Am J Physiol Lung Cell Mol Physiol 308: L891–L903, 2015. First published March 6, 2015; doi:10.1152/ajplung.00377.2014.

CALL FOR PAPERS

Translational Research in Acute Lung Injury and Pulmonary

Fibrosis

Hyaluronan mediates airway hyperresponsiveness in oxidative lung injury Ahmed Lazrak,1 Judy Creighton,1 Zhihong Yu,1 Svetlana Komarova,1 Stephen F. Doran,1 Saurabh Aggarwal,1 Charles W. Emala Sr,2 Vandy P. Stober,3 Carol S. Trempus,3 Stavros Garantziotis,3* and Sadis Matalon1* 1

Department of Anesthesiology and Pulmonary Injury and Repair Center, School of Medicine, University of Alabama at Birmingham, Birmingham, Alabama; 2Department of Anesthesiology, Columbia University, New York, New York; and 3Laboratory of Respiratory Biology, National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina Submitted 10 December 2014; accepted in final form 3 March 2015

Lazrak A, Creighton J, Yu Z, Komarova S, Doran SF, Aggarwal S, Emala CW Sr, Stober VP, Trempus CS, Garantziotis S, Matalon S. Hyaluronan mediates airway hyperresponsiveness in oxidative lung injury. Am J Physiol Lung Cell Mol Physiol 308: L891–L903, 2015. First published March 6, 2015; doi:10.1152/ajplung.00377.2014.—Chlorine (Cl2) inhalation induces severe oxidative lung injury and airway hyperresponsiveness (AHR) that lead to asthmalike symptoms. When inhaled, Cl2 reacts with epithelial lining fluid, forming by-products that damage hyaluronan, a constituent of the extracellular matrix, causing the release of low-molecular-weight fragments (L-HA, ⬍300 kDa), which initiate a series of proinflammatory events. Cl2 (400 ppm, 30 min) exposure to mice caused an increase of L-HA and its binding partner, inter-␣-trypsin-inhibitor (I␣I), in the bronchoalveolar lavage fluid. Airway resistance following methacholine challenge was increased 24 h post-Cl2 exposure. Intratracheal administration of highmolecular-weight hyaluronan (H-HA) or an antibody against I␣I post-Cl2 exposure decreased AHR. Exposure of human airway smooth muscle (HASM) cells to Cl2 (100 ppm, 10 min) or incubation with Cl2-exposed H-HA (which fragments it to L-HA) increased membrane potential depolarization, intracellular Ca2⫹, and RhoA activation. Inhibition of RhoA, chelation of intracellular Ca2⫹, blockade of cation channels, as well as postexposure addition of H-HA, reversed membrane depolarization in HASM cells. We propose a paradigm in which oxidative lung injury generates reactive species and L-HA that activates RhoA and Ca2⫹ channels of airway smooth muscle cells, increasing their contractility and thus causing AHR. calcium; chlorine; human airway smooth muscle; membrane potential; patch clamp

contributor to acute lung injury and resulting morbidity. Numerous environmental insults can produce reactive oxygen species, which damage airway epithelia, activate the immune response, and result in airway remodeling and dysfunction (41). Common reactive species include superoxide, hydroxyl radicals, hydrogen peroxide, and hypochlorous acid like HOCl, which is generated after exposure to chlorine gas (Cl2) and by activated neutrophils. Cl2 is essential to the global chemical industry and has a potential significant global public health impact. According to the World Chlorine Council (http://www.worldchlorine.org), 62.8 million metric tons are produced globally, 20% of which is in the OXIDATIVE STRESS IS A CRUCIAL

* S. Garantziotis and S. Matalon contributed equally as senior authors. Address for reprint requests and other correspondence: S. Matalon, BMR II 224, 901 19th St. S., Birmingham, AL 35205-3703 (e-mail: [email protected]). http://www.ajplung.org

United States. Approximately 100,000 tankers filled with Cl2 travel on U.S. railways each year (14a). The accidental release of large amounts of Cl2 in 30 large cities worldwide during the last 20 years (49) and the deliberate release of Cl2 during acts of terrorism (37) caused significant mortality and morbidity to humans and animals (3, 10, 49, 64). Cl2 generated from the mixing of household products (bleach with acidic solutions) as well as swimming pool accidents results in bronchoconstriction especially in people with preexisting lung diseases (70, 74). Clinical observations suggest that even casual exposure to Cl2 exacerbates the clinical outcome of a number of pulmonary diseases including asthma and chronic obstructive pulmonary disease (14). There were about 9,000 calls for Cl2-related injuries to US poison control centers each year from 2000 to 2005 (5). For these reasons, facilities producing Cl2 are considered by the Department of Homeland Security to be at high risk with respect to a terrorist attack, with an estimated 17,500 deaths, 100,000 hospitalizations, and damages of millions of dollars if such an attack were to occur (30a). Cl2 is a highly reactive oxidant gas with a high solubility in water. When inhaled, Cl2 reacts with the epithelial lung lining fluid (ELF) to form hypochlorous acid (HOCl) and hydrochloric acid (HCl). HCl is rapidly neutralized by NaHCO3⫺, leading to the formation of NaCl, H2O, and CO2. However, HOCl is a highly active oxidant that reacts with proteins and structural molecules of the cell matrix such as hyaluronan (HA). HA, a component of the lung extracellular matrix, is a high-molecular-weight polymer (⬎1,000 kDa) composed of D-N-acetylglucosamine and D-glucuronic acids. Inhalation of oxidant gases, such as ozone, breaks high-molecular-weight HA to produce low-molecular-weight HA fragments (L-HA, 100 –300 kDa). These fragments initiate a series of proinflammatory events by binding to their main receptor (CD44), as well as to Toll-like receptor 4 (TLR4) of lung epithelial, inflammatory, and airway smooth muscle cells (ASMC) (22, 36). Binding of L-HA to CD44 is enhanced by inter-␣-trypsininhibitor (I␣I), a serum protein (8, 50) the bronchoalveolar lavage fluid (BALF) concentration of which increases considerably in inflammatory conditions (22, 43). Increased airway resistance and airway hyperresponsiveness (AHR) are important pathological events of oxidative lung injury in general and Cl2 toxicity in particular and result in persistent asthmalike symptoms and exacerbation of allergic

1040-0605/15 Copyright © 2015 the American Physiological Society

L891

L892

HYALURONAN AND Cl2 INJURY

airway inflammation (2, 51, 67), which may progress to lung fibrosis (54, 55). The transient receptor potential family A1 (TRPA1) channels, present in sensory airway neurons, play an important role in the development of AHR in response to low (⬍50 ppm) concentrations of Cl2 (6). However, the mechanisms responsible for Cl2-induced AHR (when inhaled at concentrations likely to be encountered near industrial accidents) have not been investigated adequately. Herein we tested the hypothesis that L-HA, generated by the action of Cl2, HOCl, and other secondary reactive intermediates on high-molecular-weight HA (H-HA), is necessary and sufficient for the development of AHR in mice exposed to sublethal concentrations of Cl2 (400 ppm for 30 min). In the first series of experiments, we showed that L-HA and I␣I BALF levels are increased after Cl2 exposure, and that therapeutic intratracheal administration of H-HA or an antibody against I␣I after Cl2 exposure diminishes the extent of AHR at 24 h postexposure. In the next series of experiments, we measured the mechanisms involved in the increase of AHR. Since membrane depolarization has been linked to increased airway contraction (33), we measured membrane potential (VM) as well as intracellular Ca2⫹ levels in human airway smooth muscle (HASM) cells after in vitro exposure to Cl2. Our results show that exposure of HASM cells to Cl2 leads to depolarization, increased intracellular Ca2⫹, and activation of RhoA. Similar effects are seen following exposure of HASM cells to L-HA, generated by exposing H-HA to Cl2. H-HA and the anti-I␣I antibody ameliorates Cl2 and L-HA effects on RhoA. A particular novel aspect of our studies is the demonstration that the Cl2-induced membrane depolarization was caused in part by the activation of TMEM16A, a Ca2⫹activated Cl⫺ channel present in HASM cells (17). MATERIALS AND METHODS

