Huntingtin functions as a scaffold for selective macroautophagy.

A RT I C L E S

Huntingtin functions as a scaffold for selective macroautophagy Yan-Ning Rui1,11, Zhen Xu1,11, Bindi Patel2,11, Zhihua Chen1, Dongsheng Chen1, Antonio Tito1,3, Gabriela David4, Yamin Sun1, Erin F. Stimming5, Hugo J. Bellen4,6,7, Ana Maria Cuervo2,8,9,12 and Sheng Zhang1,3,10,12 Selective macroautophagy is an important protective mechanism against diverse cellular stresses. In contrast to the well-characterized starvation-induced autophagy, the regulation of selective autophagy is largely unknown. Here, we demonstrate that Huntingtin, the Huntington disease gene product, functions as a scaffold protein for selective macroautophagy but it is dispensable for non-selective macroautophagy. In Drosophila, Huntingtin genetically interacts with autophagy pathway components. In mammalian cells, Huntingtin physically interacts with the autophagy cargo receptor p62 to facilitate its association with the integral autophagosome component LC3 and with Lys-63-linked ubiquitin-modified substrates. Maximal activation of selective autophagy during stress is attained by the ability of Huntingtin to bind ULK1, a kinase that initiates autophagy, which releases ULK1 from negative regulation by mTOR. Our data uncover an important physiological function of Huntingtin and provide a missing link in the activation of selective macroautophagy in metazoans. In macroautophagy (hereafter referred to as autophagy), the material to be degraded (cargo) is first sequestered into a double-membrane vesicle (autophagosome) that subsequently fuses with the lysosome1. Contrary to the ‘in bulk’ engulfment of cytosolic material observed on induction of autophagy by starvation1, most nutrient-independent stresses (that is, proteotoxicity, lipotoxicity, organelle damage) activate selective autophagy. In selective autophagy only the altered cytosolic components are recognized by cargo adaptors such as p62 (also known as SQSTM1; ref. 2), and then targeted for lysosomal degradation3,4. Despite a growing appreciation of the role of selective autophagy in intracellular quality control and cellular stress response, its regulation and how the autophagy machinery is recruited to the cargo for autophagosome formation are not well defined. In yeast, scaffold proteins such as Atg11 facilitate the effective recruitment of cargos into autophagosome through their interaction with cargo receptors5. However, few such scaffolds have been identified in mammals6. A

second difference between starvation-induced ‘in bulk’ autophagy and selective autophagy is their regulation. Activation of autophagy on starvation is attained through repression of the master nutrient sensor mTOR complex 1 (mTORC1), which promotes release and activation of an autophagy-initiation kinase ULK1. In contrast, selective autophagy can be activated independently of mTORC1 through relatively poorly understood mechanisms. Huntingtin (Htt), the protein encoded by the gene mutated in Huntington disease, is a large protein with many proposed functions7–11. We previously reported defective autophagy in Huntington disease-affected neurons manifested by the presence of ‘empty autophagosomes’ and suggestive of failure of cargo sequestration12. Here, we show that Htt positively modulates selective autophagy but not starvation-induced autophagy in fly and mammalian cells. Htt contributes to cargo recognition by facilitating binding of p62 to ubiquitin (Ub)-K63-modified cargos and to LC3, an integral autophagosome

1

The Brown Foundation Institute of Molecular Medicine, The University of Texas Medical School at Houston, The University of Texas Health Science Center at Houston (UTHealth), 1825 Pressler Street, Houston, Texas 77030, USA. 2Department of Development and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461, USA. 3Programs in Human and Molecular Genetics and Neuroscience, The University of Texas Graduate School of Biomedical Sciences, The University of Texas Health Science Center at Houston (UTHealth), 1825 Pressler Street, Houston, Texas 77030, USA. 4Program in Developmental Biology, Baylor College of Medicine, Jan and Dan Duncan Neurological Research Institute, 1250 Moursund Street, Houston, Texas 77030, USA. 5Department of Neurology, The University of Texas Medical School at Houston, The University of Texas Health Science Center at Houston (UTHealth), 6341 Fannin Street, Houston, Texas 77030, USA. 6Howard Hughes Medical Institute, Baylor College of Medicine, Jan and Dan Duncan Neurological Research Institute, 1250 Moursund Street, Houston, Texas 77030, USA. 7Departments of Molecular and Human Genetics and Neuroscience, Baylor College of Medicine, Jan and Dan Duncan Neurological Research Institute, 1250 Moursund Street, Houston, Texas 77030, USA. 8Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, Bronx, New York 10461, USA. 9Institute for Aging Studies, Albert Einstein College of Medicine, Bronx, New York 10461, USA. 10Department of Neurobiology and Anatomy, The University of Texas Medical School at Houston, The University of Texas Health Science Center at Houston (UTHealth), 1825 Pressler Street, Houston, Texas 77030, USA. 11These authors contributed equally to this work. 12 Correspondence should be addressed to A.M.C. or S.Z. (e-mail: [email protected] or [email protected]) Received 27 November 2014; accepted 22 December 2014; published online 16 February 2015; DOI: 10.1038/ncb3101

NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION

© 2015 Macmillan Publishers Limited. All rights reserved

1

A RT I C L E S

L1 L2 L3 L4 L5 L6

250/259

0/102

0/220

150 100 50 0

+/+

dhttko–/– dhttRescue; dhttko–/–

Appl–Gal4 > UAS–GFP–mCherry–Atg8a

30/30

Tau-ΔC Actin

UAS–DTS7

+/+ +/+ dhttko–/–

L1 L2 L3 L4 L5 L6

+/+

i

Tau-ΔC Actin arm–Gal4 > UAS–Tau-ΔC

22 °C 28 °C arm–Gal4 > arm–Gal4 > UAS–Tau-ΔC UAS–Tau-ΔC UAS–LacZ

∗

j

UAS–DTS7

arm–Gal4 > UAS–Tau-ΔC

+/+

∗

∗

UAS–LacZ

20 15 10 5 0

∗

200

+/+ +/+ atg8ad4–/–

Fold change of Ref(2)P levels

dhtt ko–/– dhtt Rescue/+; dhtt ko–/– WT

Ref(2)P Actin

d6

0/24

32/32

g

5 week

dhttRescue/+; dhttko–/–

d5

c1 c2 c3 c4 c5 c6 c7 c8

h 1 week

dhttko–/–

d4

Atg8a-positive puncta

c8

c7

100 75 50 25 0

+/+

b1 b2 b3 b4

33/33

c7

0/32

Ref(2)Pc03993/+

d3 mCherry–Atg8a

e

35/35

c5

c6

100 75 50 25 0

0/19

c4

atg7d77/+

c5

dhtt Rescue/+; dhtt ko–/–

ATau; dhttko/+ ATau

atg13Δ81/+

c3

c2 c3

WT

f

c1

b4

36/36

atg1Δ3D/+

c

b3

d2

a5 a6 a7 a8

atg8ad4–/–; ATau/+

0/26

b2

100 75 50 25 0

d1

a1 a2 a3 a4

0/32

b1

dhtt ko–/–

Muscle

atg8ad4/+; ATau/+ atg8ad4/+; ATau/+ dhttko/+ atg8ad4–/–

Factin

0/135

a8

0/28

a7

0/25

a6

35/35

a5

Appl–Gal4 > UAS–GFP–mCherry–atg8a 100 75 50 25 0

0/28

a4

30/30

a3

16/28

a2

Penetrance (%)

a1

d

Muscle loss (%)

b

ATau/dhttRescue; ATau/+; dhttko–/– dhttko–/–

ATau/+

Muscle loss (%)

Muscle

Thorax

WT

Muscle loss (%)

a

Tau-ΔC Actin

Figure 1 Drosophila huntingtin interacts genetically with the autophagy pathway. (a) Representative scanning electron micrographs of the external thorax (a1–a4) and phalloidin F-actin staining of the internal muscle structure underlying the thorax (a5–a8) in adult flies of the indicated genotype. Arrows: collapsed thorax. White dotted lines: missing dorsal longitudinal muscles. ATau: ectopic Tau expression from a single copy of the UAS– Tau transgene driven by a single copy of the A307–Gal4 line (A307–Gal4 > UAS–Tau/+). Right: quantification of penetrance (top) or muscle loss (bottom; n = 3 independent experiments). (b,c) Phalloidin F-actin staining in fly mutants of the indicated genotypes either homozygous for atg8ad4 or double heterozygous for dhtt ko and other mutations: atg8ad4 , atg1∆3D , atg13∆81 , atg7 d77 and Ref(2)P c03993 . Right: quantification of percentage of muscle loss (n = 4 independent experiments). (d) Representative confocal images (d1–d3) of whole-mount adult brains expressing the mCherry–GFP– Atg8a reporter under a pan-neuronal driver (Appl–Gal4). High-magnification view of outlined areas (d4–d6). (e) Quantification of mCherry–Atg8a-positive

puncta in flies of the indicated genotypes (n = 15 fly brains (d1), n = 18 (d2), n = 19 (d3), pooled from 3 independent experiments). (f,g) Representative immunoblot (f) and quantification (g) of Ref(2)P protein from dhtt ko−/− mutant flies and age-matched controls with the indicated genotypes (n = 3 independent experiments). (h,i) Representative immunoblot of Tau-1C in fly mutants homozygous for atg8ad4 (h) or dhtt ko (i). (j) Representative immunoblot of samples from flies co-expressing Tau-1C together with control LacZ (lanes 2 and 5) or with DTS7 (lanes 3 and 6), a temperature-sensitive dominant-negative mutant allele of a proteasome subunit. Inactivation of the proteasome by raising DTS7-expressing flies at the non-permissive temperature of 28 ◦ C (lanes 4–6) did not cause a higher level of accumulation of Tau-1C compared to the control. All values are mean + s.e.m. and differences are significant for ∗ P < 0.05 using analysis of variance plus Bonferroni’s test. Scale bars, 20 µm for d4–d6 and 100 µm for all others. Uncropped images of blots are shown in Supplementary Fig. 9.

component. In addition, non-overlapping interaction of Htt with ULK1 promotes its activation by dissociation from the mTOR–ULK1 complex and subsequent initiation of selective autophagy. These data support a dual function of Htt as a scaffold in selective autophagy by promoting cargo recognition and autophagy initiation.

due to severe muscle loss below (Fig. 1a7) not observed by Tau expression alone, and accelerated decline in mobility and lifespan. These phenotypes were fully rescued by the dhtt genomic rescue transgene (‘dhtt Rescue ’; ref. 13; Fig. 1a and Supplementary Fig. 1a–c), suggesting that dhtt protects against Tau-induced pathogenic effects. Although heterozygous dhtt ko /+ flies expressing Tau (ATau; dhtt ko /+) seem normal, removing a single copy of the fly LC3 gene, atg8a (atg8ad4 mutant)14, in these flies also induced a collapsed thorax and muscle loss, which could be phenocopied by expressing Tau in homozygous atg8ad4−/− flies alone (Fig. 1b and Supplementary Fig. 1d). Four additional components of the early steps of the autophagy pathway, atg1 (ULK1), atg7 and atg13, and an adaptor for the selective recognition of autophagic cargo, Ref(2)P (p62; ref. 15), also exhibit strong genetic interactions with dhtt (Fig. 1c

RESULTS Drosophila huntingtin genetically interacts with autophagy pathway components Homozygous flies lacking its single htt homologue (dhtt ko ) are fully viable with only mild phenotypes13. In a genetic screen for the physiological function of Htt, ectopic expression of a truncated form of the microtubule-binding protein Tau (Tau-1C; truncated after Val 382) induced a prominent collapse of the thorax in dhtt ko flies

2



Ctrl PI –

k

Htt(–)

+2 h +4 h

– +2 h +4 h

Ctrl

PI – +2 h +4 h – +2 h +4 h

LC3-I LC3-II

Actin Total ubiquitin

25

Htt(–)

p62

j

g

Htt(–)

Ctrl

b2

b3

h

Ctrl Serum+ Htt(–) Ctrl Htt(–)

15 10

∗

5

m

∗

25 20 15 10 5 0

5 10 15 20 25 ∗

Ctrl Htt(–)

6 5 4 3 2 1 0

hHtt; dhtt ko–/–

1.5 1.0 0.5 0

∗

Ctrl Htt-KD

Ctrl

Htt(–)

∗

None N/L 3MA ∗

Ctrl Htt(–)

5 4 3 2 1 0

∗

Ctrl Htt(–)

Htt(–)

Figure 2 Huntingtin is functionally conserved between the fly and humans and is required for effective autophagy in mammals. (a–e) hHtt rescued dhtt ko -associated phenotypes. (a) Thorax pictures (top) and phalloidin F-actin staining (bottom) of flies. Arrows: collapsed thorax. White dashed lines: muscle loss. Scale bars, 100 µm. Right: quantification. (b) Representative confocal images of adult brains from flies expressing GFP–mCherry–Atg8a (scale bar, 100 (top) and 20 (bottom) µm). (c) Quantification. n = 12 fly brains (b1), n = 10 (b2), n = 9 (b3), pooled from 3 independent experiments. (d) Representative Ref(2)P immunoblot in mutants flies of the indicated ages and genotypes. (e) Quantification (n = 3 independent experiments). (f–o) Autophagic activity in NIH3T3 mouse fibroblasts, control (Ctrl; transduced with empty vector) or knocked down for Htt (Htt(−)). (f) Immunoblot for Htt and quantification (n = 8). (g) Long half-life protein degradation rates in cells cultured in serum-supplemented medium without additions (continuous line) or on addition of lysosomal proteolysis inhibitors (ammonium chloride and leupeptin) (dashed line) (n = 6 plates in 6 independent experiments, with triplicate wells per condition). (h) Effect of ammonium chloride and leupeptin (N/L) or treatment with 3-methyladenine (3MA) to inhibit macroautophagy (n = 6 plates in 6 independent experiments, with triplicate wells per condition). (i) Representative immunoblot of p62 in cells untreated (−) or treated for the indicated times with lysosomal

16 12 8 4 0

∗ ∗

Ctrl Htt(–)

∗

S M ing ul le t Emiple pt y

0

∗

AV number per section

3

100 80 60 40 20 0

C a Emrgo pt y

6

Percentage of total AVs

10 0

9

C H trl tt( –)

∗

20

C H trl tt( –)


30

AV area (% cytoplasm)

Htt(–)

o

Ctrl

n

b1

∗

L1 L2 L3 L4 L5 L6

Htt Actin

20

2.5 2.0 1.5 1.0 0.5 0

∗ ∗

f WT Htt(–)

0 Time (h) 0

l

∗

30 20 10 0

Folds control

b6

∗

LC3-II flux

hHtt; dhttko–/–

b5

200 150 100 50 0

Proteolysis (%)

dhttko–/–

b4

Atg8a-positive puncta

+/+

c

LC3-II levels (folds)

i

b3 mCherry–Atg8a

b2

dhttko–/–

WT

a5 a6 a7 a8

Appl–Gal4 > UAS–GFP–mCherry–Atg8a b1

dhttko–/– hHtt; dhtt ko–/– WT

18/152

0/126

0/112

129/137

L1 L2 L3 L4 L5 L6

e

ΔLC3-II (folds)

100 75 50 25 0

Ref(2)P Actin Fold change of Ref(2)P levels

a8

5 week

a1 a2 a3 a4 8/36

a7

1 week

Proteolysis (%)

b

F-actin a6

d 100 75 50 25 0

0/31

a5

Muscle loss (%)

Muscle

ATau

Thorax

a1

GFP; dhttko–/– dhttRescue; hHtt; dhttko–/– ko–/– a2 a3 dhtt a4

0/29

GFP

38/38

a

Penetrance (%)

A RT I C L E S

protease inhibitors (PI). (j) Immunofluorescence for polyubiquitylated proteins. Arrows: protein aggregates. Scale bar, 10 µm. (k,l) LC3-II flux in cells treated as in i; representative immunoblot (k) and quantification (l) of LC3-II steady-state levels (left), net flux (middle) and synthesis (difference between 2 and 4 h; right) (n = 6 plates in 6 independent experiments, with triplicate wells per condition). (m) Representative electron micrographs of cells maintained in serum-supplemented media. Bottom: higher-magnification images of the outlined areas; for control cells, top row of insets shows higher-magnification images of the outlined areas and bottom row shows additional examples of autophagic vacuoles from other control cells. (n) Quantification (from left to right) of autophagic vacuole (AV) number per section, relative cytosolic area occupied, percentage containing cargo and number per section containing single (selective) or multiple (in bulk) cytosolic content or an empty lumen (n = 12 micrographs for each condition from 3 independent experiments, with 4 micrographs per experiment). (o) Representative images of immunogold labelling for LC3. Insets: outlined areas at higher magnification. Scale bars, 2 µm. All values are mean + s.e.m. and differences are significant for ∗ P < 0.05 using either analysis of variance plus Bonferroni’s test (c,e) or Student’s t-test (f,h,l,n). Uncropped images of blots are shown in Supplementary Fig. 9.



