whether human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) could

Keywords:

improve brain injury after middle cerebral artery occlusion (MCAO) through modulating

Human umbilical cord-derived

peripheral immunoinflammation. The study showed that neurological deficit was amelio-

mesenchymal stem cells (hUC‐MSCs)

rated and brain edema, infarct volume was significantly decreased from 72 h to 1 week

Stroke

post-MCAO with hUC-MSCs treatment via tail vein injection within 30 mins after stroke;

Neuroimmunology

hUC-MSCs attenuated the levels of inflammatory factors including IL-1, TNF-α, IL-23, IL-17

Transplantation

and IL-10 in peripheral blood serum and ischemia hemisphere after stroke; hUC-MSCs significantly decreased the level of Th17 cells at 24 h and increased the level of Tregs at 72 h post-MCAO in peripheral immune system; the level of TGF-β in blood serum was enhanced by hUC-MSCs. In conclusion, our findings suggested that hUC-MSCs had neuroprotection in MCAO mice by TGF-β modulating peripheral immune and hUC-MSCs may be as a potential therapy for ischemic stroke. & 2014 Elsevier B.V. All rights reserved.

n Correspondence to: Department of Neurology, Affiliated Drum Tower Hospital, Nanjing University Medical School, 321 ZhongShan Road, Nanjing City, Jiangsu Province 210008, PR China. Fax: þ86 25 68182155. E-mail address: [email protected] (Y. Xu). 1 Contributed equally to this work.

http://dx.doi.org/10.1016/j.brainres.2014.10.065 0006-8993/& 2014 Elsevier B.V. All rights reserved.

294

1.

brain research 1594 (2015) 293–304

Introduction

Stroke is the second leading cause of death worldwide and represents a significant public health burden (Kim and Johnston, 2013). Ischemic stroke accounts for approximately 70–80% of all cases, and treatment options are limited. Brain tissue is sensitive to oxygen and glucose deprivation (OGD), and arterial occlusion can result in neuronal death from the disruption of cerebral blood flow following a complex sequence of events. Both human and animal studies have shown that the activation of the immune system plays an important role in the pathophysiology of stroke (Macrez et al., 2011). Severe ischemia triggers an inflammatory cascade and oxidative stress, inducing the breakdown of the blood–brain barrier and resulting in the infiltration of peripheral immune cells into brain tissue. During the hyperacute and acute phases of ischemia, danger-associated molecular patterns (DAMPs) released from damaged cells and extracellular peroxiredoxin activate infiltrating macrophages, leading to the release of inflammatory cytokines such as interleukin (IL)-1, tumor necrosis factor (TNF)-α, IL-23 and IL-17 (Shichita et al., 2012a). Finally, injured resident brain cells and impregnated leukocytes produce various inflammatory cytokines and mediators that aggravated post-ischemic inflammation and injury. T lymphocytes can be detected in the infarction boundary zones 24 h after reperfusion and play important roles in the delayed phase of brain ischemia (Jander et al., 1995; Schroeter et al., 1994). CD4þ helper T (Th) and CD8þ cytotoxic T lymphocytes (CTL) as well as γδT cells exacerbate neuronal damage (Kleinschnitz et al., 2010; Shichita et al., 2009) by releasing the pro-inflammatory cytokines IL-1,–17, and -23 and TNF-α, whereas regulatory T (Treg) cells play a neuroprotective role following stroke through the secretion of antiinflammatory cytokines such as IL-10 and transforming growth factor (TGF)-β (Jin et al., 2010; Liesz et al., 2009). Moreover, activated cells in the central nervous system (CNS) also produce pro-inflammatory mediators for the recruitment of T cells (Lakhan et al., 2009). The T cell cytokine IL-17 is closely associated with experimental autoimmune encephalomyelitis, a T cell-mediated CNS inflammation model (Lakhan et al., 2009). IL-17 has been shown to exacerbate neuronal injury induced by OGD in vitro in a dosedependent manner (Wang et al., 2009), and is more central to ischemia/reperfusion (I/R) injury than the cytokine interferon γ (Shichita et al., 2009). IL-17 is produced by γδT and Th17 cells. The γδT cells appear in the infarct boundary zones at early phase after I/R, as the major source of IL-17 in acute phase of stroke. The proportion of γδT cells in T lymphocytes is only 1–10% in peripheral blood (Gelderblom et al., 2012). After a few days of T lymphocyte infiltration, Th17 cells became the main source of IL-17 (Swardfager et al., 2013). The production of IL-17 depends on the stimulation by IL-23, which is released by macrophages (Chen et al., 2006; Langrish et al., 2005). A greater resistance to I/R injury is conferred by deficiency of IL-23 compared to IL-17 in mouse models (Shichita et al., 2009); however, the regulation of the CNS inflammatory response by both cytokines promotes the progression of ischemia. Besides IL-23, TNF-α and IL-1 produced by microglia can also stimulate IL-17 secretion by lymphocytes even in the absence of T cell receptor stimulation (Sutton et al.,