Animals. Eight-week-old C57BL/6 mice (20 –25 g body wt) were purchased from Charles River Laboratories (Wilmington, MA). All experimental procedures involving animals were approved by the University of Alabama at Birmingham (UAB) Institutional Animal Care and Use Committee (IACUC). Exposure to Cl2. Mice were exposed to Cl2 gas (400 ppm) for 30 min in a cylindrical glass chamber for 30 min as previously described (23, 78); control mice were exposed to air in the same experimental conditions as Cl2. The mice were then returned to room air and euthanized at 1, 6, or 24 h postexposure. H-HA and L-HA measurements in lungs. HA measurements in cell-free BALF were done by using a commercial ELISA kit (Echelon, San Jose, CA) as per manufacturer’s instructions (43, 47). To verify the presence of L-HA, concentrated and DNase/protease-pretreated BALF was run on 1% agarose (Lonza; Rockland, ME) gels, along with commercially available H-HA (Yabro; generous donation of IBSA Institut Biochimique; ⬃1,000 kDa), sonicated H-HA (Fisher Scientific with model CL-18 probe; amplitude 20%, duration 30 s followed by 1 min in ice; ⫻3), Cl2-exposed H-HA (1.5 mg/ml Yabro; 400 ppm Cl2 for 30 min), and HA ladders, as previously described (21, 22). In some cases, 0.5 ml of BALF from mice exposed to Cl2 and returned to room air for 24 h were treated with hyaluronidase (10 U/ml; Sigma Aldrich, St. Louis, MO) overnight at 37°C prior to agarose gel electrophoresis. Respiratory system mechanics. Mice were mechanically ventilated and challenged with increasing concentrations of methacholine as described previously (2, 23, 67). Briefly, air and Cl2-exposed mice were anesthetized with pentobarbital (50 mg/kg ip; Vortech Pharmaceuticals, Dearborn, MI), paralyzed with pancuronium (4 mg/kg ip;

Gensia Sicor Pharmaceuticals, Irvine, CA), intubated, connected to an FX-1 module of the flexiVent (SCIREQ, Montreal, PQ, Canada), and ventilated at a rate of 160 breaths per minute at a tidal volume of 0.2 ml with a positive end-expiratory pressure of 3 cmH2O. Total as well as Newtonian respiratory system resistance and elastance were recorded continuously as previously described (29). Baseline was set via deep inhalation. Increasing concentrations of methacholine chloride (0 – 40 mg/ml, Sigma-Aldrich) were administered via aerosolization within an administration time of 10 s. Airway responsiveness was recorded every 15 s for 3 min after each aerosol challenge. Broadband perturbation was used and impedance was analyzed via a constant phase model. Assessments of Newtonian vs. total respiratory resistances allow us to differentiate the contribution of the central vs. peripheral airways in the observed increase of total lung resistance. In some experiments, Yabro (aerosolized sodium hyaluronate; IBSA Institut Biochimique; a type of H-HA with molecular mass ⬃1,000 kDa) was administered in the external nares (50 ␮l each of 3 mg/ml) of anesthetized mice at 1 and 23 h post-Cl2 (400 ppm for 30 min) exposure. These experiments were repeated with Cl2 (400 ppm for 30 min)-exposed Yabro, stored at ⫺4°C for 24 h. Finally, in another group of animals, we instilled at the same times 50 ␮l of monoclonal mouse anti-human I␣I antibody (generously donated by Yow-Pin Lim, Brown University; 0.5 mg/ml), or an equivalent amount of mouse IgG (Sigma Aldrich). All mice were euthanized at 24 h postexposure. HASM cell culture. HASM cells were immortalized by Dr. Gerthoffer (24) and were cultured as described by Gallos et al. (19). In brief, cells were cultured in SmBM-2 media supplemented with 10% serum and antibiotics (1% penicillin and streptomycin; Atlanta Biologicals, Atlanta, GA). Subsequently, they were plated on T25 flasks and allowed to grow to confluence. Twenty-four hours prior to exposure, cells were lifted from the flasks using trypsin-EDTA (Atlanta Biologicals; Atlanta, GA) and then seeded in six-well plates coated with collagen (0.1 mg/ml; Sigma Aldrich) at 5 ⫻ 104 cells/cm2 and incubated overnight at 37°C in humidified atmosphere of 95% air 5% CO2. The next day, the culture medium was replaced with 2 ml of Lactated Ringer’s containing antioxidants (ascorbate, urate, and reduced glutathione in concentrations present in the rodent epithelial lining fluid) along with 25 mM HCO3⫺ (42), and exposed to Cl2 (100 ppm chlorine, for 10 min) in 5% CO2, and 95% air. The CO2/ bicarbonate buffer system neutralized HOCl and HCl generated by the hydrolysis of Cl2 and maintained pH at 7.4. Immediately post-Cl2 exposure, cells were lifted from the plates by use of collagenase (1 mg/ml; Sigma Aldrich), seeded onto coverslips in culture medium, and placed in a humidified incubator at 37°C vented with 95% air-5% CO2 for 1 h. Measurement of Vm. At 1 h postexposure, HASM cells seeded on coverslips were transferred to a recording chamber on the stage of an inverted microscope (Olympus IMT2) and perfused at a rate of 1 ml/min with a solution containing (in mM) 135 NaCl, 5.4 KCl, 1 MgCl2, 1.8 CaCl2, 5.5 glucose, 10 HEPES, pH 7.4 (following addition of 1 N NaOH) at room temperature. Vm was measured with a Molecular Devices amplifier (Sunnyvale, CA; Axopatch 200B) in fast current-clamp conditions. The procedure consists of establishing a stable gigaseal (10 –20 G⍀) between a glass pipette and the cell membrane, followed by rupture of the membrane patch under the pipette. Vm values were read on the digital display of the patch amplifier and simultaneously recorded and stored on a hard drive of a computer equipped with pClamp software (Molecular Devices) (44). The pipette resistance varied from 2 to 3 M⍀ when filled with a solution containing (in mM) 135 KCl, 10 NaCl, 2 MgCl2, 10 glucose, 0.1 EGTA, 0.2 Na2ATP, 10 HEPES, pH 7.2 (1 N KOH). The data was digitized with a Digidata 1322A low-noise digitizer (Molecular Devices) connected to a computer equipped with pClamp software (Molecular Devices). Inhibitors were added into the perfusion solution as described in RESULTS, with the exception of measurement to assess the involvement of RhoA. In this case, HASM cells were preincubated