3

A RT I C L E S and Supplementary Fig. 1e). Consistent with its pivotal role in autophagy initiation1, loss of atg1 induced the strongest defect, and Tau expression could induce a mild muscle loss phenotype even in heterozygous null atg1∆3d (Fig. 1c). Collectively, these genetic interaction studies suggest a role for dhtt in autophagy. Drosophila huntingtin positively regulates autophagy in vivo Using the mCherry–GFP–Atg8a fusion reporter to directly measure autophagic flux in adult dhtt ko−/− brains16, we found similar number of red fluorescent punctae (acidic autolysosomes originating from autophagosome/lysosome fusion) in young mutant and control flies, but the number of punctae was reduced in old dhtt ko−/− brains when compared with age-matched controls (Fig. 1d,e). As we did not observe autophagosome accumulation (co-localized green and red puncta), we concluded that the absence of dhtt in older animals is associated with reduced autophagosome formation. The fact that levels of Ref(2)P were significantly higher in old dhtt ko−/− brains compared with brains from age-matched wild-type controls (Fig. 1f,g) suggested a possible preferential compromise in selective autophagy in these animals. Consistent with the role of basal autophagy in quality control in non-dividing cells17, we found that brains from 5-week-old dhtt ko−/− contained almost double the amount of ubiquitylated proteins, a marker of quality control failure, compared with wild-type flies (Supplementary Fig. 2a). As genetic interaction analysis and specific ubiquitin proteasome system (UPS) reporters all failed to reveal a functional link between dhtt and the UPS pathway (Supplementary Fig. 2b–f), we propose that the defects in autophagic activity are the main cause of diminished quality control and increased accumulation of ubiquitylated proteins in dhtt ko−/− mutants. Drosophila huntingtin is required for intracellular quality control Selective autophagy is induced in response to proteotoxic stress. The truncated Tau-1C used in our genetic studies is preferentially degraded through autophagy in cortical neurons18, serving as a model of proteotoxicity when ectopically expressed. We confirmed lower stability of Tau-1C compared with full-length Tau in wild-type flies (Supplementary Fig. 3a) and in UPS mutants, but found significantly higher levels of Tau-1C when expressed in atg8a and in dhtt ko−/− mutant flies (Fig. 1h–j), suggesting that autophagy is essential for the clearance of Tau-1C also in flies and that dhtt plays a role in this clearance. In contrast, loss of dhtt did not affect flies’ adaptation to nutrient deprivation, which typically induces robust ‘in bulk’ autophagy19. Fat bodies of early third instar larvae expressing mCherry–Atg8, where starvation-induced autophagy can be readily detected20, failed to reveal any significant difference between wild-type and dhtt ko−/− flies and they die at the same rate as wild-type flies when tested for starvation resistance (Supplementary Fig. 2g–i). Thus, although dhtt is necessary for selective autophagy of toxic proteins such as Tau-1C, it is dispensable for starvation-induced autophagy in flies. Huntingtin’s function is conserved from flies to humans Expression of human Htt (hHTT) in dhtt ko−/− null flies rescued both the mobility and longevity defects of dhtt ko−/− mutants and

4

partially rescued the Tau-induced morphological and behavioural defects of dhtt ko−/− flies (Fig. 2a and Supplementary Fig. 3b–f). hHTT also suppressed almost all of the autophagic defects observed in dhtt ko−/− , including decreased levels of autolysosomes, increased levels of Ref(2)P and of total ubiquitylated proteins, and accumulation of ectopically expressed Tau-1C (Fig. 2b–e and Supplementary Fig. 3g–i), suggesting that the involvement of dhtt in autophagy is functionally conserved. In fact, confluent mouse fibroblasts knocked down for Htt (Htt(−)) exhibited significantly lower basal rates of long-lived proteins’ degradation than control cells, which were no longer evident on chemical inhibition of lysosomal proteolysis or of macroautophagy, thus confirming an autophagic origin of the proteolytic defect (Fig. 2g,h). Htt(−) fibroblasts also exhibited higher p62 levels and accumulate ubiquitin aggregates even in the absence of a proteotoxic challenge (Fig. 2i,j). As in dhtt ko−/− flies, Htt knockdown in mammalian cells did not affect degradation of CL1–GFP (a UPS reporter), β-catenin (a UPS canonical substrate) or proteasome peptidase activities (Supplementary Fig. 4a–c). Reduced autophagic degradation in Htt(−) cells was not due to a primary lysosomal defect, as depletion of Htt did not reduce lysosomal acidification, endolysosomal number (if anything, we observed an expansion of this compartment) or other lysosomal functions such as endocytosis (transferrin internalization shown as an example; Supplementary Fig. 4d–h). In fact, analysis of the lysosomal degradation of LC3-II revealed that autophagic flux and autophagosome formation were preserved and even enhanced in Htt(−) fibroblasts at basal conditions (Fig. 2k,l). We have previously shown a similar apparent dichotomy—reduced autophagic degradation of cargo (long-lived proteins and p62) with normal or increased formation and clearance of LC3-positive autophagic vesicles—in cells from Huntington disease patients12. As, in this pathological setting, we observed an ‘empty autophagosome’ phenotype resulting from defective cargo sequestration, we performed electron microscopy. We found that the overall size and number of the autophagic/lysosomal compartments was expanded in Htt(−) fibroblasts under basal conditions but that, contrary to the organelles and electron-dense cargo noticeable in the vacuoles in the control cells, a larger fraction of the vesicular structures in Htt(−) fibroblasts lacked visible content or had a mixed cargo composition reflective of ‘in bulk’ autophagy (Fig. 2m,n). Immunogold staining for LC3 confirmed the autophagic nature of the Htt(−) cells’ empty vesicles (Fig. 2o). Thus, as in flies, Htt is also required for effective autophagy in mammals and its depletion affects the autophagic process early at the step of selective cargo recognition. Mammalian Huntingtin is required for selective autophagy In light of the above observed role of Htt in autophagy under basal conditions, we then analysed the requirement for Htt in autophagy activated in response to different cellular stressors, when only specific cytosolic cargo is degraded. The reduced rates of autophagic degradation of long-lived proteins observed in Htt(−) fibroblasts become even more pronounced on exposure to proteotoxic stress (inhibition of proteasome degradation), lipotoxic stress (oleic challenge) or the mitochondrial depolarizing agent FCCP (Fig. 3a). However, on starvation (serum removal or incubation in nutrientfree media), control and Htt(−) fibroblasts exhibited a similar increase



A RT I C L E S

0 8 16 24 h

0

∗

10 ∗

0

8 16 24 h

0

8 16 24 h

∗

0 0

8 16 24 h

d Htt(–)-2 – – – – + – – + – – +

MG132

BHMT

Htt(–)-1 – Dox +

– –

– + – – + – – + + + + + + + + +

– +

Tau-ΔC Htt Actin

∗

i

Mito CMXROS

72 h ∗

3 2

∗

0

Merged

∗

40

∗

0

None OL 0.05 OL 0.15

1

Ctrl Htt(–)

80

on e O Pa leic Et lmi op tic os id e

12 10 8 6 4 2 0

24 48

120

N

0

H tt( –)

Percentage of remaining (Tau/actin)

40

72 h

j

1.2 β-oxidation 1.0 0.8 0.6 0.4 ∗ 0.2 0

10 0

15 10 5 0

p

o 40 30 20 10 0

Ctrl MitoTracker/LC3

Htt(–)

∗

C trl H tt( –)

∗

∗

MitoTracker per LC3 (puncta per cell)

20

20

C tr H l tt( –)

30

Percentage of depolarized mitochondria

n

40

C tr H l tt( –)

l

LC3/bodipy (co-localization %)

Htt(–)

Htt(–)

Control

m MitoTracker

f

∗

H tt( –)

∗

48 Ctrl Htt(–)-1 Htt(–)-2

80

trl

Control

Bodipy/LC3

30 25 20 15 10 5 0

C H trl tt( –)

h

24

120

C

Htt(–)

LD (number per cell)

Control Bodipy

GFP Htt

LD (area mm2 × 102)

BHMT-FRAG

BHMT-FRAG GFP Htt

e

Viability (% untreated)

BHMT 0

k

∗

3

BHMT + + + + +

BHMT + + + + +

g

6

C tr H l tt( –)

0

c

RM MOCK Ctrl Htt(–)-1 Htt(–)-2

∗

20

FCCP

9

Folds control

EBSS

b

0

8 16 24 h

∗

Lactacystin

C trl

0

10

RM MOCK Ctrl Htt(–)-1 Htt(–)-2

0

10

20

30

Proteolysis (%)

∗

10

20

Oleic

30

OCR (pmol min–1)

20

Serum –

30

Proteolysis (%)

Serum + Ctrl Htt(–)

Proteolysis (%)

30

Proteolysis (%)

Proteolysis (%)

a

Figure 3 Huntingtin functions in selective macroautophagy. (a) Htt loss reduced autophagy-dependent degradation in response to different stressors. Long half-life protein degradation rates in NIH3T3 cells control (Ctrl) or knocked down for Htt (Htt(−)) cultured in serum-deprived (−) or -supplemented (+) medium without additions or with the indicated stressors (n = 6 plates in 3 independent experiments, with triplicate wells per condition). (b,c) GST–BHMT assay. Representative immunoblot for GST–BHMT in HEK293T cells treated as indicated (n = 3 independent experiments). (d,e) Tau-1C degradation. Representative immunoblot of the time course of Tau-1C levels in HeLa cells (d) and quantification of Tau-1C protein (e) (n = 3 independent experiments). (f–l) Htt knockdown in NIH3T3 fibroblasts reduces lipophagy. (f) Higher susceptibility of Htt(−) cells to lipotoxicity (oleic or palmitic acid) but not to genotoxicity (etoposide) (n = 6 plates in 3 independent experiments, with triplicate wells per condition). (g,h) Accumulation of lipid droplets (LD) in oleictreated cells. Representative images of Bodipy493/503-stained cells (g) and quantification of LD number per cell and average LD area (h). Scale bar, 10 µm (n = 3 independent experiments where a total of 100 cells were analysed per condition). (i) Reduced increase in oxygen consumption rates (OCR) on oleic (OL) challenges (n = 6 plates in 4 independent experiments, with 4 wells per condition). (j) Reduced β-oxidation measured

as release of [14 C]carbon dioxide in [14 C]oleate-loaded cells (n = 4). (k,l) LC3 immunostaining in BODIPY493/503-stained cells. (k) Representative images (insets: higher magnification of outlined areas with co-localization pixels in white). Scale bar, 10 µm. (l) Quantification: percentage of LC3/BODIPY co-localization (n = 3 independent experiments a total of 110 cells were analysed per condition). (m–p) Htt knockdown in NIH3T3 fibroblasts reduces mitophagy. (m,n) Htt(−) cells have a higher content of depolarized mitochondria (MitoTracker-positive and MitoTracker Red CMXROS-negative). (m) Representative images (insets: higher magnification images). Arrows: depolarized mitochondria. Scale bar, 10 µm. (n) Quantification: percentage of depolarized mitochondria (n = 3 independent experiments; a total of 85 cells were analysed per condition). (o,p) LC3 immunostaining in MitoTrackerstained cells. (o) Representative images in both channels and co-localization pixels in white (insets: higher-magnification images). Scale bar, 10 µm. (p) Quantification of LC3/MitoTracker co-localization (n = 3 independent experiments where a total of 110 cells were analysed per condition). In all studies with lentivirus-mediated shRNA (f–p) control cells were transduced with viral particles carrying the empty vector. All values are mean + s.e.m. and differences are significant for ∗ P < 0.05 using Student’s t-test (a,f,h–j,l,n,p) or analysis of variance plus Bonferroni’s test (e). Uncropped images of blots are shown in Supplementary Fig. 9.



5

A RT I C L E S a LD LD

LD

b

Percentage of total AV

Ctrl

Htt(–)

LD

15 10

∗

5 0 Ctrl Htt(–) 80

3 ∗

2 1 0

Ctrl Htt(–)

∗

60 40 20 0

∗ Dense Other Empty material

c

Oleic

Cytosolic material per section


Lactacystin

FCCP

Ctrl

Ctrl

LD LD LD LD Htt(–)

Htt(–)

LD LD LD

40

–) tt(

trl C

C trl H tt( –)

0

0

∗

60 40

∗ ∗

20 0

em b ic le Em s pt y

80

80

Ve s

∗

2

120

Percentage of total AV

4

160

M

6

AV size (mm2)

8

H

0

200

10

M

0

5

AV occupied area (%)

∗

∗

–)

20

10

trl

0

40

15

tt(

60

60

C

0

∗

Ctrl Htt(–)

20

H

2

120

80


∗

180

Percentage of total AV em ve br si an cl e e Li s pi Em ds pt y

) tt( –

C trl

0

4

240

C trl H tt( –)

5

6 AV size (mm2)

10

LD

C trl H tt( –)

15

AV occupied area (%)

Ctrl Htt(–)

H


LD

Figure 4 Ultrastructure of cells knocked down for Huntingtin on induction of selective types of autophagy. (a–c) NIH3T3 fibroblasts control (Ctrl) or knocked down for Htt (Htt(−)) were exposed to lactacystin (a), oleic acid (b) or the mitochondria-depolarizing agent FCCP (c) and processed for electron microscopy. Images show representative cellular areas and insets show examples of autophagic vacuoles (AV) at higher magnification to appreciate the cargo content. Red arrows: protein aggregates inside AV (a), AV containing lipid material (b) or AV containing mitochondria (c). Yellow arrows: protein aggregates free in the cytoplasm. LD, lipid droplets. Note that induction of proteotoxicity with lactacystin favours autophagic sequestration

of proteinaceous aggregate material over sequestration of LD that remain intact under these conditions (a), whereas induction of lipophagy with oleic results in a higher content of AV in close proximity of the LD (b). LD are also preserved from autophagic sequestration in the case of FCCP treatment, where membranous structures compatible with mitochondria undergoing degradation are detected in AV (c). Quantification of the number, average size and percentage of cytosolic area covered by AV is shown on the right (a) or at the bottom (b,c). n = 9 (in a), 9 (in b) and 6 (in c) micrographs pooled from 3 independent experiments. Scale bars, 0.5 µm. All values are mean + s.e.m. and differences are significant for ∗ P < 0.05 using Student’s t-test.

in long-lived proteins’ degradation and in fragmentation of GST– BHMT, a cargo-based end-point assay for autophagy21 (Fig. 3a,b). In contrast, accumulation of fragmented GST–BHMT was almost abolished in Htt(−) fibroblasts subjected to proteotoxic stress by proteasome inhibition (Fig. 3c). To further analyse the involvement of Htt in selective autophagy, we directly tracked the cargo targeted in each of these stress conditions.