2006). In contrast, IL-10 has been shown to ameliorate brain damage induced by Treg cell depletion and prevent secondary infarction (Liesz et al., 2009); thus, the activation of Treg cells can be beneficial for post-stroke rehabilitation. The transplantation of pluripotent stem cells is a promising strategy for the treatment of stroke. Given the ethical considerations, human umbilical cord mesenchymal stem cells (hUC-MSCs) offer the best option for cell therapy, as they can be obtained painlessly in abundance, express low levels of human leukocyte antigen 1, have high immune tolerance, and possess stemness properties (Chao et al., 2012). Our previous study demonstrated that hUC-MSCs improved behavioral functions and histopathological injury in autoimmune encephalomyelitis mice through the regulation of immunoinflammation and remyelination (Liu et al., 2013). Other studies have demonstrated that hUC-MSCs transplantation can significantly alleviate ischemic injury in a mouse model of middle cerebral artery occlusion (MCAO) by differentiating into neurons and astrocytes, thereby enhancing plasticity (Ding et al., 2007), and by secreting factors that promote neuroprotection, neurogenesis, and angiogenesis (Hsieh et al., 2013). Although the mechanisms underlying these functions are not fully understood, some can be attributed to anti-inflammatory effects (Wang et al., 2012, 2013). For instance, transplantation of hUC-MSCs can ameliorate acute lung injury by increasing the number of Treg cells and balancing anti- and pro-inflammatory factors in an endotoxin-mediated experimental model (Sun et al., 2011). Treatment of intracerebral hemorrhage in rats using hUCMSCs also decreased leukocyte infiltration, microglial activation, ROS levels, and matrix metalloproteinase production (Liao et al., 2009b). Based on these findings, the present study tested the hypothesis that hUC-MSCs can mitigate brain injury from ischemia through regulation of peripheral immunoinflammation.

2.

Results

2.1.

Reduction in stroke-induced brain injury by hUC-MSCs

To characterize the neurological effects of hUC-MSCs treatment, the NSS, measurement of brain water content, and TTC staining were used to assess behavior, brain edema, and infarct volume at 24 h, 72 h and 1w post-I/R, respectively. At 72 h and 1week post-I/R, neurological deficit was improved in hUC-MSCs-treated MCAO mice, compared to those (control) without hUC-MSCs treatment (72 h: 6.370.86 vs. 8.270.77; 1 w: 5.370.66 vs. 7.870.58; Po0.01) (Fig. 1(A)). Brain water content and infarct volume were lower in hUC-MSCs-treated MCAO group at 72 h post-IR, than that in control group (Brain water content: 72 h: 80.971.86 vs. 85.271.219 (%), Po0.01; 1 w- 79.871.18 vs. 83.071.97 (%), Po0.01; Infarct volume: 72 h: 24.174.24 vs. 29.274.33 (%), Po0.05; 1 w- 14.272.07 vs. 19.572.06 (%), Po0.01, respectively. Fig. 1(B) and (C)). These results suggested that hUCMSCs treatment could lead to an improvement in ischemic brain injury.

brain research 1594 (2015) 293–304

295

Fig. 1 – hUC-MSCs alleviated the ischemia-induced brain injury in an animal model of MCAO. (A) Motor and sensory function, reflex, and balance were evaluated and assigned and NSS 24 and 72 h and 1 week after I/R. (B) Brain water content was assessed as a measure of brain edema at the same time points. (C-i) TCC staining was used to assess infarct volume at the same time points; normal tissue and the infarct area were stained deep red and pale gray, respectively. (C-ii) Infarct size was quantified based on the staining patterns represented in panel. Results are shown as mean7SE. nPo0.05 and nnPo0.01 vs. sham; #Po0.05 and ##Po0.01 vs. MCAOþNS (n¼ 10 per group).

2.2. Alterations of levels of inflammatory factors by hUCMSCs treatment in serum IL-1 and TNF-α participate in the amplification and activation of γδT and Th17, while IL-23 is required for sustaining IL-17 production by these cells. IL-10 is a major immune suppressant and mediates neuroprotection. The effect of hUC-MSCs on peripheral blood serum levels of these cytokines was determined by ELISA at 6 h, 12 h, 24 h, 72 h and 1 week after I/R. The hUC-

MSCs decreased the levels of IL-1, TNF-α, IL-23 and IL-17 at 12 h, 24 h, and 72 h post-I/R compared to control group (Fig. 2(A)–(D)). Levels of IL-10 were higher in the hUC-MSCs-treated MCAO group compared to control group at 24 h (6.7470.61 vs. 3.0370.53, Po0.01), 72 h (4.0370.54 vs. 2.4870.36, Po0.05), and 1 week (3.5870.59 vs. 2.3170.47, Po0.05) (Fig. 2(E)). Thus, hUC-MSCs reduced levels of pro-inflammatory cytokines and increased levels of anti-inflammatory cytokines in peripheral blood after ischemia, respectively.

296

brain research 1594 (2015) 293–304

Fig. 2 – hUC-MSCs reduced levels of inflammatory factors and enhanced levels of IL-10 in peripheral blood serum in MCAO mice. Levels of (A) IL-1, (B) TNF-α, (C) IL-23, (D) IL-17, and (E) IL-10 were measured 6, 12, 24, and 72 h and 1 week after I/R by ELISA. Results are shown as mean7SE. *Po0.05 and **Po0.01 vs. sham; #Po0.05 and ##Po0.01 vs. MCAOþNS (n ¼8 per group)

2.3. Reduction of inflammation in ischemic brain by hUC-MSCs To examine the levels of these cytokines of ischemic brain, quantitative PCR was performed within 1 week after I/R. Compared to shams, the expression of IL-1 and IL-23 peaked at 12 h, and the level of TNF-α and IL-17 in ipsilateral brain peaked at 24 h post-MCAO (Fig. 3 However, hUC-MSCs mitigated this effect compared to control, reducing folds change in transcript levels at 12 h, 24 h and 72 h postMCAO (Fig. 3A‐E). It suggested that hUC-MSCs reversed

neuroinflammation resulting from I/R injury by suppressing the production of pro-inflammatory cytokines and enhancing the expression of anti-inflammatory factor.