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

HYALURONAN AND Cl2 INJURY

with a RhoA (Rho inhibitor I, 1 ␮g/ml; Cytoskeleton, Denver, CO) or ROCK inhibitor (Y-27632, 10 ␮M; Cytoskeleton) for 4 and 1 h, respectively, prior to being exposed to Cl2. During exposure, the medium was changed as described above without inhibitors. Measurements of TMEM16A Cl⫺ activity in HASM cells: current-voltage (I–V) relationships of Cl⫺ channels of air or Cl2-exposed HASM cells were recorded in the whole cell mode of the patch-clamp technique as described recently (79). During the experiments, cells were perfused at a rate of 1 ml/min with an external solution of the following ionic composition (in mM): 145 CsCl, 2 MgCl2, 2 CaCl2, 5.5 glucose, 10 HEPES, pH 7.4 (1 N CsOH). The pipette resistance used for whole cell recording ranged from 3 to 5 M⍀ when filled with the following solution (in mM): 135 CsCl, 10 KCl, 2 MgCl2, 0.1 EGTA, 5.5 glucose, 10 HEPES, pH 7.2 (1 N CsOH). All measurements were performed at room temperature. Cells were perfused continuously with the external solution until formation of a gigaseal between the pipette and cell surface. Following recordings of I–V relationships, inhibitors of TMEM16A [tannic acid, 100 ␮M; 5-nitro-2-(3-phenylpropylamino) benzoic acid (NPPB), 100 ␮M; niflumic acid, 100 ␮M] were added into the perfusing solution. In another set of experiments, cells were incubated with an anti-TMEM16A antibody (ab53213; Abcam, Cambridge, MA) at 1:5 dilution after Cl2 exposure until measurement of I–V relationships (about 1–2 h). RhoA activity and protein levels. Total RhoA and activated RhoA in HASM cells prior to and immediately following exposure (100 ppm Cl2 for 10 min) were measured by ELISA and G-LISA (Cytoskeleton), respectively, according to the manufacturer’s specifications. G-LISA values were divided by their corresponding ELISA values and results were expressed as fold increase compared with the air values. Human primary bronchial smooth muscle cells (Lonza) were cultured in Smooth Muscle Growth Medium (Lonza) and grown to 80 –90% confluence on 100-mm tissue culture dishes. Cells were switched to Smooth Muscle Basal Medium (Lonza) for 4 h prior to the RhoA activation. Cells were incubated without and with the addition of L-HA (0.25 mg/ml or 0.5 mg/ml), H-HA (0.25 mg/ml or 0.5 mg/ml), both L-HA (0.25 mg/ml) and H-HA (0.25 mg/ml), IgG (0.1 mg/ml) with and without L-HA (0.5 mg/ml), or anti-I␣I antibody (0.1 mg/ml, graciously donated by Yow-Pin Lim, Brown University) with or without L-HA (0.5 mg/ml) for 5 min. Cells were harvested on ice in G-LISA lysis buffer with protease inhibitors and snap frozen in liquid nitrogen until analyzed. Measurements of intracellular Ca2⫹ levels. HASM cells were plated on 25-cm coverslips in six-well plates, exposed to Cl2, and returned to 95% air-5% CO2 as described above. Changes in cytosolic Ca2⫹ levels were determined by using fura 2-acetoxymethyl ester (fura-2 AM; TEFLabs, Austin, TX) as described previously (17). In brief, cells were incubated with 8 ␮g dye/2 ml for 20 min in HBSS buffer (1.8 mM Ca2⫹, 25 mM HEPES, pH 7.4). The buffer was replaced with 2 ml fresh HBSS without fura-2 AM for an additional 20 min. Cells were then transferred to an Attofluor with 2 ml fresh HBSS. After establishment of baseline Ca2⫹ levels, thapsigargin (1 ␮M) or histamine (10 ␮M) was added to the buffer to activate store-operated Ca2⫹ entry. Data were acquired by using Nikon Elements software and a Nikon Ti80e microscope fitted with a ⫻40 oil immersion objective. Contractility of tracheal rings. C57BL/6 were exposed to Cl2 (400 ppm for 30 min) in environmental chambers and returned to room air. Twenty-four hours later, their tracheas were removed, stored in cold (4°C) cell culture medium (serum-free SmBM-2), packed in wet ice, and shipped to Dr. Emala (Columbia University) for study the following day. Connective tissue was removed and one-half of each trachea was mounted on a myograph bath (DMT, Ann Arbor, MI) and held at a resting tension of 5 mN as described previously (72). The bath buffer consisted of (in mM) 115 NaCl, 2.5 KCl, 1.91 CaCl2, 2.46 MgSO4, 1.38 NaH2PO4, 25 NaHCO3, and 5.56 D-glucose, pH 7.4, and was continuously bubbled with 95% O2-5% CO2 and maintained at 37°C. Following an equilibration period, increasing concentrations of

L893

acetylcholine (100 nM–1 mM) were added in the bath at 7-min intervals. Three cycles of acetylcholine dose-response curves were performed in each ring (with extensive buffer exchanges between cycles) to determine the acetylcholine EC50. In relaxation studies, tracheal rings were contracted to the determined approximate EC50, and force was allowed to plateau. Increasing concentrations of isoproterenol (0.1 nM–10 ␮M in ½ log increments) were added at 7-min intervals. Following copious amounts of washing with buffer and a return to baseline tension, tissues were exposed to 80 mM KCl to determine each ring’s maximal contractile response to this depolarizing stimulus (11, 18). Other tracheal rings were harvested from naive C57Bl/6J mice, exposed for 30 min to L-HA (0.15 mg/ml), and studied as above. In additional experiments, we obtained tracheal rings from mice lacking the CD44 receptor (CD44⫺/⫺; one of the main receptors of HA) and incubated the rings with L-HA (0.15 mg/ml) and then we exposed the rings in organ baths to increasing concentrations of methacholine (0.013 to 3.333 ␮M). HABP and ␣-SMA staining in chlorine gas or air exposed mouse lungs. Formalin-fixed, paraffin-embedded lung sections were deparaffinized in xylene followed by rehydration to TBST in graded ethanol. Endogenous peroxidases were blocked in 3% aqueous hydrogen peroxide, and then tissues were subjected to antigen retrieval in a pressure cooker (Biocare Medical, Concord, CA) in 1⫻ decloaking solution (Biocare). Tissues were incubated in blocking diluent (1% BSA, 10% normal donkey serum in TBST) followed by incubation with biotinylated hyaluronic acid binding protein (HABP) at 1:10 (Millipore, Billerica, MA) and rabbit anti-␣-smooth muscle actin (␣-SMA) (1:500; Abcam) for 1 h at room temperature. Secondary antibodies were Alexa Fluor 488 streptavidin 5-nm colloidal gold conjugate (1:50, for HABP) and Alexa Fluor donkey anti-rabbit-594 at 1:500 for ␣-SMA (Millipore). After a washing in PBS, coverslips were affixed with Prolong Gold antifade reagent and DAPI (Millipore) and fluorescence was assessed on an Olympus BX51 microscope (Melville, NY). Images were captured with a ProgRes CF scan digital camera (Jenoptic; Jena, Germany). Quantitative RT-PCR. RNA was isolated by using RNeasy (Qiagen, Valencia, CA) as per manufacturer’s protocol. RNA (200 ng) was converted into cDNA as per manufacturer’s protocol by using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Expression levels of HA synthase 1, 2, 3 and hyaluronidases 1, 2, 3 were quantified by SYBR Green (Applied Biosystems). Samples in triplicate were assayed on the Applied Biosystems StepOnePlus system and quantified for ⌬Ct by using the housekeeping gene 18s. Fold change was determined by using the average value of air-exposed lung samples as reference control. Primers used are as follows: 18s, forward primer CGG CTA CCA CAT CCA AGG AA, reverse primer GCT GGA ATT ACC GCG GCT; HAS1, forward primer GCCCTCCTCCTTCCTTCGT, reverse primer GTATAGCCACTCTCGGAAGTAAGATT; HAS2, forward primer TCATGGGTAACCAATGCAGTTTT, reverse primer TTTAGTTGCATAGCCCAGACTCAA; HAS3, forward primer CCTATGAATCAGTGGTCACAGGTTT, reverse primer TGCGGCCACGGTAGAAAA; hyal1, forward primer TGT GGC TAT AGT TTC CAG AGA CC, reverse primer TGAATTCAGTGTGTGCAGTTGGGT; hyal2, forward primer ACA TAC ACC CGA GGA CTC ACG G, reverse primer TGAATTCCTTGCACCAGAGGCCAG; hyal3, forward primer GCT CTC TTC CCT AGC ATC TAC C, reverse primer TCA GGG TTT AGG CTC CAG GCA G. Statistics. Data are presented as means ⫾ 1 SE; statistical analysis among means was performed with analysis of variance (ANOVA; one- or two-way) followed by the Tukey’s multigroup comparisons. Results were considered significant when P ⬍ 0.05. RESULTS