In stably transfected HeLa cells with inducible expression of Tau1C, degradation of Tau-1C was mostly dependent on autophagy (sensitive to 3-methyladenine or Atg7 knockdown but insensitive to proteasome inhibition; Supplementary Fig. 4i–k). Htt knockdown markedly blocked Tau-1C turnover (Fig. 3d,e), indicating that, as in flies, Htt is required for the autophagy-mediated degradation of Tau-1C.

6



h Striatal

i

Htt Actin

Bodipy/LC3

Ctrl Htt(–)

N2a cells Htt(–)

Ctrl

Striatal cells Ctrl Ctrl

Htt(–)

Htt(–)

Htt(–)

g

Ctrl Htt(–) ∗

60 40 20 0

N2a cells Htt(–) Htt(-)

Ctrl Htt(–)

j 60 50 40 30 20 10 0

Ctrl

Ctrl Htt(–) ∗ Ctrl Htt(–)

Ctrl

Htt(–)

Striatal cells Ctrl

Htt(–)

MitoTracker/LC3 co-local. (%)

WT Htt-KO

WT HttKO


Actin

Actin

Ctrl

50 40 30 20 10 0

LC3/MitoTracker (co-localization %)

Htt

p62

f

WT HttKO

Htt-KO

Bodipy/LC3

N2a cells Ctrl Htt(–)

*

MEFs WT

MitoTracker/LC3

e N2a cells Ctrl Htt(–) BafA1 – + – +

c

WT Htt-KO

LC3/MitoTracker (co-localization %)

d

30 25 20 15 10 5 0


Actin

MEFs Htt-KO

WT

Bodipy/LC3 co-local. (%)

Bodipy/LC3

b

MEFs HttWT KO p62

MitoTracker/LC3

a

MitoTracker/LC3

A RT I C L E S

70 60 50 40 30 20 10 0

50 40 30 20 10 0

Ctrl Htt(–) ∗ Ctrl Htt(–)

Ctrl Htt(–) ∗

Ctrl Htt(–)

Figure 5 Role of Huntingtin in selective autophagy in different mammalian cell types. Defective selective autophagy in different types of mammalian cell with reduced Htt levels. (a) Representative immunoblots to illustrate increased levels of p62 in total cellular lysates of MEFs from mice knocked out for Htt (Htt-KO). (b,c) Analysis of lipophagy and mitophagy as the colocalization of LC3 with BODIPY493/503-stained lipid droplets (b) or with MitoTracker-labelled mitochondria (c) in MEFs from wild-type (WT) or HttKO mice on exposure to oleic acid (for lipophagy) or FCCP (for mitophagy). (d) Representative immunoblot to illustrate increased levels of p62 in total cellular lysates of N2a cells knocked down (KD) for Htt (Htt(−)) untreated (−) or treated with BafA1. (e) Efficiency of Htt knockdown in N2a cells was confirmed by immunoblot. (f,g) Analysis of mitophagy (f) and lipophagy

(g) in N2a neuroblastoma cells, control or knocked down for Htt (Htt(−)). (h) Representative immunoblots to illustrate efficiency of Htt knockdown in mouse striatal-derived cells. (i,j) Analysis of lipophagy (i) and mitophagy (j) in mouse striatal-derived cells, control or knocked down for Htt (Htt(−)). Quantification of the percentage of co-localization is shown on the right. Images show merged channels and insets show a co-localization mask (as white pixels). Scale bars, 10 µm. The number of independent experiments (n) was 3 (in b,c,i,j) and 4 (in f,g), where the number of total cells counted for each experimental condition was 80 (b), 75 (c), 80 (f), 60 (g), 80 (i) and 70 (j). All values are mean + s.e.m. and differences are significant for ∗ P < 0.05 using Students t-test. Uncropped images of blots/gels are shown in Supplementary Fig. 9.

We next induced selective degradation of lipid droplets (lipophagy) by cell loading with oleic acid22,23. Htt(−) fibroblasts exhibited a higher sensitivity to lipid challenges and a more pronounced accumulation of lipid droplets (Fig. 3f–h). Lipid accumulation in Htt(−) fibroblasts was mostly due to their reduced ability to mobilize and break down intracellular lipid stores, as they failed to increase mitochondrial respiration in response to the lipogenic challenge and exhibited lower rates of lipid β-oxidation (Fig. 3i,j). Immunostaining revealed significantly lower co-localization of LC3 with Bodipy-labelled lipid droplets in Htt(−) cells (Fig. 3k,l), further supporting the idea that Htt is required for selective lipophagy. Similarly, Htt(−) fibroblasts showed a comparatively higher content of depolarized mitochondria (labelled with MitoTracker but negative for MitoTracker Red CMXRos staining) and less co-localization between LC3 and MitoTracker-highlighted mitochondria than control cells, in support of reduced mitophagy (Fig. 3m–p). Ultrastructural analysis of control and Htt(−) cells on exposure to these three different stressors confirmed the fluorescence data (Fig. 4a–c). Thus, the most abundant fraction of autophagosomes in control cells treated with a proteasome inhibitor were those containing aggregate proteinaceous material, whereas in Htt(−) cells most of the observed autophagic vacuoles had a clear lumen and aggregates were instead detectable free in the cytosol (Fig. 4a). Similarly, treatment with oleic acid or FCCP increased the fraction of autophagic vacuoles containing lipids or mitochondria, respectively, in control

cells whereas this switch towards a specific autophagic cargo was not observed in Htt(−) cells (Fig. 4b–c). Interestingly, in contrast to the higher autophagic vacuole content observed in Htt(−) fibroblasts under basal conditions (Fig. 2m,n), the number and cell fraction occupied by autophagic vacuoles on exposure to any of these stressors were significantly lower in Htt(−) than in control cells (Fig. 4a–c), in support of a failure to maximally induce selective autophagy in Httdeficient cells. Complete ablation of Htt (mouse embryonic fibroblasts (MEFs) from mice knocked out for Htt (ref. 24) or Htt knockdown in other cell types (neuroblastoma N2a cells and mouse striatal cells), also led to higher levels of p62 and reduced co-localization of LC3 with markers of lipid droplets or mitochondria on exposure to oleic acid or FCCP, respectively (Fig. 5). Overall, our results support the hypothesis that Htt is dispensable for starvation-induced autophagy but essential for at least three different types of selective autophagy, aggrephagy of either a specific protein (Tau) or a pool of aggregate proteins (proteasome inhibition), lipophagy and mitophagy. Further analysis of changes in autophagic flux in the absence of Htt in different cell types under different experimental conditions revealed that, in contrast to the increase in basal autophagosome formation and autophagic flux observed in Htt(−) fibroblasts (Fig. 2k,l), Htt depletion in HeLa cells had indiscernible effects on basal LC3-II flux and on GST–BHMT fragmentation under basal conditions (Supplementary Fig. 5a,b). These data probably reflect the lower



7

A RT I C L E S a +

–

+

–

+

– +

Htt(–)-2

0.4

0.6

0.7

+MG132 +BafA1 b10

b2

b5

b8

b11

b3

b6

b9

b12

Htt p62

h

ULK1

LC3 Draq5

0

h1

Htt h2

p62 h3

h4

h5

h6

85

200 0

Ctrl

50

100

31

NS

–MG132–BafA1 –MG132+BafA1 +MG132–BafA1 +MG132+BafA1 56

NS NS NS

300

37

100

d

36

200

∗ ∗

∗ ∗

LC3 puncta per cellular profile

ULK1

Ctrl Htt(–)-1 Htt(–)-2

300

–M G –B 13 2 –M afA G 1 +B 13 2 +M afA G 1 –B 13 +M afA 2 G 1 +B 13 af 2 A1

Htt(–)-2

Htt(–)-1

Ctrl

c p62

Htt(–)-1 Htt(–)-2

Htt p62 Draq5

MEF-Htt-WT

MEF-Htt-WT

MG132 Input IP: Htt MEF-Htt-KO

MEF-Htt-WT

MEF-Htt-KO

Mock Input IP: Htt

Input IP: anti-htt

f

Ref(2)P dHtt

MEF-Htt-KO

+MG132 -BafA1 b7


MEF-Htt-KO

dhttko–/–

WCE IP: anti-HA

RM

Ref(2)P dHtt

g

∗

–BafA1 +BafA1

HA–dhtt mimic line

1 0

e

∗ 1.2

2

MEF-Htt-WT

LC3-II/actin

∗

Htt(–)-1

Actin Htt

3

–MG132 +BafA1 b4

Ctrl

LC3-I LC3-II

–MG132 –BafA1 b1

LC3 puncta per cellular profile

BafA1 –

b

MG132 Ctrl Htt(–)-1 Htt(–)-2

RM

p62 ULK1 Htt

i

90

Htt conserved regions

1

Htt deletions map

1

650 D2

1,622

2,433 2,522 2,665 3,079 d e 3,144

c 1,775

1,133

D3

D4

WCE

k

ND MD CD D5 D6 D7

2,394

D5

2,657

D6

D7

3,144

IP: HA WCE Mr (K) ND MD CD D2 D3 D4 ND MD CD D2 D3 D4 170 135 100 55

HA–Htt deletions

33

D1

1,228

HA–Htt deletions

55 40

684 730 b

415

IP: HA Mr (K) ND MD CD D5 D6 D7 170 135 100

j

382 a

ULK1

24 p62

Figure 6 Huntingtin modulates autophagic induction and physically interacts with p62 and ULK1 proteins through two non-overlapping conserved regions. (a) Representative immunoblot for LC3 in HEK293T cells treated as indicated. Bottom: quantification of LC3-II levels and net LC3-II flux (lateral numbers shown net differences in LC3-II levels on addition of BafA1) normalized against loading control actin (n = 3 independent experiments). (b) Immunostaining for LC3 in HeLa cells treated as indicated. Scale bar, 10 µm. (c,d) Quantification of LC3-positive puncta plotted by different inhibitor treatments (c) or by Htt genotype (d). Note that although the ratio of LC3 in cells treated or not with BafA1 is comparable in control and Htt(−) cells, the net changes in LC3 puncta content on addition of BafA1 (shown in the lateral numbers) are markedly lower in these cells (n = 5 wells, pooled from 3 independent experiments, >150 cells per experiment). (e) Representative immunoblot to show co-immunoprecipitation experiments using whole-animal extract from dhtt ko−/− as a negative control or a genome-tagging MiMIC fly line expressing 3×HA-tagged dHtt (n = 3 independent experiments). (f,g) Representative immunoblot to show coimmunoprecipitation experiments between Htt and p62 or ULK1 in HEK293T

8

cells (f) and MEF cells (g) in comparison with negative controls, Htt-siRNAtreated (f) or Htt-KO MEF (g) cells. Input lines show the Triton X-100soluble fraction from the whole-cell lysate used for co-immunoprecipitation on normalization of soluble p62 levels across samples (n = 3 independent experiments). (h) Representative confocal images of immunofluorescent stained cells for Htt (green), p62 (red) and Draq5 (blue). Bottom: highmagnification view of outlined areas. Scale bar, 5 µm (top) or 2 µm (bottom) (n = 3 independent experiments). (i–k) Mapping of p62- and ULK1interacting regions in Htt. (i) Schematics of fly and human conserved regions (blue) in Htt (top) and of the Htt deletions (green) generated in this study (bottom). (j,k) Representative immunoblots for co-immunoprecipitation assays using the HA-tagged Htt deletions to pull down Myc–p62 (j) or Myc–ULK1 (k). Whole-cell extracts (WCE) are shown in the right. Myc–p62 was pulled down by the C-terminal CD and D6 fragments in Htt and Myc–ULK1 by the middle MD and D3 fragments in Htt. All values are mean + s.e.m. and differences are significant for ∗ P < 0.05 using analysis of variance plus Bonferroni’s test. Uncropped images of blots are shown in Supplementary Fig. 9.



A RT I C L E S dependence on Htt-mediated selective autophagy in these rapidly dividing cells, where quality control is less important. However, when we forced activation of quality control selective autophagy in these cells by inflicting proteotoxic stress with the proteasome inhibitor, Htt knockdown markedly blocked the induction of autophagy visible in the control cells as an increase in steady-state levels and clearance of LC3-II (Fig. 6a). Immunostaining for LC3 confirmed a reduced increase in the number of LC3-positive puncta in the Htt(−) HeLa cells on proteotoxic stress (Fig. 6b,c). Transfection with GFP–Htt restored the defective autophagic flux during proteotoxic stress both in Htt(−) HeLa cells and in Htt-KO MEFs, but did not affect autophagy activation in response to serum removal (Supplementary Fig. 5c,d). Blockage of lysosomal proteolysis with bafilomycin-A1 in Htt(−) cells exposed to proteasome inhibition still increased the number of LC3-positive puncta (Fig. 6b,d), suggesting that, in agreement with the electron microscopy data (Fig. 4), autophagosome clearance is normal in Htt-depleted cells and that their reduced LC3 flux during proteotoxic stress is mainly due to reduced autophagosome formation. Consistently, double labelling with the lysosome marker LAMP1 revealed lysosomal accumulation of LC3 in bafilomycin-A1-treated cells in both control and Htt(−) cells, indicating that fusion of autophagosomes with lysosomes still occurs in the absence of Htt (Supplementary Fig. 5e). In contrast, Htt knockdown did not significantly affect the levels or processing of LC3-II on induction of non-selective autophagy by nutrient depletion (Supplementary Fig. 5f). We found similar defects in induction of selective autophagy on exposure to proteasome inhibitors, oleic acid or FCCP on Htt depletion in mouse fibroblasts, MEFs, striatal and neuroblastoma cells expressing the mCherry–GFP– LC3 fusion reporter, whereas their ability to upregulate autophagic flux in response to nutritional deprivation remained unaffected (Supplementary Fig. 5g–k). These results support the idea that Htt is important in selective autophagy for both initiation of autophagosome formation and cargo recognition. Huntingtin physically interacts with p62 and ULK1 proteins To explore how Htt is involved in autophagy regulation, we next examined potential physical interactions between Htt and the autophagy components identified in our fly-based genetic screens (Fig. 1). Using whole-animal extracts from a genome-tagging fly line expressing 3×HA-tagged dHtt, we found that dHtt strongly coimmunoprecipitated with endogenous Ref(2)P (Fig. 6e). Experiments in mammalian cells confirmed co-immunoprecipitation of both endogenous and tagged Htt and p62, as well as between Htt and ULK1, the mammalian Atg1 homologue25 (Fig. 6f and Supplementary Fig. 6a–d). Notably, we previously reported that p62 co-localized and interacted with mutant Htt in autophagosomes12. Hence, results from the fly and mammalian systems together support the idea that p62 and ULK1 are conserved binding partners of Htt. Intriguingly, the amount of endogenous p62 that co-immunoprecipitated with endogenous Htt was significantly increased on induction of proteotoxic stress (proteasome inhibitor treatment), whereas the level of co-immunoprecipitated ULK1 remained similar (Fig. 6g). Immunofluorescence for endogenous Htt and p62 in HeLa cells also revealed enrichment of Htt in the large p62-positive bodies (sequestosomes)26 that form around the nucleus on proteasome