2.4. Effect of hUC-MSCs on Th17/Treg cells in peripheral immunology system in MCAO mice γδT and Th17 are both the major sources of IL-17 after ischemia, the presence of these cells in the peripheral immunology system (spleen, blood and lymph node) was evaluated by flow cytometry at 24 h, 72 h after I/R. Worth to

brain research 1594 (2015) 293–304

297

Fig. 3 – hUC-MSCs decreased the levels of pro-inflammatory cytokines and enhanced the levels of anti-inflammatory cytokines in the ischemia hemisphere. Transcript expression levels normalized to GAPDH mRNA of (A) IL-1, (B) TNF-α, (C) IL-23, (D) IL-17, and (E) IL-10 in the cortex were measured 6, 12, 24, and 72 h and 1 week after I/R by quantitative PCR. Results are shown as mean7SE. nPo0.05 and nnPo0.01 vs. shamþMSCs; #Po0.05 and ##Po0.01 vs. MCAOþNS (n¼ 8 per group). mention, our results showed very low frequencies of γδT cells in spleen (  4%), and lymph node ( 1%). Moreover, there was only  0.5% and 0.1% proportion of IL-17þ in γδT cells been detected in spleen and lymph node, respectively (data not shown). As Fig. 4 shows, the numbers of Th17 cells were increased in MCAO groups at 24 h (spleen: 4.1970.19 vs. 170.11, Po0.01; blood: 2.0570.15 vs. 170.08, Po0.01; lymph node: 2.0470.14 vs. 170.08, Po0.05. Fig. 4A-D). The hUCMSCs reduced these cells compared to control at 24 h (spleen: 3.22 70.26 vs. 4.1970.19, Po0.05; blood: 0.8370.18 vs. 2.0570.15, Po0.01; lymph node: 0.8270.18 vs. 2.0470.14,

Po0.05. Fig. 4A-D). Thus, hUC-MSCs suppressed populations of T cells which is responsible for the release of proinflammatory factors. Treg cells have an anti-inflammatory, neuroprotective role following MCAO. To determine whether hUC-MSCs can modulate population of Treg, the number of Treg cells in the spleen, blood and lymph node was assessed by flow cytometry at 24 h, 72 h post-I/R. As shown in Fig. 5A-D, the presence of hUC-MSCs significantly increased these numbers compared to control at 72 h post-MCAO (spleen: 1.9970.12 vs. 0.8770.08, Po0.01; blood: 1.7970.11 vs. 0.9070.07, Po0.01;

298

brain research 1594 (2015) 293–304

Fig. 4 – hUC-MSCs reduced numbers of Th17 cells in spleen, blood and lymph node in MCAO mice. The fraction of Th17 cells in the total CD4þ T cell population was measured by flow cytometry at 24 h and 72 h after I/R. (A) Scatterplots from spleen, blood to lymph node are shown. The Th17 cell fraction in (B) spleen, (C) blood and (D) lymph node was quantified. Results are shown as mean7SE. nPo0.05 and nnPo0.01 vs. sham; #Po0.05 vs. MCAOþNS. (n ¼ 8 per group).

lymph node: 1.0870.04 vs. 0.7470.13, Po0.05). These results indicated that hUC-MSCs could enhance T cells involved in neuroprotection following ischemia.

2.5. hUC-MSCs modulating peripheral immunoinflammation by TGF-β TGF-β participated in the process of which Naïve CD4þ Tcells develop into Th17 and Treg (Hemdan et al., 2012; Josefowicz et al., 2012; Kunzmann et al., 2009). We proposed that hUCMSCs modulate the peripheral immune response through the effect of TGF-β, so the serum levels of TGF-β were measured at 24 h, 72 h, and 1week post-MCAO. Although I/R had no effect on TGF-β levels, total TGF-β level was elevated in hUCMSCs-injected MCAO animals, reaching a peak at 24 h (80% higher than NS-injected MCAO animals; Po0.01), and gradually decreasing thereafter (Fig. 6).

To further confirm whether hUC-MSCs could upregulate TGF-β, TGF-β neutralizing antibody (eBioscience, #16-9243) was used. The results showed that the TGF-β antibody, at partially, block the effect of hUC-MSCs significantly increased the number of Th17 cells at 24 h and decreased Treg cells at 72 h post-I/R, compared to the hUC-MSCs-treated MCAO mice (hUC-MSCsþTGF-β vs hUC-MSCs: Th17: blood: 0.92570.058 vs. 0.75370.049; LN: 3.05370.158 vs. 1.41970.079; spleen: 1.55870.068 vs. 1.047970.047; Treg: blood: 0.89670.058 vs. 1.38570.079; LN: 0.92270.058 vs. 1.13170.069; spleen: 0.73970.058 vs. 0.85170.079. Fig. 7A-B). Moreover, this antibody eliminated the neuroprotection of hUC-MSCs from ischemia injury (water content: 82.34571.321 vs. 79.76371.132 (%); infarct volume: 26.2671.18 vs. 21.1471.143 (%), respectively, Fig. 7C). Interestingly, a single injection of hUC-MSCs in sham mice had also 16.74% higher level of TGF-β than sham group; Due to the homology between human- and

brain research 1594 (2015) 293–304

299

Fig. 5 – hUC-MSCs increased numbers of CD4þCD25þFoxp3þ Treg cells in spleen, blood and lymph node in MCAO mice. The fraction of Treg cells in the total CD4þ T cell population was measured by flow cytometry at 24 h and 72 h after I/R. (A) Scatterplots from spleen, blood to lymph node are shown. The Treg cell fraction (B) spleen, (C) blood and (D) lymph node was quantified. Results are shown as mean7SE. nPo0.05 vs. sham; #Po0.05 and ##Po0.01 vs. MCAOþNS (n ¼ 8 per group). mouse-derived TGF-βis 99%, these results indicated that hUCMSCs may increase the level of TGF-β not only through autocrine but also regulating endogenous secretion, to modulate the peripheral immunoinflammation.

3.