Detection of HA and I␣I in the BALF of Cl2-exposed mice. C57BL/6 mice were exposed to Cl2 (400 ppm for 30 min) and

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

L894

HYALURONAN AND Cl2 INJURY

returned to room air for up to 24 h. As shown in Fig. 1A, concentrations of HA and its binding partner I␣I in the BALF increased after exposure to Cl2. Agarose gel electrophoresis of Yabro (H-HA) showed the presence of a smear with a preponderance around 1,000 kDa (Fig. 1B); sonicated HA or HA exposed to Cl2 (Cl2-HA; 400 ppm for 30 min) had considerably lower molecular weights (⬍300 kDa), indicating that both processes fragmented H-HA, generating L-HA fragments (Fig. 1B). Agarose gel electrophoresis of concentrated BALF of Cl2 (400 ppm for 30 min)-exposed mice showed the presence of very low (⬍30 kDa) bands at 30 min postexposure (Fig. 1C); at 6 h postexposure, a continuous smear between 300 and 30 kDa was seen, the intensity of which increased at 24 h postexposure; no bands were observed if the 24-h BALF was treated with hyaluronidase, suggesting that L-HA was accounting for the observed staining (Fig. 1C). The increase in L-HA levels coincided with a significant increase in expression of HA synthases (HAS1, 3-fold at 6 and 24 h; HAS2 8-fold at 6 and 24 h; HAS3, 1.5-fold at 6 h, and 1.8-fold at 24 h) as well as hyaluronidases (hyal1, 11-fold at 6 h and 26-fold at 24 h; hyal2, 2-fold at 2 h and 5-fold at 24 h; hyal3, 3.5-fold at 6 h and 4.8-fold at 24 h). There was also an increase in HA staining in the peribronchial space (Fig. 1, D–F). These data show convincingly the presence of L-HA in the BALF of Cl2-exposed mice and that its concentration increases postexposure. AHR in Cl2-exposed mice was abrogated by instillation of H-HA or an antibody against I␣I. In agreement with our previous observations (2, 67), we detected a significant increase in total and Newtonian airway resistances and development of AHR to methacholine in mice exposed to Cl2 (400 ppm for 30 min) and returned to air for 24 h (Fig. 2, A–D). Intranasal instillation of either H-HA or a blocking antibody against I␣I at 1 and 23 h postexposure significantly abrogated AHR at 24 h postexposure (Fig. 2, A–D). Conversely, instilla-

tion of Cl2-exposed H-HA (Cl2-HA; which fragmented H-HA) but not H-HA into the external nares of air-breathing mice resulted in hyperresponsiveness to methacholine (Fig. 2E). These data indicate that L-HA contributes, at least in part, to Cl2 induced AHR. Exposure of HASM cells to Cl2 or L-HA results in resting membrane potential depolarization. As shown in Fig. 3A, control (air exposed cells) had a Vm of about ⫺60 mV; at 1 h post-Cl2 exposure, Vm was depolarized from ⫺60 to about ⫺35 mV. Incubation of HASM cells with BAPTA-AM (200 ␮M) for 1 h immediately postexposure, or perfusion with lanthanum (LaCl3; 10 ␮M; a general cation channel inhibitor; Fig. 3, A and B), starting at 1 h postexposure, returned membrane potentials to baseline values (Fig. 3, A and B). On the other hand, perfusion with nifedipine (10 ␮M; a blocker of L-type Ca2⫹ channels) had no effect on Vm (Fig. 3A). Finally, incubation of HASM cells with KB-R7943 (5 ␮M), a TRPC inhibitor (38), starting at 1 h postexposure, reversed to some extent the membrane depolarization (Fig. 3C). These data indicate that Ca2⫹ influx through TRPC channels may be responsible, at least in part, for the Cl2-induced membrane depolarization. Exposure of ASMC to Cl2 or L-HA activates RhoA, which contributes to membrane depolarization. Activation of RhoA contributes to the development of AHR and airway smooth muscle contractility, and inhibition of RhoA or Rho kinase ameliorates asthmatic AHR (9, 25, 39). We thus sought to determine whether chlorine gas exposure or L-HA could lead to RhoA activation in HASM. As shown in Fig. 4, A–C, exposure of HASM cells to L-HA or Cl2 activated RhoA and this was reversed by addition of H-HA or by pretreatment with an antibody against I␣I. We then tested whether activation of RhoA (as well as ROCK, its downstream kinase) contributed to membrane depolarization. Preincubation of HASM cells with a

Fig. 1. Detection of hyaluronan (HA) and inter-␣trypsin-inhibitor (I␣I) in the bronchoalveolar lavage fluid (BALF) of Cl2-exposed mice. A: mice were exposed to Cl2 (400 ppm for 30 min) and returned to air. HA was measured in the BALF by ELISA at the indicated times. I␣I was determined by competitive ELISA with a monoclonal antibody against human plasma-derived I␣I (MAb 69.26), as previously described (47). Values are means ⫾ 1 standard error of the mean (SE); number of mice (n) in each group ⫽ 5; *,#P ⬍ 0.01 compared with air and the value to its left at the same time point, respectively (ANOVA). B: agar gel electrophoresis of Yabro. Lane 1, HA Mega-HA Ladder (Hyalose); lane 2, Select-HA HiLadder; lane 3, Yabro; lane 4, Yabro exposed to Cl2 (400 ppm for 30 min) and stored at ⫺4°C for 24 h; lane 5, sonicated Yabro; lane 6, Select-HA LoLadder, C: agar gel electrophoresis of concentrated BALF from air and Cl2-exposed mice. Lane 1, Select-HA HiLadder; lane 2, Select-HA LoLadder; lane 3, 95% air-5% CO 2 (Air); Lanes 4 and 5, immediately postCl2; lane 6, 6 h post-Cl2, Lane 7, 24 h post-Cl2; lane 8, as in lane 7 but the BALF was treated with hyaluronidase, which degrades HA. In all cases, proteins were visualized with Stains-All (Sigma). D–F: representative image of mouse airways in naive state (D) or 6 h (E) and 24 h (F) after Cl2 exposure. Increased HA staining (green, arrows) at 24 h in the peribronchial area surrounding airway smooth muscle cells (ASMC; red). Magnification: ⫻200. AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