inhibition (Fig. 6h), suggesting a translocation of Htt to the p62 bodies in response to autophagy induction. Tagged ULK1 has been shown to co-localize with p62 (ref. 27), raising the possibility that Htt might form a tertiary complex with p62 and ULK1. To map the regions responsible for the association of Htt with p62 and ULK1, we generated Htt deletions and through co-immunoprecipitation identified two non-overlapping conserved regions13,28 in Htt, the carboxy-terminal D6 and the middle D3 regions that bind to p62 and ULK1, respectively (Fig. 6i–k and Supplementary Fig. 6e–g). Huntingtin facilitates p62-mediated cargo recognition efficiency Given the defective sequestration of selective cargo inside autophagosomes in Htt(−) cells and the direct interaction between Htt and p62, we investigated whether Htt functions with p62 in cargo recognition. p62 is involved in selective autophagy by simultaneous binding with LC3 and ubiquitylated cargos for their subsequent engulfment by the forming autophagic membrane2. Cargo recognition by p62 initiates with the formation of sequestosomes (detergent-resistant p62 bodies)2,26. Accordingly, treatment with proteasome inhibitors gradually decreased soluble p62 and increased insoluble p62 in control cells. However, p62 redistribution and formation of large p62 bodies were no longer observed on depletion of Htt (Fig. 7a–c and Supplementary Fig. 7a–c; depletion of Beclin 1, essential for autophagosome formation1 is shown as a positive control). In contrast, the fraction of cellular p62 degraded by autophagy during starvation did not change on Htt knockdown (Supplementary Fig. 7d). Three functional domains in p62 coordinate its roles in selective autophagy: the self-polymerization (PB1) and ubiquitin-binding (UBA) domains are critical for p62 body formation2, and the middle motif (LIR) for its interaction with LC3 for cargo-based autophagic degradation29. We found that knockdown of Htt had no obvious effect on p62 polymerization (HA–p62 and Myc–p62 interaction) or its interaction with ubiquitylated proteins containing the Lys 48 linkagespecific modification (Ub-K48), but strikingly reduced the amount of p62 that co-immunoprecipitated with ubiquitylated substrates containing the Lys 63 linkage-specific modification30 (Ub-K63; Supplementary Fig. 7e–g). These findings were also reproduced using transfected HA-tagged Ub-K63 and Ub-K48 and pulldowns with antiHA (to discard nonspecific antibody effects; Supplementary Fig. 7h–i) and in Htt-KO MEFs (to discard nonspecific siRNA-mediated effects; Fig. 7d,e). The above results raise the possibility that Tau1C is also a target of Ub-K63 modification. Indeed, we found that Tau-1C protein was preferentially modified by Ub-K63 but not Ub-K48 in HEK293T cells (Fig. 7f). Co-immunoprecipitation experiments showed that p62 physically interacts with Tau-1C and their affinity was compromised after Htt knockdown (Fig. 7g). Overall, these findings indicate that Htt facilitates p62 binding to Ub-K63-modified proteins that are preferentially degraded by selective autophagy31. Last, we investigated the effect of Htt knockdown in the interaction of p62 with LC3. The ability of LC3 to co-immunoprecipitate endogenous p62 was markedly reduced in Htt(−) cells and, accordingly, co-localization of p62 and LC3 was also significantly



9

A RT I C L E S

Ctrl Htt(–)-1 Htt(–)-2 +MG132

Ub-Tau-ΔC–GFP

–

+ –

–

Htt(–)-2

–

Htt(–)-2

Htt(–)-1

Dox + –

IP: GFP Htt(–)-1

MEF-Htt-KO Anti-Ub-K48

MEF-Htt-KO MEF-Htt-WT

MEF-Htt-WT

∗

–MG132

g

WCE + + – – – – + + – + – +

–

Tau-ΔC p62

Htt

Anti-HA

h Tau-ΔC

Htt Control

∗

WCE IP: anti-GFP HA–Ub-K63 + + – – HA–Ub–K48 – – + + Tau-ΔC–GFP – + – +

p62

Htt

10 5 0

∗

Ctrl

b6

+MG132

b5

f

Anti-Ub-K63

MEF-Htt-KO

b3

∗

25 20 15

Ctrl

WCE MEF-Htt-KO MEF-Htt-WT

b2

Htt(–)-2

e WCE IP: Ub-K48

p62

i

b1

b4

Htt Actin

WCE IP: Ub-K63

Htt(–)-1

Large p62 bodies per cellular profile

–MG132

Soluble p62 Insoluble p62

IP: p62

MEF-Htt-WT

Htt(–)-2

Ctrl

Ctrl Htt(–)-1

RM

d

c Ctrl

MG132 (6 h)


b

a

IP: LC3 Ctrl Htt(–) Inp IP FT Inp IP FT LC3-I LC3-II

Htt(–)

P62 LC3

j

P62/LC3 co-localization (%)

p62

120 80

∗

40 0 Ctrl Htt(–)

Figure 7 Huntingtin facilitates p62-mediated cargo recognition efficiency. (a) Representative immunoblot of Triton X-100-soluble and -insoluble p62 in HEK293T cells treated as indicated (n = 3 independent experiments). RM, regular media. (b) Confocal images of HeLa cells immunostained for endogenous p62 (green) and Draq5 (blue). Scale bar, 8 µm. (c) Quantification of large p62 bodies. n = 3 independent experiments >150 cells. (d,e) Representative immunoblots of endogenous proteins with Ub-K63 or Ub-K48 modifications immunoprecipitated in MEF cells from wild-type (WT) or Htt knockout (Htt-KO) mice using anti-Ub-K63 (d) or anti-UbK48 (e) antibodies. Co-immunoprecipitated p62 is also shown. (f) Tau-1C– GFP and HA-tagged Ub-K63 or Ub-K48 were co-transfected into HEK293T cells, followed by an in vitro ubiquitylation assay with anti-GFP antibody and probing with anti-HA antibody. (g) Representative immunoblots of

endogenous p62 co-immunoprecipitated with an anti-GFP antibody in stable Tau-1C–GFP-expressing HeLa cells, control or treated with siRNA against Htt (n = 3 independent experiments). (h–j) Htt knockdown compromised p62/LC3 interaction in NIH3T3 fibroblasts. (h) Representative immunoblot of co-immunoprecipitation experiments in NIH3T3 cells for LC3. Inp: input, IP: immunoprecipitated, FT: flow-through. (i,j) Co-immunostaining for p62 and LC3 in confluent NIH3T3 cells. (i) Representative images of merged channels of full fields (top) and high-magnification of outlined areas (bottom). Scale bars, 10 µm. (j) Quantification: percentage of co-localization (n = 4 independent experiments; a total of 80 cells were analysed per condition). All values are mean + s.e.m. and differences are significant for ∗ P < 0.05 using analysis of either variance plus Bonferroni’s test (c) or Student’s test (j). Uncropped images of blots are shown in Supplementary Fig. 9.

reduced on Htt loss (Fig. 7h–j). Although it is not possible to discriminate whether the reduced p62 and LC3 interaction is primarily due to the loss of Htt or secondary to the inability of p62 to bind K63-ubiquitylated cargo, these findings uncover an essential role for Htt in p62-dependent cargo recognition required for proper sequestration of specific cargo into autophagosomes during selective autophagy.

and non-selective autophagy25. In control cells, both starvation and proteotoxicity (proteasome inhibition) significantly boosted ULK1 kinase activity, measured as increased phosphorylation of myelinbinding protein (MBP), a pseudo-substrate for ULK1 (ref. 25), but Htt knockdown only attenuated proteasome inhibition-mediated ULK1 activation (Fig. 8a). These results suggest that Htt could contribute to the regulation of the initiation of selective autophagy by modulating ULK1 activation while not affecting starvation-induced non-selective autophagy. Consistent with this hypothesis, Htt has no significant impact on AMPK, which positively regulates ULK1 kinase activity in response to energy depletion, presumably by interacting and phosphorylating ULK1 (refs 32–34). Htt knockdown did not disrupt the interaction between AMPK and ULK1, nor did it interfere with AMPK-mediated ULK1 phosphorylation at Ser 555 (Supplementary

Huntingtin–ULK1 and mTOR–ULK1 complexes are mutually exclusive To investigate the basis for the observed defective autophagosome biogenesis in Htt(−) cells in response to different stressors, we followed up on the physical (Fig. 6f) and genetic (Fig. 1c) interaction of Htt with ULK1, the kinase essential for initiation of both selective

10



A RT I C L E S

– – + –

– + – –

+ – – –

– – + +

– + – +

+ – – + Htt mTOR Raptor ULK1 Htt mTOR Raptor ULK1

WCE

MBP ULK1 Htt

d Myc–Raptor – – + – – + Input IP: anti-ULK1

– + – +

– + + +

+ – – +

HA–Htt – FLAG–ULK1 –

– +

p-MBP MBP ULK1 mTOR

– + – –

– + – +

+ – – –

+ – – +

(no mTOR) ULK1 (no Raptor) Htt mTOR ULK1 Raptor Htt

Htt-1

Htt-2

Htt-1

Htt-2

– + – +

– +

IP

– + – +

IP: anti-mTOR siRNA Ctrl

ULK1 mTOR Htt ULK1 mTOR Htt

j

+ +

IP: FLAG

i – – – +

MG132 – + ULK1 mTOR Htt

Raptor mTOR ULK1

Basal Dividing cells

mTOR Raptor

– – – –

Input IP: anti-Htt

mTOR ULK1

– – + +

IP: anti-ULK1 siRNA Ctrl

Htt-KO WT Htt-KO WT

Htt

h Myc–mTOR-KD Myc–mTOR HA–Htt FLAG–ULK1

g

mT TOR FIP200 mTOR ULK LK K1 1 Atg13 ULK1

Rapto Raptor or In bulk autophagy

Induced autophagy Starvation

Proteotoxicity Mitotoxicity Lipotoxicity

mTOR

mTOR

WCE

Raptor

Htt

mTOR ULK1 Htt

Non-dividing cells

WCE

Raptor Htt ULK1

f

WT

ULK1 mTOR

ULK1-KO

e

WT

(no Htt)

ULK1-KO

IP: MyC

Myc–mTOR – + – – + – FLAG–ULK1 + + + – – – FLAG–Htt – – – + + +

– – + –

IP: FLAG

p-MBP

Myc–mTOR Myc–Raptor Myc–ULK1 FLAG–Htt

WCE

Myc–Htt Myc–Raptor Myc–mTOR FLAG–ULK1

WCE

FLAG–ULK1 – + + + + + + +

c

IP: FLAG

EBSS

RM RM Ctrl Htt(–)-1 Htt(–)-2 Ctrl Htt(–)-1 Htt(–)-2

MG132

b

FLAG–ULK1-KD

a

mTOR FIP200 ULK1 ULK L 1 Atg13

FIP200 ULK1 Atg13

FIP200 ULK1 Atg13

htt

In bulk b l

htt

p62

FIP200

62 p62 QC Selective autophagy

In bulk autophagy

Selective autophagy

Figure 8 Huntingtin–ULK1 and mTOR–ULK1 complexes are mutually exclusive. (a) Representative autoradiograph to show in vitro ULK1 kinase activity monitored by the phosphorylation level of myelin-binding protein (p-MBP). Equal input of ULK1 protein was verified by immunoblot (n = 3 independent experiments). (b) Representative immunoblot of coimmunoprecipitation experiments using anti-FLAG antibody in HEK293T cells co-transfected with FLAG-tagged ULK1 and Myc-tagged Htt, Raptor or mTOR, as indicated (n = 3 independent experiments). (c,d) Representative immunoblot of co-immunoprecipitation experiments using anti-FLAG (c) or anti-Myc (d) in HEK293T cells co-transfected with tagged Htt, ULK1, mTOR and Raptor, as indicated. (e,f) Representative immunoblots of endogenous co-immunoprecipitation experiments in MEFs using anti-ULK1 (e) or anti-Htt antibodies (f). (g) Representative immunoblot to show reciprocal co-immunoprecipitation experiments in MEFs using anti-ULK1 or anti-mTOR antibodies, as indicated. (h) Representative immunoblot to show in vitro ULK1 kinase assay in HEK293T cells treated as indicated. (i) Representative immunoblot of co-immunoprecipitation assays using

anti-FLAG in HEK293T cells transfected with FLAG–ULK1 and HA–Htt as indicated to analyse the association between ULK1 and endogenous Raptor or mTOR proteins (n = 3 independent experiments). (j) A schematic model of Htt regulation of selective autophagy. Htt serves as a scaffolding for selective autophagy by bringing together cargo bound through p62 and the initiator of autophagy ULK1. Basal autophagy: under basal conditions the absence of Htt leads to reduced selectivity in cargo recognition required for quality control autophagy, but it does not affect autophagy induction/autophagosome biogenesis, because basal ULK1 is sufficient to sustain ‘in bulk’ autophagy and basal quality control autophagy. Induced autophagy: maximal activation of autophagy in response to stress requires the release of mTORC1 inhibition over ULK1. In starvation-induced autophagy, inactivation of mTORC1 promotes release and activation of ULK1. Selective autophagy induced in response to different stressors requires Htt to actively compete away ULK1 from the mTORC1 inhibitory complex. Uncropped images of blots/gels are shown in Supplementary Fig. 9.

Fig. 8a,b), two mechanisms of regulation that are critical for AMPKinduced ULK1 activation35. To determine how Htt specifically activates selective autophagy but not non-selective autophagy when they both share common regulators including ULK1, we systematically examined several established mechanisms governing ULK1 kinase activity. Maximal activation of ULK1 is attained by forming a stable quaternary complex with FIP200, Atg13 and Atg101 (ref. 25). Pulldown assays revealed that Htt did not affect the stability of this complex (Supplementary Fig. 8c). ULK1 is

also regulated by the central nutrient sensor mTORC1, which binds to ULK1 and represses its kinase activity to prevent autophagy initiation. Inactivation of mTORC1 during starvation triggers release of active ULK1 from this complex and initiation of non-selective autophagy36, whereas the mechanisms that counterbalance the inhibitory effect of mTORC1 on ULK1 for activation of selective autophagy remain poorly understood. We first tested whether Htt affected the kinase activity of mTOR and consequently its inhibitory effect on ULK1. Neither Htt knockdown nor Htt overexpression showed any obvious



11

A RT I C L E S effect on mTOR kinase activity when assessed by the phosphorylation of the downstream mTOR effector S6K at Thr 389 (ref. 36) under basal conditions or on activation of mTOR by the upstream regulator Rheb (Supplementary Fig. 8d,e). This result was further confirmed by an in vitro kinase assay using GST–4E-BP1, a substrate readily phosphorylated by mTOR at Ser 65 after mTOR activation. Ser65– GST–4E-BP1 phosphorylation was unaffected by Htt knockdown (Supplementary Fig. 8f). Thus, Htt might not activate ULK1 by directly inhibiting mTOR activity. Excitingly, although ULK1 co-immunoprecipitated with Htt, mTOR and Raptor, an adaptor protein critical for mTORC1 activity (Fig. 8b), Htt–ULK1 and mTOR–Raptor–ULK1 exist as two separate mutually exclusive complexes. Specifically, co-immunoprecipitation assays showed that Htt could pull down ULK1 but not mTOR or Raptor (Fig. 8c), and both mTOR and Raptor co-immunoprecipitated ULK1 but not Htt (Fig. 8d). Similar physical interactions were observed for endogenous Htt, ULK1 and mTOR proteins in MEFs (Fig. 8e,f; Htt-KO and ULK1-KO (ref. 37) as controls) and neuroblastoma N2a cells (Supplementary Fig. 8g–i), thus confirming the existence of two mutually exclusive ULK1–Htt and ULK1–mTOR complexes. This mutual exclusion indicates that Htt may promote ULK1 activation during selective autophagy by directly competing for the inhibitory binding of mTORC1 to ULK1. Indeed, under all three different stress conditions, we observed an increased interaction between ULK1 and Htt at the expense of mTOR, and Htt depletion largely abolished this competitive effect (Fig. 8g and Supplementary Fig. 8j,k). Consistently, overexpression of Htt significantly blocked mTOR-mediated repression of ULK1. Basal ULK1-dependent phosphorylation of MBP can be detected in the kinase assay under rich nutritional conditions but not with the kinase-dead ULK1 mutant (FLAG–ULK1-KD; Fig. 8a). This basal ULK1 activity is sensitive to regulation by mTOR, as overexpression of Myc–mTOR substantially repressed MBP phosphorylation and overexpression of a kinase-dead Myc–mTOR mutant showed the opposite effect, probably through a dominant-negative mechanism (Fig. 8h). Interestingly, overexpression of Htt significantly relieved this mTOR-mediated repression of basal ULK1 kinase activity (Fig. 8h), suggesting that Htt antagonizes the negative regulation of mTOR on ULK1 and promotes activation of selective autophagy even in the presence of active mTOR (rich media) by directly competing away ULK1 from the mTORC1–ULK1 complex. Indeed, co-immunoprecipitation assays revealed that Htt overexpression markedly reduced the amount of endogenous mTOR and Raptor proteins associated with ULK1 (Fig. 8i), providing further support for this competition model. Changes in Htt protein levels may also contribute to modulate Htt function on autophagy under physiological conditions, because after exposure to stressors that induce selective autophagy but not in response to starvation, we found modest elevations of endogenous Htt levels in fibroblasts and neuroblastoma N2a cells (Supplementary Fig. 8l,m). DISCUSSION Selective autophagy is important for intracellular quality control and the cellular stress response but its regulation and how the autophagy machinery is recruited to the cargo for autophagosome formation are still poorly defined processes. In this work, we show that Htt is a scaffold protein that promotes selective autophagy through its ability