Discussion

Many studies indicate that hUC-MSCs treatment can promote functional recovery and reduce infarction in animal models of MCAO (Ding et al., 2007; Hsieh et al., 2013; Liao et al., 2009a). This was supported by the results of the present study, in which hUC-MSCs were administrated by intravenous tail injection within 30 min after I/R. The observed

reduction in infarct size and brain edema, accompanied by an improvement in neurological outcome suggests that the beneficial effects of hUC-MSCs after stroke are not limited to their proliferative capacity and multilineage differentiation potential (Fig. 1). The immunomodulation effect of hUC-MSCs was evidenced by the down-regulation of the proinflammatory cytokines IL-1, -17, -23 and TNF-α and concomitant up-regulation of production of the antiinflammatory factor IL-10 in peripheral blood serum and ischemia hemisphere (Figs. 2 and 3). The populations of IL-17-releasing T cells (Th17) in spleen, blood and lymph node were correspondingly reduced at 24 h post-MCAO, while the number of IL-10-producing Treg cells was increased at 72 h post-MCAO by hUC-MSCs treatment (Figs. 4 and 5).

300

brain research 1594 (2015) 293–304

Fig. 6 – hUC-MSCs increased serum levels of TGF-β in MCAO mice. Levels of human/mouse-derived TGF-β were measured by ELISA at 24 h, 72 h and 1 week after I/R. Results are shown as mean7SE. nPo0.05 and nnPo0.01 (n ¼8 per group). Moreover, hUC-MSCs could enhanced the level of TGF-β through autocrine and modulating endogenous secretion (Figs. 6 and 7). Taken together, these findings demonstrate that hUC-MSCs can attenuate or reverse ischemia-induced brain injury by regulating the peripheral immunoinflammatory response. Experimental induction of stroke produces a core of dead neurons, but also causes apoptosis of damaged but partially functional neurons in the ischemic penumbra (Sairanen et al., 2006). The fate of these neurons is influenced by post-ischemic inflammation, specifically by the balance between pro- and antiinflammatory cytokines (Shichita et al., 2012b). IL-17, which is upregulated under ischemia, acts on receptors in astrocytes, microglia, and neurons (Wang et al., 2009), the latter leading to the activation of multiple second messenger systems such as those involving nuclear factor (NF)-κB and glycogen synthase kinase 3β, which has been shown to mediate neuronal apoptosis (Hetman et al., 2000; Zepp et al., 2011). NF-κB is implicated in microglia activation, which leads to the secretion of proinflammatory factors and adhesion molecules that exacerbate parenchymal inflammation in the delayed phase of ischemia (Zepp et al., 2011). Thus, suppressing the secretion of IL-17 is presumed to constitute an effective therapeutic strategy. The present results showed that compared to control, IL-17 levels in the serum and ipsilateral brain of hUC-MSCs-treated MCAO mice were downregulated, corresponding to the smaller numbers of Th17 cells in the spleen, peripheral blood and lymph node as determined by flow cytometry. The release of IL-17 and differentiation of Th17 from naïve T cells can also be stimulated by TNF-α and IL-1 (Weaver et al., 2007). Expression of these cytokines is detected within 1 h of ischemia, and both are known to directly induce neuronal apoptosis; in addition, IL-1 enhances chemokine expression in microglia and astrocytes while TNF-α attracts infiltrating leukocytes (Shichita et al., 2012b). In this study, the expression of IL-1 and TNF-α was detected in the serum and brain within 1 week after ischemia, which was downregulated in the delayed phase in the presence of hUCMSCs, corresponding to the time period during which reduced

brain edema and infarct volume were observed in the treatment group. Thus, the present results are consistent with previous studies demonstrating that suppression of IL-1 and TNF-α can reduce brain injury resulting from ischemia. During the first 24 h after stroke, DAMPs activate toll-like receptors on microglia, promoting the release of inflammatory cytokines, chemokines, and nitric oxide, leading to the activation of the vascular endothelium and production of additional inflammatory factors that result in the entry of peripheral leukocytes into the parenchyma. After this initial response, invading macrophages are activated by DAMPs and release IL-23, while hypoxia inducible factor 1α induces the production of IL-23 by astrocytes, thereby activating microglia; subsequently, microglia and encephalitogenic γδT cells release IL-17 (Swardfager et al., 2013). Thus, IL-23 regulates IL-17 production, and suppressing IL-23 decreases IL-17 levels, leading to a better post-ischemic outcome; the reduced IL-23 expression in the treatment group (Figs. 2 and 3) can therefore partly account for the alleviation of I/R-induced neurological injury by hUC-MSCs. IL-10 is an immune suppressant and mediates neuroprotection (Singh et al., 2013); The overexpression of IL-10 had an anti-apoptotic effect in hippocampal neurons (Ooboshi et al., 2005). Here, it was observed that the level of IL-10, as well as the number of IL-10-producing Treg cells, was increased by hUC-MSCs treatment (Figs. 2, 3, 5). Thus, in addition to suppressing pro-inflammatory cytokines, hUC-MSCs concomitantly stimulate anti-inflammatory factors that protect the brain from post-ischemic injury. TGF-β is a major regulator of cell proliferation and differentiation in many tissues, and is produced by various cell types including human amniotic membrane-derived mesenchymal stem cells, Treg and macrophages (Kang et al., 2012). It has been shown to mediate differentiation of Treg and Th17 cells in vitro and in vivo in a context-dependent manner (Chen et al., 2003; Kretschmer et al., 2005; Mucida et al., 2005). In the presence of IL2, TGF-β regulates Treg cell development, possibly via stimulation of Foxp3 expression (Chen et al., 2003; Josefowicz et al., 2012), while in cooperation with IL-1, -6, and -23 and TNF-α, Th17 cells are promoted (Bettelli et al., 2006; Hemdan et al., 2012; Laurence et al., 2007; Manel et al., 2008; Veldhoen et al., 2006; Zuniga et al., 2013), in part through induction of IL-23 receptor expression (O'Shea et al., 2009). Significantly, this study found that the total levels of TGF-β were enhanced by hUC-MSCs through autocrine and modulating endogenous secretion of mice (Figs. 6 and 7). Taken together, we conclude that hUC-MSCs regulate peripheral immune by shifting the Th17/Treg differentiation from Naïve CD4þ T cells through modulating the production of TGF-β. Moreover, because the development of Treg cells is stimulated by a high concentration of TGF-β and TGF-β is released by Treg cells, the differentiation of Treg cells and TGF-β production constitute a positive feedback loop that is further amplified by the suppression of γδT cells by Treg cells (Kunzmann et al., 2009). That is, the suppression effect of Treg strengthened the modulation of hUC-MSCs on peripheral immune response.