L895

HYALURONAN AND Cl2 INJURY

Fig. 2. Airway hyperresponsiveness in Cl2-exposed mice was reversed by instillation of high-molecular-weight hyaluronan (H-HA) or an antibody against I␣I. A–D: mice were exposed to Cl2 (400 ppm for 30 min) and returned to room air. Fifty microliters of Yabro (H-HA; 3 mg/ml; A and B) or a blocking antibody against I␣I (rabbit anti-human I␣I immunoglobulin; Dako, Glostrup, Denmark; 0.5 mg/ml; C and D) were administered in the external nares of lightly anesthetized mice at 0.5 and 23 h postexposure. All measurements were conducted at 24 h postexposure. Airway resistance (R; A and C) and Newtonian resistance (RN, which reflects the upper airway resistance; B and D) were measured by flexiVent prior to and following challenge with the indicated doses of aerosolized methacholine. Values are means ⫾ 1 SE; N ⱖ 6 (mice); *,#P ⬍ 0.05 compared with the corresponding air and Cl2 value in the same group (ANOVA and). E: airway resistance, measured 1 h post-intranasal instillation of either H-HA or Cl2-exposed H-HA. Values are means ⫾ 1 SE; n ⫽ 4 (mice); *,#P ⬍ 0.05 compared with the corresponding air or H-HA value in the same group (ANOVA and Tukey-Kramer multiple-comparisons test).

RhoA (Rho inhibitor I, 1 ␮g/ml) or a ROCK inhibitor (Y27632, 10 ␮M) reduced Cl2-induced membrane depolarization significantly (Fig. 4D). Perfusion of HASM cells with H-HA post-Cl2 exposure reversed the Cl2-induced membrane depo-

larization, to the same extent as inhibition of RhoA or ROCK (Fig. 4E). In addition, incubation of HASM cells with Cl2exposed H-HA (Cl2-HA; 1.5 ␮g/ml for 60 min) resulted in membrane depolarization of similar magnitude as following

Fig. 3. Exposure of human airway smooth muscle (HASM) cells to Cl2 or low-molecular-weight hyaluronan (L-HA) results in resting membrane potential depolarization. A and B: HASM cells were exposed to Cl2 (100 ppm for 10 min) as described in MATERIALS AND METHODS and placed in a humidified incubator in 95% air-5% CO2 for 60 min. Membrane potentials were measured at 1 h postexposure. Control (air-exposed cells) had a membrane potential (VM) of about ⫺60 mV; at 1 h post-Cl2 exposure, VM was depolarized from ⫺60 to about ⫺35 mV. Incubation of HASM cells with BAPTA-AM (200 ␮M) for 1 h immediately postexposure, or perfusion with lanthanum (LaCl2; 10 ␮M), a general cation channel inhibitor, starting at 1 h postexposure, returned membrane potentials to baseline values (A and B). On the other hand, perfusion with nifedipine (Nif.; 10 ␮M; a blocker of L-type Ca2⫹ channels) had no effect on VM (Fig. 3A). Values are means ⫾ SE; number of measurements as follows: air ⫽ 19; Cl2 ⫽ 8; BAPTA-AM ⫽ 8; La2⫹ ⫽ 8; Nif. ⫽ 20. *P ⬍ 0.05 compared with air (ANOVA and Tukey-Kramer multiple-comparisons test). C: as in A, except that Cl2-exposed HASM cells were incubated with KB-R7943, a TRPC inhibitor (inh.), starting shortly postexposure. Values are means ⫾ SE; n ⫽ 10 for each group. *,#P ⬍ 0.05 compared with air or Cl2 vehicle (Veh) (ANOVA and Tukey-Kramer multiple-comparisons test).

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

L896

HYALURONAN AND Cl2 INJURY

Fig. 4. Exposure of HASM cells to Cl2 activates RhoA, which contributes to membrane depolarization. A: HASM cells were exposed to Cl2 and returned to 95% air-5% CO2. Immediately upon return to room air RhoA activity and protein, levels were measured by G-LISA/ELISA as mentioned in METHODS. For each experiment active RhoA (measured by G-LISA) was divided by total RhoA for the same experiment measured by ELISA. Then the ratio of RhoA active to total RhoA for post-Cl2 was divided by the corresponding air control ratio for the same experiment (fold increase). Values are means ⫾ SE; n ⫽ 4; *P ⬍ 0.01; Student’s t-test. B and C: HASM cells were exposed to different concentrations of L-HA with either H-HA, IgG or anti-I␣I antibody for 5 min as described in the METHODS section, and RhoA activation was measured as above. Values are means ⫾ SD; n ⫽ 3– 4; *P ⬍ 0.01; Student’s t-test. D: HASM cells were exposed to Cl2 (100 ppm for 10 min) and placed in a humidified incubator in 95% air-5% CO2 for 60 min for 1 h. Preincubation of HASM cells with a RhoA (Rho inhibitor I, 1 ␮g/ml) or a ROCK inhibitor (Y-27632, 10 ␮M) significantly reduced Cl2-induced membrane depolarization. Perfusion of HASM cells with H-HA (Yabro; 3 mg/ml for 10 min post-Cl2 exposure) reversed the Cl2-induced membrane depolarization, to the same extent as inhibition of RhoA and ROCK. Values are means ⫾ SE; number of measurements as follows: air: n ⫽ 17; Cl2 ⫽ 20; RhoA inh. ⫽ 10; ROCK inh. ⫽ 10; H-HA ⫽ 23. *P ⬍ 0.05 compared with air (ANOVA and Tukey-Kramer multiple-comparisons test). E: incubation of 95% air-5% CO2-exposed HASM cells with Cl2-exposed H-HA (Cl2-HA; 1.5 ␮g/ml for 60 min), which fragments H-HA resulted in membrane depolarization of similar magnitude as following exposure to Cl2. Subsequent perfusion with H-HA (1.5 ␮g/ml for 10 min) reversed the depolarization. Values are means ⫾ SE; n ⫽ 16 for each group; *,#P ⬍ 0.05 compared with air or Cl2-HA perfused with vehicle. ANOVA and Tukey-Kramer multiple-comparisons test.