12

to simultaneously interact with components involved in two major autophagy steps, p62 and ULK1, and thus modulate both cargo recognition efficiency and autophagosome initiation. First, Htt releases the inhibitory effect of mTOR over ULK1, by directly competing away this kinase from the mTORC1 complex. Second, binding of Htt to p62 enhances the association between this cargo receptor and its Ub-K63modified substrates. We propose a scaffolding role for Htt in selective autophagy whereby the ability of Htt to simultaneously bind ULK1 and p62 assures the spatial proximity between cargo recognition and autophagy-initiation components (Fig. 8j). We found that Htt is required for at least three types of selective autophagy (aggrephagy, lipophagy and mitophagy) but is dispensable for starvation-induced autophagy. Selective recognition of cargo requires receptors including p62, and Htt facilitates p62-mediated cargo recognition, at least in part, by enhancing the affinity between p62 and Ub-K63-modified cargos38 and LC3. Selective formation of an autophagosome around the p62-recognized cargo has been attributed to the ability of p62 to simultaneously bind cargo and LC3. However, autophagy initiation requires events that precede lipid conjugation of LC3, such as recruitment to the sites of autophagosome formation of ULK1, one of the earliest autophagy effectors. We propose that Htt directs ULK1 to these sites by forming an Htt–ULK1 complex distinct from the mTOR–ULK1 complex. Of note, both Htt and mTOR contain HEAT repeats39, which could be the basis of their mutually exclusive interaction with ULK1 and of the ability of Htt to compete with mTOR for ULK1 binding to achieve maximal activation of selective autophagy. Under basal conditions, binding of Htt to the pool of constitutively active ULK1 identified in this study might be sufficient for preserving basal autophagy-dependent intracellular quality control, potentially by competing away and shielding ULK1 from the inhibitory mTORC1 complex. How this competing activity of Htt is repressed under basal conditions requires future investigation, but it is possible that changes in Htt levels, subcellular location or its myriad of post-translational modifications40–47 could contribute to regulate the function of Htt to fine-tune the proper cellular autophagic response against a variety of cellular stresses. Notably, animals deficient for Htt, ULK1 and p62 show distinctive phenotypes. Htt-KO mice die at embryonic day E7.5 (refs 48–50), whereas p62 and ULK1-KO are viable37,51–54. These differences are probably partially due to the additional roles each protein plays besides autophagy. For example, the earlier lethality of the Htt-KO mice has been primarily attributed to the essential role of Htt in extraembryonic tissues55,56. Furthermore, only one Htt gene exists in both the fly and most vertebrate genomes, whereas ULK1 and ULK2 seem capable of compensating for each other37,53,54,57, and the function of p62 in autophagic cargo recognition shows some redundancy with other receptors such as NBR1. Interestingly, p62-KO mice exhibit adultonset neurodegeneration with elevated level of K63-ubiquitylated Tau in the brain58,59, and similarly, reduced Htt expression or Htt postnatal deletion both result in brain degeneration60,61. Connections of Htt with autophagy have previously been described11,42,62–64 and we also reported autophagy abnormalities (‘empty autophagosomes’ phenotype) in the context of Huntington disease12. As deleting the polyQ tract in Htt enhances neuronal autophagic activity and longevity in mice65, it is attractive to propose that polyQ expansion compromises the role of Htt in selective autophagy. NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION


A RT I C L E S METHODS Methods and any associated references are available in the online version of the paper. Note: Supplementary Information is available in the online version of the paper ACKNOWLEDGEMENTS We are grateful to T. Neufeld and U. Pandey for their fly lines; P. B. Dennis for the pRK5-GST-BHMT plasmid; D. Contamine for anti-Ref(2)P antibody; I. Bezprozvanny for MEF-Htt-WT and MEF-Htt-KO lines; M. Kundu for MEF-ULK1-KO and MEF-ULK1-WT lines; J. Botas for UAS–hHtt DNA and fly lines. We also thank Z. Mao for technical assistance in confocal microscopy, and Z. Sun and N. Perrimon for critically reading the manuscript. H.J.B. is an investigator of the HHMI and supported by the R&R Belfer and Hufftington foundations. G.D. was supported by a T32 developmental biology training grant from the NICHD. This work was supported by NIH grants R01-NS069880 (to S.Z.) and P01-AG031782 and AG038072 (to A.M.C.) and the generous support of R&R Belfer (to A.M.C.). AUTHOR CONTRIBUTIONS Y-N.R. and Z.X. designed and performed most Drosophila studies and most of the studies on starvation- and MG132-induced autophagy response and Tau-1C degradation in mammalian cells; B.P. designed and performed part of the studies on autophagic flux in mammalian cells, and most of the studies of lipophagy and mitophagy, some of the co-immunoprecipitation studies and all the electron microscopy studies and morphometric analysis; Z.C., D.C., A.T., E.F.S. and Y.S. contributed to part of these studies; G.D. performed larva starvation, LysoTracker staining and LC3 reporter assay; G.D. and H.J.B. designed experiments, analysed data and contributed to part of the writing and revision of the manuscript; A.M.C. coordinated the study, designed experiments, analysed data and contributed to the writing and revision of the manuscript. S.Z. coordinated the study, designed experiments, analysed data and contributed to the main writing and revision of the manuscript. COMPETING FINANCIAL INTERESTS The authors declare no competing financial interests. Published online at www.nature.com/doifinder/10.1038/ncb3101 Reprints and permissions information is available online at www.nature.com/reprints 1. He, C. & Klionsky, D. J. Regulation mechanisms and signaling pathways of autophagy. Annu. Rev. Genet. 43, 67–93 (2009). 2. Bjorkoy, G., Lamark, T. & Johansen, T. p62/SQSTM1: a missing link between protein aggregates and the autophagy machinery. Autophagy 2, 138–139 (2006). 3. Johansen, T. & Lamark, T. Selective autophagy mediated by autophagic adapter proteins. Autophagy 7, 279–296 (2011). 4. Lamark, T. & Johansen, T. Aggrephagy: selective disposal of protein aggregates by macroautophagy. Int. J. Cell Biol. 2012, 736905 (2012). 5. Lynch-Day, M. A. & Klionsky, D. J. The Cvt pathway as a model for selective autophagy. FEBS Lett. 584, 1359–1366 (2010). 6. Jin, M., Liu, X. & Klionsky, D. J. SnapShot: Selective autophagy. Cell 152, 368–368.e2 (2013). 7. The Huntington’s Disease Collaborative Research Group. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosomes. Cell 72, 971–983 (1993). 8. Cattaneo, E., Zuccato, C. & Tartari, M. Normal huntingtin function: an alternative approach to Huntington’s disease. Nat. Rev. Neurosci. 6, 919–930 (2005). 9. Caviston, J. P. & Holzbaur, E. L. Huntingtin as an essential integrator of intracellular vesicular trafficking. Trends Cell Biol. 19, 147–155 (2009). 10. Harjes, P. & Wanker, E. E. The hunt for huntingtin function: interaction partners tell many different stories. Trends Biochem. Sci. 28, 425–433 (2003). 11. Martin, D. D., Ladha, S., Ehrnhoefer, D. E. & Hayden, M. R. Autophagy in Huntington disease and huntingtin in autophagy. Trends Neurosci. 38, 26–35 (2015). 12. Martinez-Vicente, M. et al. Cargo recognition failure is responsible for inefficient autophagy in Huntington’s disease. Nat. Neurosci. 13, 567–576 (2010). 13. Zhang, S., Feany, M. B., Saraswati, S., Littleton, J. T. & Perrimon, N. Inactivation of Drosophila Huntingtin affects long-term adult functioning and the pathogenesis of a Huntington’s disease model. Dis. Model Mech. 2, 247–266 (2009). 14. Pircs, K. et al. Advantages and limitations of different p62-based assays for estimating autophagic activity in Drosophila. PloS ONE 7, e44214 (2012). 15. Bartlett, B. J. et al. p62, Ref(2)P and ubiquitinated proteins are conserved markers of neuronal aging, aggregate formation and progressive autophagic defects. Autophagy 7, 572–583 (2011). 16. Nezis, I. P. et al. Autophagic degradation of dBruce controls DNA fragmentation in nurse cells during late Drosophila melanogaster oogenesis. J. Cell Biol. 190, 523–531 (2010).

17. Rubinsztein, D. C. The roles of intracellular protein-degradation pathways in neurodegeneration. Nature 443, 780–786 (2006). 18. Dolan, P. J. & Johnson, G. V. A caspase cleaved form of tau is preferentially degraded through the autophagy pathway. J. Biol. Chem. 285, 21978–21987 (2010). 19. Mortimore, G. E. & Poso, A. R. Intracellular protein catabolism and its control during nutrient deprivation and supply. Annu. Rev. Nutr. 7, 539–564 (1987). 20. Mauvezin, C., Ayala, C., Braden, C. R., Kim, J. & Neufeld, T. P. Assays to monitor autophagy in Drosophila. Methods 68, 134–139 (2014). 21. Dennis, P. B. & Mercer, C. A. The GST-BHMT assay and related assays for autophagy. Methods Enzymol. 452, 97–118 (2009). 22. Singh, R. et al. Autophagy regulates lipid metabolism. Nature 458, 1131–1135 (2009). 23. Koga, H., Kaushik, S. & Cuervo, A. M. Altered lipid content inhibits autophagic vesicular fusion. FASEB J. 24, 3052–3065 (2010). 24. Zhang, H. et al. Elucidating a normal function of huntingtin by functional and microarray analysis of huntingtin-null mouse embryonic fibroblasts. BMC Neurosci. 9, 38 Special section p1-15 (2008). 25. Ganley, I. G. et al. ULK1.ATG13.FIP200 complex mediates mTOR signaling and is essential for autophagy. J. Biol. Chem. 284, 12297–12305 (2009). 26. Bjorkoy, G. et al. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 171, 603–614 (2005). 27. Itakura, E. & Mizushima, N. p62 targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. J. Cell Biol. 192, 17–27 (2011). 28. Li, Z., Karlovich, C. A., Fish, M. P., Scott, M. P. & Myers, R. M. A putative Drosophila homolog of the Huntington’s disease gene. Hum. Mol. Genet. 8, 1807–1815 (1999). 29. Pankiv, S. et al. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J. Biol. Chem. 282, 24131–24145 (2007). 30. Newton, K. et al. Ubiquitin chain editing revealed by polyubiquitin linkage-specific antibodies. Cell 134, 668–678 (2008). 31. Kirkin, V., McEwan, D. G., Novak, I. & Dikic, I. A role for ubiquitin in selective autophagy. Mol. Cell 34, 259–269 (2009). 32. Egan, D. F. et al. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 331, 456–461 (2011). 33. Kim, J., Kundu, M., Viollet, B. & Guan, K. L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 13, 132–141 (2011). 34. Shang, L. et al. Nutrient starvation elicits an acute autophagic response mediated by Ulk1 dephosphorylation and its subsequent dissociation from AMPK. Proc. Natl Acad. Sci. USA 108, 4788–4793 (2011). 35. Alers, S., Loffler, A. S., Wesselborg, S. & Stork, B. Role of AMPK-mTOR-Ulk1/2 in the regulation of autophagy: cross talk, shortcuts, and feedbacks. Mol. Cell Biol. 32, 2–11 (2012). 36. Laplante, M. & Sabatini, D. M. mTOR signaling in growth control and disease. Cell 149, 274–293 (2012). 37. Kundu, M. et al. Ulk1 plays a critical role in the autophagic clearance of mitochondria and ribosomes during reticulocyte maturation. Blood 112, 1493–1502 (2008). 38. Seibenhener, M. L. et al. Sequestosome 1/p62 is a polyubiquitin chain binding protein involved in ubiquitin proteasome degradation. Mol. Cell Biol. 24, 8055–8068 (2004). 39. Andrade, M. A. & Bork, P. HEAT repeats in the Huntington’s disease protein. Nat. Genet. 11, 115–116 (1995). 40. Ehrnhoefer, D. E., Sutton, L. & Hayden, M. R. Small changes, big impact: posttranslational modifications and function of huntingtin in Huntington disease. The Neuroscientist: A Rev. J. Neurobiol. Neurol. Psychiatry 17, 475–492 (2011). 41. Jeong, H. et al. Acetylation targets mutant huntingtin to autophagosomes for degradation. Cell 137, 60–72 (2009). 42. Martin, D. D. et al. Identification of a post-translationally myristoylated autophagyinducing domain released by caspase cleavage of huntingtin. Hum. Mol. Genet. 23, 3166–3179 (2014). 43. Schilling, B. et al. Huntingtin phosphorylation sites mapped by mass spectrometry. Modulation of cleavage and toxicity. J. Biol. Chem. 281, 23686–23697 (2006). 44. Steffan, J. S. et al. SUMO modification of Huntingtin and Huntington’s disease pathology. Science 304, 100–104 (2004). 45. Wellington, C. L. & Hayden, M. R. Caspases and neurodegeneration: on the cutting edge of new therapeutic approaches. Clin. Genet. 57, 1–10 (2000). 46. Wellington, C. L. et al. Inhibiting caspase cleavage of huntingtin reduces toxicity and aggregate formation in neuronal and nonneuronal cells. J. Biol. Chem. 275, 19831–19838 (2000). 47. Yanai, A. et al. Palmitoylation of huntingtin by HIP14 is essential for its trafficking and function. Nat. Neurosci. 9, 824–831 (2006). 48. Duyao, M. P. et al. Inactivation of the mouse Huntington’s disease gene homolog Hdh. Science 269, 407–410 (1995). 49. Nasir, J. et al. Targeted disruption of the Huntington’s disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell 81, 811–823 (1995). 50. Zeitlin, S., Liu, J. P., Chapman, D. L., Papaioannou, V. E. & Efstratiadis, A. Increased apoptosis and early embryonic lethality in mice nullizygous for the Huntington’s disease gene homologue. Nat. Genet. 11, 155–163 (1995). 51. Duran, A. et al. The atypical PKC-interacting protein p62 is an important mediator of RANK-activated osteoclastogenesis. Dev. Cell 6, 303–309 (2004).