4.

Conclusion

In summary, the hUC-MSCs have neuroprotection against ischemic stroke through modulating TGF-β, which shifts the

brain research 1594 (2015) 293–304

301

Fig. 7 – TGF-β neutralizing antibody partly eliminated effect of hUC-MSCs. Number of Th17 at 24 h and Treg at 72 h post-I/R in peripheral immune system were measured by FACS, respectively. The brain edema and infarct volume were tested by water content and TTC staining. Results are shown as mean7SE. nPo0.05 and nnPo0.01 vs. MCAOþNS; #Po0.05 and ##Po0.01 MCAOþhUC-MSCs vs. MCAOþanti-TGF-βþhUC-MSCs (n ¼5 per group). Th17/Treg differentiation from Naïve CD4þ T cells and regulates peripheral immune response. Future studies will address whether the beneficial effects of hUC-MSCs can lead to long-term recovery from MCAO-induced brain injury.

5.

Experimental procedures

5.1.

Experimental animals

6–7-week-old male mice weighting 25–30 g were provided by the Drum Tower Hospital Animal Center, protocols were

approved by the Committee of Experimental Animal Administration of Nanjing University.

5.2.

Preparation of focal cerebral ischemia model

Focal cerebral ischemia was induced by middle cerebral artery occlusion (MCAO) as previously described (Xu et al., 2006). Briefly, All mice were anaesthetized with Sodium Pentobarbital (1%) by intraperitoneal injection at a dose of 45 mg/kg. A middle cervical incision was made under a dissecting microscope and then the right common carotid artery and extental carotid artey were isolated. A poly- L-lysine coated nylon monofilament

302

brain research 1594 (2015) 293–304

thread (3/0gauge with the tip heat blunted to a diameter of 0.104 mm) was inserted through the external carotid artery and advanced into the internal carotid artery to occlude the origin of the middle cerebral artery (approximately 12 mm). Body and head temperatures were controlled at 3770.5 1C with a homeothermic blanket and water pads. After 90 min of occlusion, the filament was withdrawn for reperfusion. Sham-treated mice were subjected to the same procedure without MCAO.

5.3.

Preparation and transplantation of hUC-MSCs

hUC-MSCs were supplied by Shenzhen Beike Stem cell Engineering Institute as previous described (Liu et al., 2013). The passages 2–3 of hUC-MSCs for this study were used and a single injection of 4  106 ml in 0.5 ml normal saline (NS) or same volume of NS (control group) via the tail vein was operated within 30 min after I/R. For block study, the TGF-β neutralizing antibody (eBioscience, #16-9243) were used though i.p. injection at a dose of 1 mg/kg (Anscher et al., 2006), 20 min before hUCMSCs treatment (n¼5 per group).

5.4. Measurement of behavior, brain edema and infarct volume 5.4.1.

Behavior test

The Neurological Severity Scores (NSS), including of motor, sensory, reflex and balance tests, were used to evaluated the neurological function of the mice at 24 h, 72 h and 1w after MCAO (n¼10 per group), as previously described (Chen et al., 2010). Neurological function was graded on a scale of 0–18: 1–6, mild injury; 7–12, moderate injury; 13–18, severe injury. One point was awarded for the inability to perform the tasks or for the lack of a tested reflex.

5.4.2.

Brain edema test

At 24 h, 72 h and 1w after MCAO, the brains were quickly removed, the wet weight (wW) of the ischemia hemisphere were weighted using an electronic analytic balance. Then, dry weight (dW) was obtained after 24 h drying the tissue in the 100 1C incubator. The brain water content was calculate according the formula: brain water content (%)¼(wWdW)/ wW  100%, n ¼10 per group.

5.4.3.

5.6.

ELISA assays for cytokines

Mouse cytokine ELISA kits (R&D Systems, Minneapolis, MN, USA) were used to detect levels of IL-1 (MLB00C), IL-10 (M1000), IL-17 (M1700), IL-23 (M2300), and TNF-α (MTA00) in serum of all groups (n¼ 8 per group), as previously described (Liu et al., 2013). For the detection of total TGF-β in serum, because of 99% homology between human and murine proteins, human/mouse TGF-β ELISA kit were employed (eBioscience, 88-8350), n¼ 8 per group. Briefly speaking, 100 μl of samples or standards were added to each well of 96-well plates coated with anti-mouse cytokines antibody. The plates were incubated at 37 1C for 90 min and then washed 5 times. 100 μl of biotinylated cytokine specific antibody was added into each well and incubated at 37 1C for 60 min. Plates were then washed, treated with 100 μl of diluted streptavidin-HRP and incubated at 37 1C for 30 min. After washing, the color was produced by addition of 100 μL substrate solution for 10–15 min. Finally, 100 μL of stop solution was added to terminate reaction. Optical density was measured at 450 nm within 10 min (Liu et al., 2013).

Infarct volume measurement

The brains were removed and sectioned into 5 slices (2 mm thickness) at 24 h, 72 h1, 1week post-MCAO. Infarct volumes were measured by staining with 2,3,5-triphenyterazoliumchloride (TTC), as previously described (Niu et al., 2012). Briefly speaking, slices were photographed with a computercontrolled digital camera (Olympus, DP70) and infarct size was evaluated by Image-Pro Plus (IPP 6.0). To eliminate the effect of brain swelling, the result of infarct volume was shown as a percentage of the contralateral hemisphere (Niu et al., 2012), n ¼10 per group.