exposure to Cl2 (Fig. 4C). Subsequent perfusion with H-HA (1.5 ␮g/ml for 10 min) reversed the depolarization induced by Cl2-HA. Incubation with H-HA or anti-I␣I antibody also reversed the L-HA-induced RhoA activation (Fig. 4, B and C). These data suggest that L-HA, generated during Cl2 exposure, contributes to the observed cell membrane depolarization and that H-HA reverses Cl2-induced depolarization. Exposure of HASM cells to Cl2 or Cl2-HA increases intracellular Ca2⫹. Changes in HASM cell cytosolic Ca2⫹ prior to and at 1 h post-Cl2 exposures were determined by use of fura-2 AM. After establishment of baseline Ca2⫹ levels, intracellular Ca2⫹ was increased through direct stimulation of store-operated channels (SOC) using histamine (10 ␮M), which activates membrane Gq coupled receptors resulting in IP3-mediated endoplasmic reticulum (ER) Ca2⫹ depletion and SOC activation, or through indirect stimulation of SOC using thapsigargin (1 ␮M), which stimulates external Ca2⫹ influx by blocking sarco/endoplasmic reticulum calcium ATPase refilling of the ER. As shown in Fig. 5, A and B, there were significant increases of baseline as well as thapsigargin- and histamine-

induced Ca2⫹ levels at 1 h post-Cl2 exposure. Since we have shown that H-HA reversed the Cl2-induced membrane depolarization while Cl2-exposed H-HA (which is fragmented to L-HA) had the opposite effect, we evaluated the effects of these HA forms on cytosolic Ca2⫹. Figure 5C shows that post-Cl2 exposure perfusion of HASM cells with H-HA reversed the Cl2induced increase of cytosolic Ca2⫹. Conversely, incubation of air-exposed HASM cells with Cl2-HA (Fig. 5D) increased Ca2⫹ to the same extent as Cl2. These data show convincingly that exposure of HASM cells to Cl2 or Cl2-HA cause an influx of Ca2⫹ from the extracellular to the intracellular spaces. Exposure of HASM cells to Cl2 stimulates TMEM16A activity, which contributes to membrane depolarization. Previous work (17) demonstrated the presence of TMEM16A, a Ca2⫹activated Cl⫺ channel, in HASM cells. Activation of TMEM16A may result in membrane depolarization due to efflux of Cl⫺ ions. As shown in Fig. 6, when cells were patched in the whole cell mode by using CsCl2 in the pipette to suppress the activity of K⫹ channels, an inwardly rectified anion channel was observed that was inhibited following per-

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

HYALURONAN AND Cl2 INJURY

L897

Fig. 5. Exposure of HASM cells to Cl2 or Cl2-HA increases intracellular Ca2⫹. A: typical record of intracellular HASM cell Ca2⫹ changes following store-operated channel activation by thapsigargin (Tg; 1 ␮M) and/or exposure to Cl2 (100 ppm for 10 min). Exposure to Cl2 increases basal Ca2⫹ and exacerbates the effects of Tg (bottom row). Both effects are transient and Ca2⫹ levels return to baseline at 20 min postexposure. B: intracellular Ca2⫹ levels (as reflected by measurements of the ratio of 340/380 nm, which is the ratio of Ca2⫹-bound Fura dye to Ca2⫹-unbound dye) in HASM cells exposed to either 95% air-5% CO2 (Control), or Cl2 (100 ppm for 10 min followed by 1 h in 95% air-5% CO2), Tg (1 ␮M), or histamine (His.; 10 ␮M). Individual points and means ⫾ SE for each group are shown in the graph. Statistical significance among groups was assessed by ANOVA and Tukey-Kramer multiple-comparisons test. C: HASM cells were exposed to Cl2 and returned to 95% air-5% CO2. Perfusion with Yabro (3 mg/ml for 10 min) had no effect on basal Ca2⫹ levels, but reduced Ca2⫹ in Cl2-treated cells to baseline levels. Values are means ⫾ SE; n ⫽ 6. *,#P ⬍ 0.05 compared with air or 1 h post-Cl2 (ANOVA and Tukey-Kramer multiple-comparisons test). D: incubation of 95% air-5% CO2-exposed HASM cells with Cl2-exposed H-HA (Cl2-HA; 1.5 ␮g/ml for 60 min), which fragments H-HA, increased Ca2⫹ to the same extent as exposure to Cl2. Values are means ⫾ SE; n ⫽ 6. *P ⬍ 0.05 compared with vehicle (Student’s t-test).

fusion with tannic acid, an inhibitor of TMEM16A (Fig. 6, A and B), or when cells were preincubated with an antiTMEM16A antibody (Fig. 6C). Inward currents increased significantly at 1 h post-Cl2 exposure without affecting the reversal potential (Fig. 6, B and C). Furthermore, addition of tannic acid in the medium bathing ASMC post-Cl2 exposure reversed to some extent (but not completely) the Cl2-induced depolarization (Fig. 6D). These data indicate that activation of TMEM16A by an increase in intracellular Ca2⫹ contributes to the Cl2-induced membrane depolarization. Exposure of mice to Cl2 increases the contractility of tracheal rings. Mice were exposed to either air or 400 ppm Cl2 for 30 min; 24 h later, their tracheas were removed and mounted in a myograph bath, and various concentrations of acetylcholine (100 nM–1 mM) were added in the bath at 7-min intervals to determine the acetylcholine EC50 (Fig. 7A). As seen in Fig. 7B, tracheal rings from Cl2-exposed mice exhibited significantly higher tension when challenged with acetylcholine (a muscarinic receptor agonist) or KCl, which induces membrane depolarization and contraction primarily though plasma membrane channel opening and entry of extracellular Ca2⫹. The contractile force induced by acetylcholine was divided by the force induced by KCl depolarization and no significant difference was detected, suggesting that tracheal rings from Cl2-

exposed mice demonstrate nonspecific hypercontractility (data not shown). After demonstrating nonspecific enhanced contractility in tracheal rings from Cl2 gas-exposed mice, we questioned whether ␤2-agonist-mediated relaxation was different following Cl2 gas exposure. There was no difference in the potency of isoproterenol in relaxing an acetylcholine-established contraction in Cl2 gas-exposed vs. control mouse tracheal rings (Fig. 7C). This finding agrees with our previous data showing significant amelioration of Cl2-induced hyperresponsiveness to methacholine following administration of long-term ␤2-agonists (67). Interestingly, we show nearly identical results with naive tracheal rings that were then exposed to L-HA (Fig. 7D), suggesting that L-HA accounts for the observed Cl2-induced effect. In additional experiments, we obtained tracheal rings from mice lacking the CD44 receptor, one of the main receptors of HA, and incubated them with L-HA as above and then with methacholine (3.33 ␮M). As shown in Fig. 8, in contrast to tracheal rings from wild-type mice, which show a large increase in muscle tension when challenged with L-HA and methacholine, tracheal rings from CD44⫺/⫺ mice did not respond to L-HA with hyperresponsiveness to methacholine.

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

L898

HYALURONAN AND Cl2 INJURY

Fig. 6. Exposure of ASMC to Cl2 stimulates TMEM16A activity, which contributes to membrane depolarization. A: whole cell ion currents across human ASMC 1 h postexposure to 100 ppm Cl2 (10 min). Cells were perfused with a solution containing (in mM) 145 CsCl, 2 MgCl2, 2 CaCl2, 5.5 glucose, 10 HEPES, pH 7.4 (1 N CsOH). The pipette was filled with the following solution (in mM): 135 CsCl, 10 KCl, 2 MgCl2, 0.1 EGTA, 5.5 glucose, 10 HEPES, pH 7.2 (1 N CsOH). Inward and outward currents were measured while the membrane potential varied from ⫺100 to ⫹80 mV in steps of 20 mV for 500 mS from a holding potential of 0 mV. Measurements were then repeated after perfusion of the cells with tannic acid (100 ␮M) a TMEM16A inhibitor. B: current-voltage relationships for the measurements shown in A. Current (I) values for each voltage are means ⫾ SE; n ⫽ 7 each. Whole-cell tannic acid (TA)-sensitive currents at 1 h post-Cl2 exposure were significantly different from their corresponding air values for membrane potentials ⱖ40 mV. C: current-voltage relationships for HASM cell exposed to Cl2 and returned to 95% air 5% CO2 for 1 h. V, voltage. Immediately postexposure cells were incubated with an anti-TMEM16A antibody, prediluted ab53213 (Abcam) at 1:5 dilution prior to measuring I–V relationships. I values for each voltage are means ⫾ 1 SE; n ⫽ 9 –11 each. Whole-cell anti-TMEM16A sensitive currents at 1 h post-Cl2 exposure were significantly different from their corresponding air values for membrane potentials ⱖ 40 mV. D: measurements of membrane potentials in HASM cells exposed to Cl2 and returned to 95% air-5% CO2 and incubated with either tannic acid (TA) (100 ␮M) for 1 h. Values are means ⫾ 1 SE; n ⫽ 10 for each group. *,#P ⬍ 0.05 compared with air or Cl2 ⫹ Veh (ANOVA and Tukey-Kramer multiple-comparisons test). DISCUSSION