13

A RT I C L E S 52. Rodriguez, A. et al. Mature-onset obesity and insulin resistance in mice deficient in the signaling adapter p62. Cell Metab. 3, 211–222 (2006). 53. Cheong, H., Lindsten, T., Wu, J., Lu, C. & Thompson, C. B. Ammonia-induced autophagy is independent of ULK1/ULK2 kinases. Proc. Natl Acad. Sci. USA 108, 11121–11126 (2011). 54. Lee, E. J. & Tournier, C. The requirement of uncoordinated 51-like kinase 1 (ULK1) and ULK2 in the regulation of autophagy. Autophagy 7, 689–695 (2011). 55. Reiner, A., Dragatsis, I., Zeitlin, S. & Goldowitz, D. Wild-type huntingtin plays a role in brain development and neuronal survival. Mol. Neurobiol. 28, 259–276 (2003). 56. Dragatsis, I., Efstratiadis, A. & Zeitlin, S. Mouse mutant embryos lacking huntingtin are rescued from lethality by wild-type extraembryonic tissues. Development 125, 1529–1539 (1998). 57. Cheong, H. et al. Analysis of a lung defect in autophagy-deficient mouse strains. Autophagy 10, 45–56 (2014). 58. Ramesh Babu, J. et al. Genetic inactivation of p62 leads to accumulation of hyperphosphorylated tau and neurodegeneration. J. Neurochem. 106, 107–120 (2008).

14

59. Babu, J. R., Geetha, T. & Wooten, M. W. Sequestosome 1/p62 shuttles polyubiquitinated tau for proteasomal degradation. J. Neurochem. 94, 192–203 (2005). 60. Dragatsis, I., Levine, M. S. & Zeitlin, S. Inactivation of Hdh in the brain and testis results in progressive neurodegeneration and sterility in mice. Nat. Genet. 26, 300–306 (2000). 61. White, J. K. et al. Huntingtin is required for neurogenesis and is not impaired by the Huntington’s disease CAG expansion. Nat. Genet. 17, 404–410 (1997). 62. Kegel, K. B. et al. Huntingtin expression stimulates endosomal-lysosomal activity, endosome tubulation, and autophagy. J. Neurosci. 20, 7268–7278 (2000). 63. Steffan, J. S. Does Huntingtin play a role in selective macroautophagy? Cell Cycle 9, 3401–3413 (2010). 64. Wong, Y. C. & Holzbaur, E. L. The regulation of autophagosome dynamics by huntingtin and HAP1 is disrupted by expression of mutant huntingtin, leading to defective cargo degradation. J. Neurosci. 34, 1293–1305 (2014). 65. Zheng, S. et al. Deletion of the huntingtin polyglutamine stretch enhances neuronal autophagy and longevity in mice. PLoS Genet. 6, e1000838 (2010).



METHODS

DOI: 10.1038/ncb3101 METHODS otherwise indicated. The following fly stocks were obtained from Bloomington Stock Center: A307–Gal4 (no. 6488), Appl–Gal4 (no. 32040), arm–Gal4 (no. 1560), Elav– Gal4 (no. 458), GMR–Gal4 (no. 1104), Cg–Gal4 (no. 7011), UAS–DTS5 (no. 6786), UAS–DTS7 (no. 6785), UAS–mCD8–GFP (no. 5137), UAS–hHtt (no. 33810), UAS– LacZ (no. 1141), UAS–GFP–mCherry–Atg8a (no. 37749). The Ref(2)P c03993 line was a hypomorphic insertion allele from the Harvard Medical School (Exelixis Stock Collection). The dhtt ko−/− mutant and dhtt-minigene Rescue transgenic (‘dhtt Rescue ’) lines were described previously13. The UAS–Tau–GFP line was a gift from M. Packard and atg8ad4 , atg1∆3D , atg13∆81 and atg7 d77 are deletional loss-of-function alleles (gifts from T. Neufeld and references therein)66. The UAS–GFP–CL1 was a gift from U. Pandey67. The HA–dhtt tagging line was derived from a MIMIC insertional line in the dhtt gene (see below). The UAS–Tau-FL–GFP was generated by injecting pUAST-Tau-FL-GFP into w 1118 embryos together with pπ25.7wc helper plasmid followed by standard transgenic procedures.

or ULK1-KO mice were gifts from I. Bezprozvanny24 and M. Kundu37, respectively. All MEFs were maintained in the same DMEM medium. Transfections of small interfering RNAs and plasmid DNA were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. For inducing starvationmediated autophagy, nutrition-rich DMEM medium was replaced by EBSS (E2888, Sigma) for further incubation from 2 h to 6 h as indicated. For studying proteasome inhibition-induced autophagy, MG132 and lactacystin (Enzo) were used in DMEM at a final concentration from 1 µM to 10 µM for the indicated time of incubation. Where indicated, cells were exposed to 0.125 mM oleic acid, 0.3 mM palmitic acid or 50 mM etoposide for 12 h to test their susceptibility to lipotoxic or genotoxic stress. Cell lysates were prepared using Triton lysis buffer (TLB: 20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM sodium orthovanadate, 1 µg ml−1 leupeptin, 1 mM phenylmethylsulphonyl fluoride) or CHAPS lysis buffer (CLB: 40 mM HEPES, pH 7.4, 2 mM EDTA, 10 mM pyrophosphate, 10 mM glycerophosphate, 0.3% CHAPS, protease inhibitors from Roche) as indicated.

HA–dHtt MiMIC line. The dhtt genome-tagging line with an in-frame ‘TagRFP–

Bright-field imaging of adult fly thorax. Adult flies of appropriate genotypes were

3×HA’ tag was generated as described previously68. We used the parental MiMIC insert line MI01636, which contains a MiMIC insertion in an intron region in the dhtt gene. The proper expression of the full-length tagged dhtt protein was confirmed by western blot with anti-HA and anti-dhtt antibodies.

oriented on glass slides with double-sided tape and heated at 95 ◦ C for 5 s to immobilize the animals. Z-stack scanning of the dorsal thorax for each fly was recorded under a ×10 objective using a Zeiss Axioimager Z1 microscope (usually 10–20 layers scanned) and reconstructed into a 3D projection using CZFocus software.

Plasmids. The following plasmids were from the Addgene: HA–p62, Myc–LC3,

Scanning electron microscopy. Scanning electron microscopy of adult thorax

FLAG–Atg13, HA–ULK1, FLAG–ULK1, Myc–ULK1-K46I, Myc–mTOR, Myc– mTOR-KD, Myc–Raptor, HA–Ub-K63, HA–Ub-K48, FLAG–FIP200, FLAG– Atg101, Myc–Rheb, AMPKγ1–HA, AMPKβ1–FLAG, pEGFP-C1-AMPKα1, pEBG-AMPKα1-CA and GFP–Htt. The lentiviral plasmid containing mCherry– GFP–LC3 was developed in our laboratory from the original mammalian expression vector (Addgene). The epitope tags were replaced using standard cloning procedures when needed. Full-length human Htt cDNA was a gift from J. Botas and pRK5GST-BHMT reporter was from P. B. Dennis21. All of the Htt deletion constructs were generated by a PCR subcloning protocol and verified by DNA sequencing.

was performed as described in ref. 70. Briefly, adult flies with proper genotypes were dehydrated with 25% ethanol overnight followed by a gradual exchange to complete ethanol, which was then replaced by a gradual exchange with 25%, 50%, 75% and 100% hexamethydisilazane (HMDS, Sigma) for 6 h or more before vacuum evaporation of the solvent overnight. A JEOL 6500F scanning electron microscope (Rice University) was used for imaging.

Fly stocks. Flies were maintained on standard Drosophila medium at 25 ◦ C unless

Antibodies. Primary antibodies were from the following sources: mouse antiubiquitin (1:1,000, Clone FK2, Millipore); mouse anti-actin (1:10,000, MAB1501, Chemicon and no. ab-6276, Abcam); mouse anti-GFP (1:1,000, MA5-15256, Thermo Scientific); mouse anti-Htt (1:1,000 for immunoblotting and 1:200 for immunostaining, MAB2166, Millipore); mouse anti-GST (1:1,000, sc-57753, Santa Cruz); rabbit anti-LC3 (1:1,000 for immunoblotting and 1:200 for immunostaining, PM036, MBL international and no. 2775S, Cell Signaling); mouse anti-SQSTM1/p62 (1:1,000 for immunoblotting, sc-28359, Santa Cruz); mouse anti-p62 (1:200 for immunostaining, 610832, BD Transduction Lab); mouse anti-SQSTM1/p62 (1:1,000 for endogenous mouse p62, clone 2C11, Abnova); rabbit anti-ULK1 (1:1,000 for endogenous mouse ULK1, no. 8054, Cell Signaling); rabbit anti-Ub-K63 (1:200, clone Apu3, Millipore); rabbit anti-Ub-K48 (1:200, clone Apu2, Millipore); rabbit anti-Raptor (1:1,000, no. 2280, Cell Signaling); rabbit anti-mTOR (1:1,000, no. 2972, Cell Signaling); rabbit anti-β-catenin (1:1,000, no. 9582, Cell Signaling); rabbit anti-beclin 1 (1:1,000, no. 3738, Cell Signaling); rabbit anti-S6K (1:1,000, no. 9202, Cell Signaling); rabbit anti-S6K-Thr389 (1:1,000, no. 9234, Cell Signaling); rabbit anti-4E-BP1 (1:1,000, no. 9452, Cell Signaling); rabbit anti-4E-BP1-Ser65 (1:1,000, no. 9451, Cell Signaling); rabbit anti-ULK1-Ser555 (1:1,000, no. 5869, Cell Signaling); mouse anti-HA (12CA5, Roche); mouse anti-c-Myc (9E10, Santa Cruz); mouse anti-FLAG (M2, Sigma); rabbit anti-Ref(2)P (1:3,000; ref. 69), rabbit antidhtt has been described previously13. Alexa488- (711-545-152 and 715-546-150) and Alexa594-conjugated secondary antibodies (711-585-152 and 715-586-150) for immunostaining (1:500) and Alexa680- (A-21076) and Alexa800- (926-32212) conjugated secondary antibodies for immunoblotting (1:10,000) were from Jackson Labs, Molecular probes-Invitrogen and LI-COR, respectively. Draq5 (1:1,000, no. 4084, Cell Signaling) and Alexa594–phalloidin (1:500, A12381, Invitrogen) were applied in PBS–Tween (PBST) for 30 min to label nuclei and F-actin, respectively.

Cell culture and transient transfection. HEK293T or HeLa cells were maintained in DMEM medium (Mediatech) containing 10% fetal bovine serum (FBS, Invitrogen), 100 IU penicillin, and 100 µg ml−1 streptomycin. Mouse fibroblasts (NIH3T3) and the neuroblastoma cell line Neuro2a (N2a) were obtained from the American Type Culture Collection. NIH3T3 were cultured as above but in 10% heat-inactivated newborn calf serum (Invitrogen). N2a cells were cultured in 10% FBS and supplemented with non-essential amino acids (MEM NEAA, Invitrogen). Mouse striatal-derived cells were from the Coriell Cell Repository. All of the cells lines were tested for mycoplasma contamination using a DNA staining protocol with Hoechst 33258 dye. Serum removal was carried out by thorough washing of the cells with Hanks’ balanced salt solution (Invitrogen) and placing them in serum-free complete medium. Mouse embryonic fibroblasts (MEFs) from Htt-WT and Htt-KO

Cryosection of adult fly thorax. The standard cryosection protocol for Drosophila tissues was applied70. Briefly, fly thoraxes were fixed in 3% formaldehyde in 1×PBS on ice for 1 h, infiltrated with 12% sucrose in PBS at 4 ◦ C overnight and further permeated in O.C.T. (Tissue Tek Compound) at room temperature for 30 min before orientation and embedding. Frozen thoraxes were cut on a cryo-microtome at −20 ◦ C with a section thickness of 10–15 µm on Superfrost slides followed by the standard staining protocol using phalloidin (Sigma).

Climbing assay. Climbing assays were performed as described previously71. Briefly, 30 to 50 flies were placed into the first chamber in the assay slider, tapped to the bottom, and then given 30 s to climb a 10 cm distance. Flies that successfully climbed 10 cm or beyond within 30 s were then shifted to a new chamber, and both sets of flies were given another opportunity to climb the 10 cm distance. This procedure was repeated for a total of at least five times. After five trials or more, the number of flies in each chamber was counted. The climbing index was calculated by measuring the partition coefficient (Cf), as described previously72. Viability assay. Viability assays were performed as described previously13. Briefly, 30 newly hatched female flies of a specific genotype were placed into individual vials with fresh fly food at 25 ◦ C. The number of dead flies was recorded daily. Flies were transferred into a new vial with fresh food every 2–3 days to prevent them from sticking to old food or becoming dehydrated.

Larva starvation assay. L2 or early L3 stage larva (n = 10) were collected and starved in 20% sucrose for 4 h. Fat tissues were dissected in PBS and fixed in 4% paraformaldehyde as previously described73. mCherry–atg8-positive puncta were recorded under the confocal microscope followed by quantitative analysis.

Starvation resistance assay for adult flies. Newly enclosed or 5-day-old female flies raised over standard culture medium were transferred to fly vials (30 flies per vial) containing 0.5% agarose in PBS for the starvation test. Dead flies were counted every 4 h and the survival rate was calculated accordingly.

Proteasome peptidase assay. Whole-fly extracts (30 flies per group) were prepared on ice by homogenization in 0.01 Tris–EDTA, pH 7.5 buffer, followed by centrifugation at 20,817g for 15 min. Total protein concentrations were determined by Bradford assay. Peptidase activities were measured by recording the hydrolysis of the fluorogenic peptides Suc-LLVY-AMC (Anaspec, 63892), Boc-Leu-Arg-ArgAMC (Enzo, BML-BW8515-0005), and Z-Leu-Leu-Glu-βNA (Enzo, BML-ZW85200005) as previously described74.

Fluorescent dyes and immunofluorescent staining. Fly tissues, including larva eye imaginal discs and adult brains, were dissected and fixed in PBS as described

NATURE CELL BIOLOGY


METHODS

DOI: 10.1038/ncb3101

previously13. Frozen sections or fixed tissues or cells were blocked in 10% normal goat serum at room temperature for 1 h followed by incubation in primary antibodies at 4 ◦ C overnight, then stained with Alexa-594- or Alexa-488-conjugated secondary antibodies (Jackson Immunolaboratory). Washed samples were mounted in 80% glycerol solution with DAPI or Draq5. Images were captured by a Zeiss Axioimager Z1 or Leica confocal microscope. Neutral lipids were stained with Bodipy 493/503 (D-3922) (Molecular Probes) as described previously22. Where indicated, cells were incubated with LysoTracker Red DND-99 (L-7528), MitoTracker Green FM (M-7514), MitoTracker Red CMXROS (M-7512) or Transferrin Alexa 488 (T-13342) (Molecular Probes) according to the manufacturer’s instructions. Oleic acid (Sigma-Aldrich) was conjugated to albumin as described previously22, and cells were treated with 0.125 mM oleate (OL) for 24 h unless otherwise stated. Mitochondria depolarization was induced by exposure to 2 µM FCCP (Sigma) for 12 h. Images were captured using a Carl Zeiss Axiovert 200 Fluorescence microscope equipped with a ×63 Objective and ApoTome.2. Colocalization was determined using the JACoP Plug-In on ImageJ (NIH).

Transmission electron microscopy, immunogold labelling and morphometric analysis. Cells were cultured in monolayers, trypsinized, washed and subsequently fixed with 2.5% glutaraldehyde, and 2% paraformaldehyde in 0.1 M sodium cacodylate buffer pH 7.4 for 3 h at 4 ◦ C. Cells were post-fixed with 1% osmium tetroxide, dehydrated with graded series of ethanol, and then infiltrated and embedded using Epon 812 (Electron Microscopy Sciences). Ultrathin sections (70–80 nm) were cut using a Leica Ultramicrotome and stained using uranyl acetate and contrasted with lead citrate. Samples were viewed under a Jeol JEM-1200EX transmission electron microscope (Jeol) at 80 kV. Morphometric analysis was done using ImageJ (NIH). Briefly, cytosolic area and individual autophagic vesicle areas were calculated after tracing the membrane profiles using the measure function of the ImageJ software. Classification of autophagic vacuoles according to their luminal content was done by double-blinded independent observers using one singlecategory allocation for each vesicle. Immunogold labelling was performed on cells fixed with 0.1% glutaraldehyde, 4% paraformaldehyde in 0.1 M sodium cacodylate buffer, pH 7.4 for 3 h at 4 ◦ C. Cells were dehydrated with graded series of ethanol, and then infiltrated and embedded using LR White (Polysciences). Ultrathin sections were cut as described above. Grids were aldehyde-inactivated with glycine–PBS, blocked with anti-goat AURION blocking solution, incubated with primary and the corresponding 10-nm-gold-conjugated secondary antibodies.