5.5.

respectively. For Th17 analysis, samples were stained with a combination of the following mAbs (eBiosciences): CD3-APC (17-0031), CD4-FITC (11-0041); And then cells were stimulated with 25 μg/ml PMA(Sigma), 1 μg/ml lonomycin, 10 μg/ml BFA (ALEXIS), and incubated at 37 1C and 5% CO2 for 4 h. After stimulation, fluorescently labeled anti-mouse monoclonal antibodies IL-17-PE (eBiosciences, 12-7471) were used for FACS assay. For CD4þCD25þ regulatory T cells (Tregs) analysis, samples were stained with mouse regulatory T cell staining kit (eBioscience, Cat. NO.88-8111). Briefly speaking, cells were surface stained with anti-mouse CD4-FITC (RM4-5) and anti-mouse CD25-APC (PC61.5), then fixed and permeabilized using the Foxp3 staining buffers and subsequently stained with anti-mouse Foxp3-PE (FJK-16s). Identification of T lymphocytes phenotyping was performed by three-color flow cytometry on a FACSCantoTM machine using BD FACS Dvia Software (BD Biosciences). In each experiment, cells were stained with isotype control Ab to establish background staining and to set quadrants before calculating the percentage of positive cells (Liu et al., 2013).

5.7.

Real-time PCR

Real-time PCR was performed as described previously (Liu et al., 2013). Total RNA was extracted by using the Trizol reagent (Takara) and was reverse-transcribed into cDNA using a PrimeScript RT reagent kit (Takara) for Quantitative PCR (ABI 7500, USA) in the presence of a fluorescent dye (SYBR Green I; Takara), n ¼8 per group. The relative abundance of mRNA was calculated after normalization to glyceraldehyde-3-phosphate dehydrogenase ribosomal RNA. The primers (Invitrogen, USA) were as follows:

Flow cytometry assays

Peripheral immunology system (spleens, peripheral blood and lymph nodes) was removed at 24 h, 72 h post-MCAO (n ¼8 per group), and single-cell suspensions were obtained

IL-1β, F: AAGCCTCGTGCTGTCGGACC, R: TGAGGCCCAAGGC CACAGGT; IL-10, F: GGCATGAGGATCAGCAGGGGC, R: TGGCTGAAG GCAG

brain research 1594 (2015) 293–304

TCCGCAG; IL-17, F: ACCTCA ACCGTTCCACGTCA, R: CAGGGTCTTC ATTGCGGTG; IL-23, F: CCAGCAGCTCTCTCGGAATC, R: TCATATGTCCCG CTGGTGC; TNF-α, F: CAAGGGACAAGGCTGCCCCG, R: GCAGGGGCTC TTGA CGGCAG

5.8.

Statistical analysis

Data was retrieved and processed using the Microcal Origin 8.0 software program. The group data was expressed as the mean7standard error. Dependent variables (NSS and infarction volume) were analyzed by analysis of variance (ANOVA) with condition (time after I/R). Dependent variables (levels of various inflammation factors and T lymphocytes) were analyzed using two-way ANOVAs with the Bonferroni's post-hoc comparisons as the between-subjects factor. The statistical analysis was performed using SPSS 15.0 software. A probability of Po0.05 was considered to be significant.

Acknowledgment This study was supported by the National Natural Science Foundation of China (81100863, 81230026, 81171085, 81000510 and 81401864), the Natural Science Foundation of Jiangsu Province (BL2012013), the Medical Leading Talent and Innovation Team Project of Jiangsu Province (LJ201101), and the Grant from the Jiangsu Key Laboratory for Molecular Medicine (BM2007208).

r e f e r e n c e s

Anscher, M.S., Thrasher, B., Rabbani, Z., Teicher, B., Vujaskovic, Z., 2006. Antitransforming growth factor-beta antibody 1D11 ameliorates normal tissue damage caused by high-dose radiation. Int. J. Radiat. Oncol. Biol. Phys. 65, 876–881. Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T.B., Oukka, M., Weiner, H.L., Kuchroo, V.K., 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441, 235–238. Chao, Y.H., Wu, H.P., Chan, C.K., Tsai, C., Peng, C.T., Wu, K.H., 2012. Umbilical cord-derived mesenchymal stem cells for hematopoietic stem cell transplantation. J. Biomed. Biotechnol. 2012, 759503. Chen, W., Jin, W., Hardegen, N., Lei, K.J., Li, L., Marinos, N., McGrady, G., Wahl, S.M., 2003. Conversion of peripheral CD4þCD25  naive T cells to CD4þCD25þ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med. 198, 1875–1886. Chen, Y., Langrish, C.L., McKenzie, B., Joyce-Shaikh, B., Stumhofer, J.S., McClanahan, T., Blumenschein, W., Churakovsa, T., Low, J., Presta, L., Hunter, C.A., Kastelein, R.A., Cua, D.J., 2006. Anti-IL-23 therapy inhibits multiple inflammatory pathways and ameliorates autoimmune encephalomyelitis. J. Clin. Invest. 116, 1317–1326. Chen, Z.B., Huang, D.Q., Niu, F.N., Zhang, X., Li, E.G., Xu, Y., 2010. Human urinary kallidinogenase suppresses cerebral