Oxidative airway injury occurs after a multitude of environmental exposures, such as infection, pollution, or accidental exposure to halogens. Cl2 is a very reactive gas and poses a significant threat to public health when released into the atmosphere in large quantities during transportation and industrial accidents as well as acts of terrorism. We have previously shown that AHR in response to another oxidative pollutant, ozone, is mediated through L-HA (21, 22). We now expand this concept to include Cl2 gas injury. Furthermore, we show that postexposure administration of H-HA or a blocking antibody against I␣I reduce Cl2-induced AHR via inhibition of RhoA activation and intracellular Ca2⫹ in HASM. There are of course significant differences between Cl2 and ozone gas toxicity, with respect to acute symptoms, airway penetration, and sequelae (70, 73). Nevertheless, both agents cause significant oxidative injury to airway epithelium and increase airway resistance and hyperresponsiveness to methacholine, which last for days postexposure (2, 15, 21, 23, 30, 60, 65, 67); furthermore, workers exposed to ozone or chlorine both report a significant increase in acute wheezing episodes (27). In both cases there is increased generation of reactive

intermediates, which lasts after the cessation of exposure. For example, we have previously shown the presence of reactive intermediates in lung epithelial cells exposed to Cl2 and returned to room air using electron spin resonance and redox sensitive dyes (42). Increased levels of reactive intermediates were also documented in the lungs of mice and rats exposed to Cl2 and returned to room air by measuring levels of isoprostanes (75) and products of lipid peroxidation (77). Postexposure administration of antioxidant decreased mortality (77) and decreased airway hypersensitivity (15). Ozone also generates a variety of reactive intermediates and lipid ozonation products (61, 62); both Cl2 and ozone lead to intense inflammatory response and migration of activated inflammatory cells into the lung vascular and alveolar spaces (23, 32) and subsequent generation of reactive intermediates, which may fracture H-HA. We hereby propose that both exposures, and similar severe oxidative injury, share the same mechanism of induction of AHR by perturbing HA homeostasis from predominantly H-HA to L-HA species. Increased concentrations of L-HA have been found in a number of lung diseases, such as asthma, chronic obstructive pulmonary disease, and pulmonary fibrosis. L-HA is both

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

HYALURONAN AND Cl2 INJURY

L899

Fig. 7. Exposure of mice to Cl2 increases the contractility of their tracheal rings. C57BL/6 were exposed to Cl2 (400 ppm for 30 – 45 min) in environmental chambers and returned to room air. Twenty-four hours later, tracheal rings were harvested and incubated in cold SmBM-2 cell culture media for 24 h and then mounted in a myograph and held at a resting tension of 5 mN (as described in METHODS). A: typical records of tracheas from tracheas of Cl2 and air-exposed mice. Notice the significantly higher tensions develop in the former in response to increasing concentrations of acetylcholine (ACh) (dose-response curves repeated 3 times in each tracheal ring). Isopr., isoproterenol. B: muscle force generated by tracheas of air and Cl2-exposed mice in response to acetylcholine (Acetyl.; 0.1 mM) and KCl (80 mM). Values are means ⫾ SE; n ⫽ 4 each; *P ⬍ 0.05 compared with the corresponding value in the air group. C: isoproterenol-induced relaxation of precontracted tracheal rings (precontracted by an EC50 concentration of acetylcholine). No difference was detected in ␤-agonist relaxation of tracheal rings harvested from air- vs. Cl2-exposed animals. Values are means ⫾ SE; n ⫽ 4 each. D: muscle force generated by tracheas exposed (30 min) to PBS or L-HA in response to methacholine (MCh; 0.1 mM) and KCl (100 mM). Values are means ⫾ SE; n ⫽ 7 each; *P ⬍ 0.01 compared with respective exposure in PBS-treated rings. The methacholine-generated force is significantly higher than KCl-generated force for both treatments (P ⬍ 0.05) (ANOVA and Tukey-Kramer multiple-comparisons test).

necessary and sufficient for the development of AHR after exposure to ozone (21, 22), ischemia-reperfusion (13), which also leads to oxidative stress, and various other forms of injury. L-HA increases vascular permeability by activating RhoA and ROCK (its downstream kinase), inducing cytoskeletal reorganization, and inhibiting cell-cell contacts (45). On the contrary, H-HA protects from lung injury in ozone exposure (21), bleomycin administration (35), smoke inhalation, and sepsis (31, 48) as well as Cl2-induced injury, as we show in this work. This allows us to generalize the concept of oxidative stressinduced AHR. We postulate that highly reactive oxidative species lead to oxidative breakdown of structural HA (directly and indirectly) and release of L-HA, which in sequence mediates the generation of AHR via activation of RhoA, increase of pMLC, and cytoplasmic Ca2⫹ release in ASMC (Fig. 9). Oxidative species and L-HA activate Ca2⫹ channels (such as TRPC) and increase Ca2⫹ influx from the extracellular milieu to the cytoplasm, facilitating the release of Ca2⫹ from intracellular stores (53). Increased intracellular Ca2⫹ depolarizes the plasma membrane in part by activation of the Ca2⫹activated chloride channel TMEM16A and activates RhoA (34), which plays a critical role in key physiological functions (4, 7, 12, 69); in ASMC, RhoA and its downstream kinase

(ROCK) enhance methacholine-induced contraction via retention of myosin light chain in a phosphorylated state, which favors contraction (40). RhoA and ROCK have also been implicated in the Ca2⫹-dependent sensitization of ASMC and the development of airway hyperreactivity (76), and Rho kinase inhibition ameliorates AHR in rodent asthma models (28, 59). Thus our work identifies L-HA as crucial upstream activator of RhoA and a natural and specific target for pharmacological treatment of oxidative gas-induced AHR. This effect is counterbalanced by H-HA, and, indeed, shifting the homeostatic balance toward H-HA by therapeutic application of this compound ameliorates AHR in oxidative injury like ozone and Cl2 gas. The preparation of H-HA (Yabro) used in this study has been shown to prevent exercise-induced bronchoconstriction in patients with asthma (58). Several studies indicate that the relevant factor for H-HA protection is their size and not the source from which H-HA is derived (31, 36, 48). H-HA may be reversing Cl2-induced AHR by a variety of mechanisms. First, H-HA may outcompete L-HA for binding in various receptors, including the CD44. Indeed, as shown by our data in Fig. 8, tracheal rings of CD44⫺/⫺ challenged with L-HA and metha-