Western blotting. Standard 10 to 14% SDS–PAGE gels were used for separation of most proteins except for Huntingtin, which was better analysed by NuPAGE TrisAcetate gels from Invitrogen specially formulated for detection of proteins with a large molecular weight. The boiled samples were separated on SDS–PAGE and transferred to nitrocellulose membranes from Millipore. After blocking with 5% non-fat milk in Tris-buffered saline with 0.1% Tween-20 for 1 h, membranes were incubated with primary antibodies. Secondary antibodies conjugated with Alexa800 or Alexa-680 (Invitrogen) or HRP (KPL) were used and the signals were detected by the Odyssey Infrared Imaging System or LAS 300 Imaging system (Fujifilm) and quantified by Odyssey Application Software 3.0 or by densitometry of the digital images using ImageJ software (NIH).

Ubiquitylated proteins analysis. Ubiquitylated proteins analysis was conducted as previously described with a minor modification75. Briefly, about 20–30 adult fly heads of indicated ages were collected and the whole protein lysates were extracted using ubiquitylated protein extraction buffer (2% SDS with 6 M urea) with brief sonication. The profile of ubiquitylated proteins from the extract was revealed by western blot using mouse monoclonal anti-ubiquitin antibody (Clone FK2, Millipore) in 12% SDS–PAGE containing 6 M urea.

GST–BHMT assay. The GST–BHMT assay was performed as described previously21. Briefly, pRK5-GST-BHMT was co-transfected with different siRNAs into cells as indicated in the study, which were then treated with different assay conditions such as nutrition starvation using EBSS or proteasome inhibition using MG132. The accumulation of GST–BHMT-FRAG was detected by using mouse anti-GST antibody (B14, Santa Cruz) and normalized against the internal control GFP protein, which was expressed after the internal ribosome site (IRES) in the same pRK5-GST-BHMT construct.

Autophagic measurements. All autophagy assays were carried out as previously described76–78. For the LC3 lipidation assay, cells were collected in 2% Triton X-100/PBS buffer containing protease inhibitors for maximum LC3-II extraction according to the previous studies76. LC3-II and loading control actin were detected by rabbit anti-LC3 antibody (MBL international) and mouse anti-actin antibody (Chemicon), respectively. The level of LC3 lipidation was quantified as the ratio of the measured LC3-II to actin levels. LC3 flux was quantified as the relative

ratio of LC3-II/actin values between samples with or without the presence of lysosome inhibitor BafA1 or a mixture of ammonium chloride (20 mM; American Bioanalytical) and leupeptin (100 µM; Fisher Bioreagents). LC3-II synthesis (autophagosome biogenesis) was calculated as the differences in LC3-II levels at two different times on inhibition of lysosomal proteolysis as described previously79. For the LC3 puncta formation assay, cells were fixed by 4% paraformaldehyde (10 min at room temperature (RT), permeabilized by 50 µg ml−1 digitonin (10 min, RT), quenched by 50 mM NH4 Cl (freshly made, 5 min RT) and followed by standard antibody staining. The primary and secondary antibodies used were rabbit anti-LC3 antibody (MBL international) and Alexa-488 anti-rabbit IgG (Jackson ImmunoResearch Laboratories). For each assay condition, the puncta profile data were calculated by averaging the total number of LC3-positive puncta per cell from about 30–50 representative cells. For mCherry–GFP–LC3 conversion, NIH3T3 fibroblasts, MEFs, N2a and striatal cells were transduced with a lentivirus carrying the tandem construct and cells were analysed at least one week after transduction to assure stable expression. Cells were plated in glass-bottom 96-well plates and fluorescence after the indicated treatment was read in both channels using a high-content microscope (Operetta, Perkin Elmer). Images of 9 different fields per well were captured, which rendered an average of 2,000–3,000 cells counted. Nuclei, cell perimeter and puncta were identified using the manufacturer’s software. Puncta positive for both fluorophores correspond to autophagosomes whereas those only positive for the red fluorophore correspond to autolysosomes. Autophagic flux was determined as the conversion of autophagosomes to autolysosomes (red-only puncta). For the P62 turnover assay, cells were extracted in Triton lysis buffer (TLB). The supernatants were saved as the soluble fraction of p62 (sp62). The pellets were washed once with TLB and dissolved in SDS–Urea buffer (2% SDS plus 6 M urea) and saved as the insoluble portion of p62 (Insp62). To examine the total level of p62 protein, cells were directly lysed in SDS–urea buffer followed by SDS–PAGE analysis. The protocol for the large p62 body formation assay was the same as that for the LC3 puncta formation assay except for the use of guinea pig anti-p62 antibody (PROGEN Biotechnik) as the primary antibody and Alex-488 anti-guinea pig IgG as the secondary antibody (Jackson ImmunoResearch Laboratories). Data were calculated by averaging the total number of large p62 bodies per cell after counting about 50–100 cells with similar p62 staining pattern. Analyses of intracellular protein degradation were performed by metabolic labelling (with [3 H]leucine (2 µCi ml−1 ) for 48 h at 37 ◦ C) and pulse-chase experiments as described previously17. Macroautophagy-dependent degradation was inhibited using 3-methyladenine (10 mM; Sigma) and lysosomal-dependent degradation was inhibited using the mixture of ammonium chloride and leupeptin (N/L). Different stressors, oleic acid (0.125 mM), lactacystin (1 µM; Enzo Life Sciences) and the mitochondrial depolarizer FCCP (2 µM; Sigma), were added directly to the culture media.

Co-immunoprecipitation. Transiently transfected HEK293T cells in 60 mm dishes were lysed in TLB or CLB as indicated, sonicated three times for 5 s each, and centrifuged at 14,000 r.p.m. for 30 min at 4 ◦ C. For LC3 co-immunoprecipitation, samples were solubilized in 25 mM Tris (pH 7.2), 150 mM NaCl, 5 mM MgCl2 , 0.5% NP-40, 1 mM dithiothreitol, 5% glycerol and protease inhibitors for 15 min on ice and then centrifuged for 15 min at 16,000g . Epitope-tagged proteins or endogenous proteins were immunoprecipitated from the cell lysate with anti-HA, anti-Myc, antiFLAG, anti-Htt, anti-p62 and anti-ULK1 antibodies and Protein A/G Plus-agarose beads (sc-2003, Santa Cruz) as indicated. Immunoprecipitates or whole-cell extracts (WCEs) were analysed by standard western blotting.

RNA interference. The duplex RNA oligonucleotides for siRNA (Sigma) were used at 1–10 nM for knockdown of target genes in HEK293T or HeLa cells, as indicated. The sequences for the sense oligonucleotides were: Htt1-sense siRNA (50 -aacuuucagcuaccaagaaag-30 ; ref. 80) and Htt-2-sense siRNA (50 -caggguagaauuguuuggcaa-30 ) (validated sequence from Qiagen); beclin1-sense siRNA (50 -accgacuuguuccuuacggaa-30 ); Ctrl siRNA (negative control from Qiagen). Lentivirus constructs carrying shRNA against Huntingtin were generated as described previously81 and delivered to cultured cells on packaging into replicationdeficient lentiviral particles to generate Huntingtin knockdown clones. The shRNA transfer vector plasmid against Huntingtin was obtained from Sigma Mission Library (gene ID: NM_010414; clone TRCN0000100348 (50 -ccg gcctcatccattgtgtgcgattctcgagaatcgcacacaatggatgaggtttttg-30 ) and TRCN0000100349 (50 -ccggcctccagtacaagactttattctcgagaataaagtcttgtactggaggtttttg-30 ) for the mouse Htt and gene ID: NM_002111: clones TRCN0000019872 (50 -ccgggcccttcaaca ggcacatttactcgagtaaatgtgcctgttgaagggcttttt-30 ) and TRCN0000019873 (50 -ccgggct gctgacttgtttacgaaactcgagtttcgtaaacaagtcagcagcttttt-30 ) for human Htt. Control cells were transduced with lentiviral particles carrying only the empty vector. Knockdown of the protein of interest (Huntingtin) was tested periodically (each 2–3 months) during the study and representative immunoblots for the absence of

NATURE CELL BIOLOGY


METHODS

DOI: 10.1038/ncb3101 the proteins are included in the manuscript. We did not find differences between the two Htt shRNAs used in this study and consequently, where indicated, data from both clones were pooled.

In vitro ULK1 kinase assay. The in vitro ULK1 kinase assay was performed as previously described25. Briefly, FLAG–ULK1 or FLAG–ULK1-K46I was transfected into HEK293T cells. Thirty-six to forty-eight hours after transfection, cells were lysed in TLB. Supernatants were incubated with M2 beads (Sigma) and washed three times by TLB followed by a wash using ULK1 kinase buffer (10 mM cold ATP, 25 mM HEPES, pH 7.4) before addition of γ-p32 ATP to 0.5 µCi and myelin-binding protein (MPB) to 0.3 mg ml−1 for 20 min of kinase reaction. To ensure reproducibility, during the in vitro kinase assay, the ULK1 protein applied to each sample was enriched through immunoprecipitation, and the final amount of ULK1 immunoprecipitated was evaluated by immunoblot, which verified only minor negligible variations among different samples. To stop the reaction, 4× SDS sample buffer was used, and this was followed by SDS–PAGE and autoradioactive exposure using X-ray film (Kodak). mTOR kinase assay. Both, the in vivo and in vitro mTOR kinase assays were performed as previously described82. Briefly, for the in vivo mTOR kinase assay, HEK293T cells in 60 mm dishes transfected with different plasmids or siRNAs as indicated were lysed in TLB. After denaturing in SDS sample buffer, samples were subjected to western blotting analysis using anti-p-S6K (Thr389) and antiS6K antibodies for detection of the phosphorylation and expression levels of the endogenous S6K protein, respectively. For the in vitro mTOR kinase assay, HEK293T cells in 60 mm dishes transfected with the indicated plasmids were lysed in CLB. FLAG-tagged mTOR complex 1 (mTORC1) was immunoprecipitated by M2 beads and washed three times with CLB and twice by mTOR kinase assay buffer (25 mM HEPES pH 7.4, 50 mM KCl, 10 mM MgCl2 , 250 µM ATP) before adding purified 150 ng GST–4E-BP1 (SignalChem) and incubated for 20 min at 30 ◦ C. The kinase reaction was stopped by adding 4× SDS sample buffer followed by western blotting using anti-4E-BP1 (Thr 65) and anti-p4E-BP1 to detect the phosphorylation and protein expression of 4E-BP1 target, respectively.

Lipid metabolism assays. Rates of fatty acid β-oxidation were determined by metabolic radioactive labelling as described earlier22 and by respiratory measurements. Briefly, cells pretreated with OL were incubated with [14 C]oleate– BSA (0.8 µCi, 4 h) and the rate of carbon dioxide production resulting from the oxidation of [14 C]oleate was measured on trapping the released [14 C]carbon dioxide at 37 ◦ C for 1 h onto filter paper pre-soaked in 100 mM sodium hydroxide. The rate of β-oxidation was calculated as the amount of trapped [14 C]carbon dioxide in relative units produced per milligram of protein per hour. Equal numbers of cells were plated in XF96 plates (Seahorse Bioscience) in low-glucose DMEM (GIBCO) supplemented with serum. Cells were treated with OL for 16 h and cell respiration was assayed as time-resolved measurements of the oxygen consumption rate (OCR) in a respirometer (Seahorse Bioscience). Fatty acid β-oxidation was calculated as specified by the manufacturer by injecting etomoxir (50 µM) into the buffered assay medium. Inducible Tau-expression line. The Clontech Lenti-X Tet-OFF advanced inducible expression system was used to generate the inducible Tau line in HeLa cells. Basically, HeLa cells were infected by mixed lentivirus containing pLVX-Tet-off Advanced and pLVX-Tight-Puro-Tau1C-GFP. Stable clones were selected against 2 µg ml−1 puromycin and 200 µg ml−1 G418 in the presence of 100 ng ml−1 Dox to repress transgene expression. Tau1C–GFP expression can be inducibly expressed by removal of Dox.

Statistics analysis and data acquisition. The statistical significance of the difference between experimental groups was determined by two-tailed unpaired Student’s t-test, or one-way analysis of variance followed by Bonferroni’s post hoc test. Where multiple comparisons were performed, we used normalization to control values. Differences were considered significant for P < 0.05 (noted in the figures as ∗ ). Data are presented as mean + s.e.m from a minimum of three independent experiments. The exact sample size (n) is indicated in each figure and it corresponds to individual experiments unless otherwise stated. All of the experiments were done at least 3 times and in duplicate or triplicate to account for technical variability. For the studies in Drosophila, sample group allocation was based on genotype and the genotypes were blinded to the observer except for those cases in which tissues from different animals have to be pooled. For the morphometric analysis, quantification of annotated micrographs was independently reviewed by two observers and the average of their scoring was used for each micrograph. For immunofluorescence and direct fluorescence quantifications of co-localization, number of puncta per cell and ratio of red to green fluorophore were performed blinded. For the studies of analysis of changes in different steps of the autophagic process an estimate of variation was performed based on previous studies from our groups12,22,79,83 and the variance was found similar to the one in the groups being statistically compared in this study. 66. Scott, R. C., Juhasz, G. & Neufeld, T. P. Direct induction of autophagy by Atg1 inhibits cell growth and induces apoptotic cell death. Curr. Biol. 17, 1–11 (2007). 67. Pandey, U. B. et al. HDAC6 rescues neurodegeneration and provides an essential link between autophagy and the UPS. Nature 447, 859–863 (2007). 68. Venken, K. J. et al. MiMIC: a highly versatile transposon insertion resource for engineering Drosophila melanogaster genes. Nat. Methods 8, 737–743 (2011). 69. Carre-Mlouka, A. et al. Control of sigma virus multiplication by the ref(2)P gene of Drosophila melanogaster: An in vivo study of the PB1 domain of Ref(2)P. Genetics 176, 409–419 (2007). 70. Sullivan, W., Ashburner, M. & Hawley, R. S. Drosophila Protocols 240–241 (Cold Spring Harbor Laboratory Press, 2000) Ch. 13, Protocol 13.5. 71. Benzer, S. Behavioral mutants of Drosophila isolated by countercurrent distribution. Proc. Natl Acad. Sci. USA 58, 1112–1119 (1967). 72. Kamikouchi, A. et al. The neural basis of Drosophila gravity-sensing and hearing. Nature 458, 165–171 (2009). 73. Juhasz, G. & Neufeld, T. P. Experimental control and characterization of autophagy in Drosophila. Methods Mol. Biol. 445, 125–133 (2008). 74. Wilk, S. & Orlowski, M. Evidence that pituitary cation-sensitive neutral endopeptidase is a multicatalytic protease complex. J. Neurochem. 40, 842–849 (1983). 75. Cumming, R. C., Simonsen, A. & Finley, K. D. Quantitative analysis of autophagic activity in Drosophila neural tissues by measuring the turnover rates of pathway substrates. Methods Enzymol. 451, 639–651 (2008). 76. Kimura, S., Fujita, N., Noda, T. & Yoshimori, T. Monitoring autophagy in mammalian cultured cells through the dynamics of LC3. Methods Enzymol. 452, 1–12 (2009). 77. Bjorkoy, G. et al. Monitoring autophagic degradation of p62/SQSTM1. Methods Enzymol. 452, 181–197 (2009). 78. Klionsky, D. J. et al. Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy 8, 445–544 (2012). 79. Pampliega, O. et al. Functional interaction between autophagy and ciliogenesis. Nature 502, 194–200 (2013). 80. Godin, J. D. et al. Huntingtin is required for mitotic spindle orientation and mammalian neurogenesis. Neuron 67, 392–406 (2010). 81. Massey, A. C., Follenzi, A., Kiffin, R., Zhang, C. & Cuervo, A. M. Early cellular changes after blockage of chaperone-mediated autophagy. Autophagy 4, 442–456 (2008). 82. Ikenoue, T., Hong, S. & Inoki, K. Monitoring mammalian target of rapamycin (mTOR) activity. Methods Enzymol. 452, 165–180 (2009). 83. Bejarano, E. et al. Connexins modulate autophagosome biogenesis. Nat. Cell Biol. 16, 401–414 (2014).