303

inflammation in experimental stroke and downregulates nuclear factor-kappaB. J. Cereb. Blood Flow Metab. 30, 1356–1365. Ding, D.C., Shyu, W.C., Chiang, M.F., Lin, S.Z., Chang, Y.C., Wang, H.J., Su, C.Y., Li, H., 2007. Enhancement of neuroplasticity through upregulation of beta1-integrin in human umbilical cord-derived stromal cell implanted stroke model. Neurobiol. Dis. 27, 339–353. Gelderblom, M., Weymar, A., Bernreuther, C., Velden, J., Arunachalam, P., Steinbach, K., Orthey, E., Arumugam, T.V., Leypoldt, F., Simova, O., Thom, V., Friese, M.A., Prinz, I., Holscher, C., Glatzel, M., Korn, T., Gerloff, C., Tolosa, E., Magnus, T., 2012. Neutralization of the IL-17 axis diminishes neutrophil invasion and protects from ischemic stroke. Blood 120, 3793–3802. Hemdan, N.Y., Birkenmeier, G., Wichmann, G., 2012. Key molecules in the differentiation and commitment program of T helper 17 (Th17) cells up-to-date. Immunol. Lett. 148, 97–109. Hetman, M., Cavanaugh, J.E., Kimelman, D., Xia, Z., 2000. Role of glycogen synthase kinase-3beta in neuronal apoptosis induced by trophic withdrawal. J. Neurosci. 20, 2567–2574. Hsieh, J.Y., Wang, H.W., Chang, S.J., Liao, K.H., Lee, I.H., Lin, W.S., Wu, C.H., Lin, W.Y., Cheng, S.M., 2013. Mesenchymal stem cells from human umbilical cord express preferentially secreted factors related to neuroprotection, neurogenesis, and angiogenesis. PLoS One 8, e72604. Jander, S., Kraemer, M., Schroeter, M., Witte, O.W., Stoll, G., 1995. Lymphocytic infiltration and expression of intercellular adhesion molecule-1 in photochemically induced ischemia of the rat cortex. J. Cereb. Blood Flow Metab. 15, 42–51. Jin, R., Yang, G., Li, G., 2010. Inflammatory mechanisms in ischemic stroke: role of inflammatory cells. J. Leukoc. Biol. 87, 779–789. Josefowicz, S.Z., Lu, L.F., Rudensky, A.Y., 2012. Regulatory T cells: mechanisms of differentiation and function. Annu Rev. Immunol. 30, 531–564. Kang, J.W., Koo, H.C., Hwang, S.Y., Kang, S.K., Ra, J.C., Lee, M.H., Park, Y.H., 2012. Immunomodulatory effects of human amniotic membrane-derived mesenchymal stem cells. J. Vet. Sci. 13, 23–31. Kim, A.S., Johnston, S.C., 2013. Temporal and geographic trends in the global stroke epidemic. Stroke 44, S123–S125. Kleinschnitz, C., Schwab, N., Kraft, P., Hagedorn, I., Dreykluft, A., Schwarz, T., Austinat, M., Nieswandt, B., Wiendl, H., Stoll, G., 2010. Early detrimental T-cell effects in experimental cerebral ischemia are neither related to adaptive immunity nor thrombus formation. Blood 115, 3835–3842. Kretschmer, K., Apostolou, I., Hawiger, D., Khazaie, K., Nussenzweig, M.C., von Boehmer, H., 2005. Inducing and expanding regulatory T cell populations by foreign antigen. Nat. Immunol. 6, 1219–1227. Kunzmann, V., Kimmel, B., Herrmann, T., Einsele, H., Wilhelm, M., 2009. Inhibition of phosphoantigen-mediated gammadelta T-cell proliferation by CD4þ CD25þ FoxP3þ regulatory T cells. Immunology 126, 256–267. Lakhan, S.E., Kirchgessner, A., Hofer, M., 2009. Inflammatory mechanisms in ischemic stroke: therapeutic approaches. J. Transl. Med. 7, 97. Langrish, C.L., Chen, Y., Blumenschein, W.M., Mattson, J., Basham, B., Sedgwick, J.D., McClanahan, T., Kastelein, R.A., Cua, D.J., 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201, 233–240. Laurence, A., Tato, C.M., Davidson, T.S., Kanno, Y., Chen, Z., Yao, Z., Blank, R.B., Meylan, F., Siegel, R., Hennighausen, L., Shevach, E.M., O’Shea, J., J., 2007. Interleukin-2 signaling via STAT5 constrains T helper 17 cell generation. Immunity 26, 371–381. Liao, W., Xie, J., Zhong, J., Liu, Y., Du, L., Zhou, B., Xu, J., Liu, P., Yang, S., Wang, J., Han, Z., Han, Z.C., 2009a. Therapeutic effect

304

brain research 1594 (2015) 293–304

of human umbilical cord multipotent mesenchymal stromal cells in a rat model of stroke. Transplantation 87, 350–359. Liao, W., Zhong, J., Yu, J., Xie, J., Liu, Y., Du, L., Yang, S., Liu, P., Xu, J., Wang, J., Han, Z., Han, Z.C., 2009b. Therapeutic benefit of human umbilical cord derived mesenchymal stromal cells in intracerebral hemorrhage rat: implications of antiinflammation and angiogenesis. Cell Physiol. Biochem. 24, 307–316. Liesz, A., Suri-Payer, E., Veltkamp, C., Doerr, H., Sommer, C., Rivest, S., Giese, T., Veltkamp, R., 2009. Regulatory T cells are key cerebroprotective immunomodulators in acute experimental stroke. Nat. Med. 15, 192–199. Liu, R., Zhang, Z., Lu, Z., Borlongan, C., Pan, J., Chen, J., Qian, L., Liu, Z., Zhu, L., Zhang, J., Xu, Y., 2013. Human umbilical cord stem cells ameliorate experimental autoimmune encephalomyelitis by regulating immunoinflammation and remyelination. Stem Cells Dev. 22, 1053–1062. Macrez, R., Ali, C., Toutirais, O., le Mauff, B., Defer, G., Dirnagl, U., Vivien, D., 2011. Stroke and the immune system: from pathophysiology to new therapeutic strategies. Lancet Neurol. 10, 471–480. Manel, N., Unutmaz, D., Littman, D.R., 2008. The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nat. Immunol. 9, 641–649. Mucida, D., Kutchukhidze, N., Erazo, A., Russo, M., Lafaille, J.J., Curotto de Lafaille, M.A., 2005. Oral tolerance in the absence of naturally occurring Tregs. J. Clin. Invest. 115, 1923–1933. Niu, F.N., Zhang, X., Hu, X.M., Chen, J., Chang, L.L., Li, J.W., Liu, Z., Cao, W., Xu, Y., 2012. Targeted mutation of Fas ligand gene attenuates brain inflammation in experimental stroke. Brain Behav. Immun. 26, 61–71. O’Shea, J.J., Steward-Tharp, S.M., Laurence, A., Watford, W.T., Wei, L., Adamson, A.S., Fan, S., 2009. Signal transduction and Th17 cell differentiation. Microbes Infect. 11, 599–611. Ooboshi, H., Ibayashi, S., Shichita, T., Kumai, Y., Takada, J., Ago, T., Arakawa, S., Sugimori, H., Kamouchi, M., Kitazono, T., Iida, M., 2005. Postischemic gene transfer of interleukin-10 protects against both focal and global brain ischemia. Circulation 111, 913–919. Sairanen, T., Karjalainen-Lindsberg, M.L., Paetau, A., Ijas, P., Lindsberg, P.J., 2006. Apoptosis dominant in the periinfarct area of human ischaemic stroke—a possible target of antiapoptotic treatments. Brain 129, 189–199. Schroeter, M., Jander, S., Witte, O.W., Stoll, G., 1994. Local immune responses in the rat cerebral cortex after middle cerebral artery occlusion. J. Neuroimmunol. 55, 195–203. Shichita, T., Sugiyama, Y., Ooboshi, H., Sugimori, H., Nakagawa, R., Takada, I., Iwaki, T., Okada, Y., Iida, M., Cua, D.J., Iwakura, Y., Yoshimura, A., 2009. Pivotal role of cerebral interleukin-17producing gammadeltaT cells in the delayed phase of ischemic brain injury. Nat. Med. 15, 946–950. Shichita, T., Ago, T., Kamouchi, M., Kitazono, T., Yoshimura, A., Ooboshi, H., 2012a. Novel therapeutic strategies targeting

innate immune responses and early inflammation after stroke. J. Neurochem. 123 (2), 29–38. Shichita, T., Sakaguchi, R., Suzuki, M., Yoshimura, A., 2012b. Postischemic inflammation in the brain. Front. Immunol. 3, 132. Singh, H.V., Pandey, A., Shrivastava, A.K., Raizada, A., Singh, S.K., Singh, N., 2013. Prognostic value of neuron specific enolase and IL-10 in ischemic stroke and its correlation with degree of neurological deficit. Clin. Chim. Acta 419, 136–138. Sun, J., Han, Z.B., Liao, W., Yang, S.G., Yang, Z., Yu, J., Meng, L., Wu, R., Han, Z.C., 2011. Intrapulmonary delivery of human umbilical cord mesenchymal stem cells attenuates acute lung injury by expanding CD4þCD25þ Forkhead Boxp3 (FOXP3)þ regulatory T cells and balancing anti- and pro-inflammatory factors. Cell Physiol. Biochem. 27, 587–596. Sutton, C., Brereton, C., Keogh, B., Mills, K.H., Lavelle, E.C., 2006. A crucial role for interleukin (IL)-1 in the induction of IL-17producing T cells that mediate autoimmune encephalomyelitis. J. Exp. Med. 203, 1685–1691. Swardfager, W., Winer, D.A., Herrmann, N., Winer, S., Lanctot, K.L., 2013. Interleukin-17 in post-stroke neurodegeneration. Neurosci. Biobehav. Rev. 37, 436–447. Veldhoen, M., Hocking, R.J., Atkins, C.J., Locksley, R.M., Stockinger, B., 2006. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity 24, 179–189. Wang, D.D., Zhao, Y.F., Wang, G.Y., Sun, B., Kong, Q.F., Zhao, K., Zhang, Y., Wang, J.H., Liu, Y.M., Mu, L.L., Wang, D.S., Li, H.L., 2009. IL-17 potentiates neuronal injury induced by oxygenglucose deprivation and affects neuronal IL-17 receptor expression. J. Neuroimmunol. 212, 17–25. Wang, L., Cong, X., Liu, G., Zhou, J., Bai, B., Li, Y., Bai, W., Li, M., Ji, H., Zhu, D., Wu, M., Liu, Y., 2013. Human umbilical cord mesenchymal stem cell therapy for patients with active rheumatoid arthritis: safety and efficacy. Stem Cells Dev. Wang, Q., Li, X., Luo, J., Zhang, L., Ma, L., Lv, Z., Xue, L., 2012. The allogeneic umbilical cord mesenchymal stem cells regulate the function of T helper 17 cells from patients with rheumatoid arthritis in an in vitro co-culture system. BMC Musculoskelet. Disord. 13, 249. Weaver, C.T., Hatton, R.D., Mangan, P.R., Harrington, L.E., 2007. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu. Rev. Immunol. 25, 821–852. Xu, Y., Zhang, W., Klaus, J., Young, J., Koerner, I., Sheldahl, L.C., Hurn, P.D., Martinez-Murillo, F., Alkayed, N.J., 2006. Role of cocaine- and amphetamine-regulated transcript in estradiolmediated neuroprotection. Proc. Natl. Acad. Sci. USA 103, 14489–14494. Zepp, J., Wu, L., Li, X., 2011. IL-17 receptor signaling and T helper 17-mediated autoimmune demyelinating disease. Trends Immunol. 32, 232–239. Zuniga, L.A., Jain, R., Haines, C., Cua, D.J., 2013. Th17 cell development: from the cradle to the grave. Immunol. Rev. 252, 78–88.