NATURE CELL BIOLOGY


S U P P L E M E N TA R Y I N F O R M AT I O N DOI: 10.1038/ncb3101

0

d

d2

15

dhttko-/-

ATau/+; dhttko/+

d3

0/153 ATau/+ dhttko-/ATau/+; dhttko-/ATau/dhttRescue; dhttko-/-

100 80

40 20

atg8ad4/+; atg8ad4-/ATau/+; dhttko/+ d5 d6

14

28

d7

atg8ad4-/-; ATau/+

42

Supplementary Figure 1 Ectopic Tau expression reveals genetic interaction between dhtt and autophagy pathway. (a) Tau expression induced the collapsed thorax phenotype in homozygous dhttko-/- mutants (arrow in a3) that can be rescued by the presence of a dhttRescue transgene (a4). Bright field images of adult thorax, dorsal view (pooled from n=3 independent experiments). (b,c) Tau expression induced more severe mobility (b) and viability phenotypes (c) in dhttko mutants that can be rescued by the presence of a dhttRescue transgene (pooled from n=3 independent experiments). (d,e) dhtt genetically interacts with multiple autophagy pathway components. Bright field images of adult thorax, dorsal view. Tau

100 75 50 25

d1 d2 d3 d4 d5 d6 d7

100 146/149

0

32/218

25

241/278

50

0/221

75 0/165

ATau/+; atg1D3D/dhttko e5

Penetrance (%)

ATau/ ATau/ref(2)Pc03993; ATau/+; ref(2)Pc03993 dhttko/+ atg1D3D/+ e3 e4 e2

thorax

e1

+/+

70 day

56

0

e

(n=968) (n=1305) (n=1095) (n=732)

60

0

30 day

atg8ad4/+; ATau/+ d4

232/243

Tau expression reduces viability in dhttko-/- mutants

thorax

d1

+/+

1

a4

178/194

* *

a3

205/229

0.2

* *

a2

0/137

* *

a1

0/156

0.4

0

0/188

*

25

0/216

0.6

(n=355) (n=262) (n=417) (n=380)

50

0/102

Climbing index

0.8

mutants

ATau/+ dhttko-/ATau/+; dhttko-/ATau/dhttRescue; dhttko-/-

c

75

Penetrance (%)

Tau expression reduces mobility in 1

dhttko-/-

Survival rate %

b

100

0/227

ATau/dhttRescue; dhttko-/a4

ATau/+; dhttko-/a3 a2

0/189

a2

ATau/+

thorax

a1

+/+

Penetrance (%)

a

e1

e2

e3

e4

e5

expression induced the collapsed thorax phenotype both in homozygous

Supplementary 1and in atg8ad4-/- (arrow in d7) mutant flies. Similar (arrow in a3) dhttko -/-Figure

phenotype was also observed in Tau-expressing flies carrying double heterozygous mutations for both dhttko and one of the following mutant alleles: atg8ad4 (d5), ref(2)pc003993 (e3) or atg1∆3D(e5), but not in all other controls. The penetrance of the phenotype was quantified as bar graphs to the right (d) or below (e). Genotypes are as indicated (pooled from n=3 independent experiments). All values are mean+s.e.m. and differences are significant for *P GMR-Gal4> UAS-GFP-CL1 UAS-GFP-CL1

e

5 week

WT

dhttRescue/+; dhttko-/-

WT

dhttko-/-

1 week

dhttko-/-

a

28°C

mCherry-Atg8 Draq5

UASDTS7

Starved

28°C arm-Gal4> UAS-Tau-∆C +/+

UASDTS7

UASLacZ

+/+

22°C arm-Gal4> UAS-Tau-∆C

UASLacZ

c

Ubiquitin

h

Fed

starved n.s .

Atg8a-Positive Puncta

50 40

dhttko-/-

20 10

28°C ATau/+; ATau/UAS-DTS5 UAS-DTS7/+

Thorax

22°C ATau/+; ATau/UAS-DTS5 UAS-DTS7/+

Muscle

F-Actin

i

0

100 Survival rate (%)

d

+/+

30

Actin

CS dhttko-/CS dhttko-/-

80 60

(newly eclosed) (newly eclosed) (5 days old) (5 days old)

40 20 0

12

24

36

48

60

72

84

96

hours

Supplementary Figure 2

Supplementary Figure 2 dhtt does not affect proteasome activity and starvation response in Drosophila. (a) Increased accumulation of total ubiquitinated proteins in aged (5-week-old) dhttko-/- mutants compared to aged-matched controls (wildtype (WT) and dhttko-/- carrying a wildtype dhtt rescue transgene dhttRescue). Young flies (1-week-old) showed similar low levels of total ubiquitinated proteins in all the three genotypes. Bar graph below shows the quantification of the levels of total ubiquitinated proteins detected with antiubiquitin antibody by western blotting (n=3 independent experiments). (b and c) Abnormal eye phenotypes (b) and increase ubiquitination (c) associated with proteasome dysfunction. (b) Bright field images of adult fly eyes. Note the rough eye phenotype due to proteasome inactivation by DTS5 or DTS7, two temperature-sensitive, dominant-negative alleles of proteasome subunits at the non-permissive 28oC, as compared to the normal eye morphology in flies of the same genotypes raised at permissive temperature of 22oC (compare a2 and a3 with a5 and a6). GMR-Gal4 driver was used to direct eye-specific expression of UAS-DTS5 and DTS7. LacZ was used as negative control (a1 and a4). Scale bar: 50 μm. Anterior up and ventral to the right in all panels. n>15 fly eyes from 3 independent experiments. (c) Total proteins from flies of the indicated genotypes were extracted by lysis buffer containing 1% Triton X-100 and separated by 10% SDS-PAGE gel. The level of ubiquitination was revealed by anti-Ub antibody (FK2). Actin served as loading control. Note the significantly increased levels of ubiquitinated proteins in flies expressing the dominantnegative DTS7 mutant driven by arm-Gal4 under restrictive temperature of 28°C but not at 22°C or in controls (n=3 independent experiments). (d) Normal thorax morphology (top panels) and internal muscle structures (bottom panels) in flies expressing Tau together with the dominant-negative DTS5 or DTS7 alleles of proteasome subunits at either permissive 22oC or nonpermissive 28oC temperatures, as indicated. Top panels: bright field images of external thorax morphology; bottom panels: cross section views of underlying muscle structures, as revealed by confocal imaging of F-Actin patterning from phalloidin staining (bottom). Note the similar smooth thorax surface and intact

internal muscle structures in all panels. Simultaneous expression of Tau and DTS5 or DTS7 were driven by A307-Gal4 line, as indicated. Scale bar: 100 μm. n>10 fly bodies from 3 independent experiments. (e) Normal UPS activity in dhttko-/- mutants. No obvious accumulation of UPS reporter GFP-CL1 signal in dhttko-/- mutants in either the eye imaginal discs of third instar larvae (c2 and c4) or 3-day-old adult brains (c6 and c8) at either 22oC or 28oC. In contrast, in the positive controls that expressed a temperature-sensitive dominantnegative UPS mutant (DTS7) at a non-permissive temperature of 28oC (c3 and c7), there is a strong accumulation of the UPS reporter GFP-CL1. Scale bar: 100 μm. n>8 fly samples from 3 independent experiments. (f) Normal catalytic activities of proteasome subunits in dhttko-/- mutants. Caspase-like, trypsin-like and chymotrypsin-like peptidase activities were measured using whole-animal extracts from young (5-day-old) or old (40-day-old) wild-type and dhttko-/- flies, and their relative activities are presented with results from young wildtype flies as standard value of 1. n.s.: no statistical significance. n=18 fly extracts for each genotype, pooled from 3 independent experiments. (g, h) dhtt is not required for the starvation-induced autophagy. Autophagosomes and autolysosome in fat bodies of 80-hour larvae were labeled with mCherryAtg8a (red). Starvation induced similar strong increase of red puncta (autophagosomes and autolysosome) in both the wildtype and dhttko-/- mutants, as quantified in the bar graphs to the right. UAS-mCherry-Atg8a reporter was driven by the fat body-specific Cg-Gal4 driver. Tissues were double-labeled with DAPI (blue) for cell nuclei. (h) Bar graph shows the quantification of the average number of mCherry-Atg8a-positive punctae. n=60 cells for each genotype, pooled from 3 independent experiments. (i) Starvation-resistance assay. Newly eclosed or 5-day-old adult flies were subjected to starvation. dhttko-/- mutants showed similar survival curve as wildtype control (CS, Canton S). n=155 flies (newly eclosed CS), n=160 (newly eclosed dhttko-/- ), n=203 (5 days CS), n=180 (5 days dhttko-/- ), pooled from 3 independent experiments. All values are mean+s.e.m. and differences are significant for *P UAS-Tau-FL

arm-Gal4> UAS-Tau-∆C

armGal4/+

arm-Gal4/+

EIV 382

Tau-∆CT 1

arm-Gal4>UAS-hHtt; dhttko-/-

b

R1 R2 R3 R4

Tau-FL 1

arm-Gal4>UAS-GFP/dhttRescue; dhttko-/-

a

arm-Gal4>UAS-GFP; dhttko-/-

S U P P L E M E N TA R Y I N F O R M AT I O N

GFP dHtt

Tau-FL Tau-∆C

hHtt

Actin

1

60

*

20

* * 30

45

0

day

f

Human Htt rescues mobility defect in ATau; dhttko-/- mutants

** * *

15 5 week

56

70 day

40 20 0

0

14

28

42

56

70 day

h 30

Ub

*

*

i

20

Tau-∆C

Fold Change

WT

hHtt; dhttko-/-

dhttko-/-

1 week

42

60

day

30

10 0

hHtt;dhttko-/-

1

hHtt; dhttko-/-

0

WT

*

**

dhttko-/-

0.2

28

Tau-∆C/dhttRescue; dhttko-/-

*

0.4

WT

0.6

dhttko-/-

Climbing index

0.8

(n=239) (n=280) (n=445) (n=317)

14

Human Htt rescues viability defect in ATau; dhttko-/mutants ATau/UAS-GFP (n=815) ATau/UAS-GFP; dhttko-/- (n=564) 100 ATau/dhttRescue; dhttko-/- (n=672) ATau/UAS-hHtt; dhttko-/- (n=833) 80

Survival Rate %

ATau/UAS-GFP ATau/UAS-GFP; dhttko-/ATau/dhttRescue; dhttko-/ATau/UAS-hHtt; dhttko-/-

1

0

Tau-∆C/hHtt; dhttko-/-

15

Tau-∆C; dhttko-/-

0

40

*

**

hHtt;dhttko-/-

0.4

g

(n=1043) (n=926) (n=718) (n=1221)

80

0.6

0.2

e

GFP/+ GFP/+; dhttko-/GFP/dhttRescue; dhttko-/hHtt/+; dhttko-/-

100

dhttko-/-

Climbing index

0.8

d

(n=290) (n=374) (n=358) (n=426)

Survival Rate %

GFP/+ GFP/+; dhttko-/GFP/dhttRescue; dhttko-/hHtt/+; dhttko-/-

WT

c

Actin

Tau-∆C Actin

Actin

Supplementary Figure 3 Supplementary Figure 3 Human Htt rescues dhttko mutant-associated phenotypes. (a) Schematics of the C-terminus truncated Tau (Tau-ΔC, missing last 49 amino acids) used in the study, as compared to the full-length (FL) Tau. Below: western blotting analysis to confirm the expression of Tau deletion used in the study. Note the smaller size of the C-terminus truncated Tau (Tau-ΔC), as compared to that of the full-length Tau. Both Tau transgenes are tagged with GFP epitope at their C-termini. In (a-d), the ubiquitous arm arm-Gal4 driver was used to drive the ectopic Tau expression, protein expression was examined by anti-GFP antibody, with Actin served as loading control. +/+: samples from wildtype non-transgenic flies. (b) Confirmation of the proper expression of endogenous dHtt as well as the human full-length Huntingtin (hHtt) and GFP proteins from the corresponding transgenes by Western blotting analyses. The ubiquitous arm-Gal4 driver was used to drive the hHtt and GFP transgene expression. n=3 independent experiments. (c and d) Ectopic expression of full-

length human Huntingtin (hHtt) significantly rescued several dhttko associated phenotypes, including (c) the reduced mobility and (d) shortened lifespan of mutant adults. N values are indicated in the figure and were pooled from 4 independent experiments. (e and f) Ectopic expression of hHtt significantly rescued Tau-induced phenotypes in dhttko mutant background, including the exacerbated (e) mobility decline and (f) reduced lifespan. A307-Gal4 driver was used to drive the Tau-ΔC-GFP and hHtt expression. N values are indicated in the figure and were pooled from n=4 independent experiments. (g-i) hHtt partially suppressed the increased accumulations of (g-h) total ubiquitinated proteins and (f) Tau-ΔC in dhttko-/- mutant flies. Ubiquitous arm-Gal4 driver was used to drive the hHtt expression; Tau-ΔC level was examined by anti-GFP antibody, with Actin serving as loading control. n=3 independent experiments. All values are mean+s.e.m. and differences are significant for *P

Potential function for the Huntingtin protein as a scaffold for selective autophagy.

A missing piece of the puzzle: Atg11 functions as a scaffold to activate Atg1 for selective autophagy.

Huntingtin facilitates selective autophagy.

The proteasome subunit RPN10 functions as a specific receptor for degradation of the 26S proteasome by macroautophagy in Arabidopsis.

The RNA helicase DHX34 functions as a scaffold for SMG1-mediated UPF1 phosphorylation.

4-Aryliden-2-methyloxazol-5(4H)-one as a new scaffold for selective reversible MAGL inhibitors.

Exploring N-Arylsulfonyl-l-proline Scaffold as a Platform for Potent and Selective αvβ1 Integrin Inhibitors.

SnapShot: Macroautophagy.

Huntingtin in selective autophagy and Huntington disease: A foe or a friend within?

Synthetic Calcite as a Scaffold for Osteoinductive Bone Substitutes.

The albumin-binding domain as a scaffold for protein engineering.

Potency of fish collagen as a scaffold for regenerative medicine.

Remineralized bone matrix as a scaffold for bone tissue engineering.

Temporal Attention as a Scaffold for Language Development.

Recent developments with rhodanine as a scaffold for drug discovery.

Bioresorbable scaffold as a dermal substitute.

Rad4 mainly functions in Chk1-mediated DNA damage checkpoint pathway as a scaffold protein in the fission yeast Schizosaccharomyces pombe.

IGFBP-2 Signaling During Osteoblast Differentiation.

Targeting FAK scaffold functions inhibits human renal cell carcinoma growth.

Scaffold analysis of PubChem database as background for hierarchical scaffold-based visualization.

The machinery of macroautophagy.

Alternative macroautophagy and mitophagy.

Preclinical Evaluation of a Lentiviral Vector for Huntingtin Silencing.

Galactosylated reversible hydrogels as scaffold for HepG2 spheroid generation.