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

L900

HYALURONAN AND Cl2 INJURY

choline develop a highly attenuated contraction compared with those of CD⫹/⫹ mice. However, as demonstrated previously, the protective effects of H-HA may be due to the binding and neutralization of tissue kallikreins, which are known to cause bronchoconstriction (16, 66). In contrast, L-HA did not inactivate kallikreins (16, 66). In aggregate, our findings from this and previous work support a concept of homeostatic balance of high-molecular-weight HA size in healthy airways, which is acutely perturbed in favor of L-HA species in oxidative injury. This postulate allows us to form predictions about the mechanism of AHR in other types of oxidative lung injury, such as bromine lung injury, which validate our proposed model (S. Matalon, unpublished data). Thus we have ascertained that our proposed pathomechanism holds true in at least three distinct models of oxidative AHR. The nature of reactive intermediates responsible for the fragmentation of HA is not completely understood. When inhaled, Cl2 hydrolyzes to form hypochlorous (HOCl) acid and its conjugate base (OCl⫺), which are extremely reactive but short lived. HOCl has been shown to fracture H-HA in vitro (26), and HOCl generated by the action of activated neutrophils may contribute to the formation of L-HA in vivo. In addition, other reactive intermediates, such as chlorinated fatty acids (56) and chloramines (1, 68) known to be generated in the bronchoalveolar lavage and plasma of Cl2-exposed rodents, may contribute to L-HA formation. Our data show clearly that exposure of H-HA to Cl2 gas fragments HA, leading to the formation of L-HA. Furthermore, L-HA was detected in the BALF of Cl2-exposed mice and its concentration increased postexposure. Similar results have been observed following ozone exposure (21), ischemia-reperfusion injury (13), and other forms of oxidative injury. However, because of their reactivity it is unlikely that inhaled Cl2 and HOCl or ozone is able to cause a sustained generation of L-HA. We found a striking upregulation in both HA synthases as well as hyaluronidase expression after Cl2 exposure, suggesting that HA turnover is substantially increased in this situation. It is also likely that sustained production of L-HA is achieved

Fig. 8. Tracheal rings from CD44⫺/⫺ mice are hyporeactive to L-HA and methacholine compared with those of wild-type mice. Tracheal rings from naive C57Bl/6 or CD44⫺/⫺ mice (C57Bl/6 background) were incubated with L-HA for 30 min and force generation was measured in response to methacholine. Comparison rings were maintained in Krebs’ solution and exposed to methacholine. C57Bl/6 tracheal rings demonstrate a significant increase in generated force after L-HA exposure, while CD44⫺/⫺ tracheal rings do not show a change. Values are means ⫾ SE; n ⫽ 5 each; *P ⬍ 0.01 compared with respective exposure in PBS-treated rings. #P ⬍ 0.05 compared with C57Bl/6 rings exposed to L-HA.

Fig. 9. Overall scheme of putative mechanisms contributing to Cl2-induced airway hyperreactivity.

through inflammatory cell influx, particularly of neutrophils, which when activated release MPO (myeloperoxidase), which catalyzes the conversion of hydrogen peroxide and chloride to HOCl. In vitro studies have shown that exposure of HA to HOCl or HOBr results in the formation of shorter fragments, which act as free radicals, thus potentiating the initial injury (63). Neutrophil depletion decreases the development of AHR in Cl2 injury (52). In ozone injury only MyD88⫺/⫺ mice, but not TLR4⫺/⫺ or TIRAP⫺/⫺ mice, have decreased influx of PMN in the lung, which is associated with decreased levels of L-HA (46). Furthermore, in a positive feedback loop L-HA in turn stimulates reactive oxygen species generation by PMNs (71) and may thus maintain the inflammatory and AHR response until apoptotic PMNs are removed and cellular inflammation is resolved. Supporting the central role of oxidatively induced L-HA in lung injury and AHR, antioxidant treatment either exogenously through N-acetylcysteine (57) or via upregulation of extracellular superoxide dismutase (20) decreases L-HA in injured airways and prevents inflammation. Finally, post-Cl2 exposure administration of antioxidants and desferal improved survival and decreased lung injury in Cl2-exposed mice and rats (15, 77). In conclusion, our work both identifies the mechanism of oxidative stress-induced AHR and also offers a potential treatment that is already available for human use. ACKNOWLEDGMENTS The authors thank Gloria Y. Son for editing the final version of the manuscript. GRANTS This study was supported by the CounterACT Program, National Institutes of Health Office of the Director (NIH OD), and the National Institute of Neurological Disorders and Stroke (NINDS), Grants 5U01ES015676-05, 5R21 ES024027 02, and 1R21ES025423 01. This work was also supported in part by

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

HYALURONAN AND Cl2 INJURY funding from the Division of Intramural Research, National Institute of Environmental Health Sciences, NIH. DISCLOSURES No conflicts of interest, financial or otherwise, are declared by the author(s). AUTHOR CONTRIBUTIONS A.L., J.R.C., C.W.E., S.G., and S.M. conception and design of research; A.L., J.R.C., Z.Y., S.K., S.F.D., S.A., C.W.E., V.P.S., C.S.T., S.G., and S.M. analyzed data; A.L., J.R.C., C.W.E., S.G., and S.M. interpreted results of experiments; A.L., J.R.C., Z.Y., S.K., C.W.E., S.G., and S.M. prepared figures; A.L., S.A., S.G., and S.M. drafted manuscript; A.L., J.R.C., S.A., C.W.E., S.G., and S.M. edited and revised manuscript; A.L., J.R.C., Z.Y., S.K., S.F.D., S.A., C.W.E., V.P.S., C.S.T., S.G., and S.M. approved final version of manuscript; J.R.C., Z.Y., S.K., S.F.D., S.A., C.W.E., V.P.S., C.S.T., and S.G. performed experiments. REFERENCES 1. Ahmad S, Ahmad A, Hendry-Hofer TB, Loader JE, Claycomb WC, Mozziconacci O, Schoneich C, Reisdorph N, Powell RL, Chandler JD, Day BJ, Veress LA, White CW. SERCA: a critical target in chlorine inhalation-induced cardiotoxicity. Am J Respir Cell Mol Biol. 2014 Sep 4. [Epub ahead of print]. 2. Balakrishna S, Song W, Achanta S, Doran SF, Liu B, Kaelberer MM, Yu Z, Sui A, Cheung M, Leishman E, Eidam HS, Ye G, Willette RN, Thorneloe KS, Bradshaw HB, Matalon S, Jordt SE. TRPV4 inhibition counteracts edema and inflammation and improves pulmonary function and oxygen saturation in chemically induced acute lung injury. Am J Physiol Lung Cell Mol Physiol 307: L158 –L172, 2014. 3. Balte PP, Clark KA, Mohr LC, Karmaus WJ, Van Sickle D, Svendsen ER. The immediate pulmonary disease pattern following exposure to high concentrations of chlorine gas. Pulm Med 2013: 325869, 2013. 4. Baumer Y, Spindler V, Werthmann RC, Bunemann M, Waschke J. Role of Rac 1 and cAMP in endothelial barrier stabilization and thrombininduced barrier breakdown. J Cell Physiol 220: 716 –726, 2009. 5. Becker M, Forrester M. Pattern of chlorine gas exposures reported to Texas poison control centers, 2000 through 2005. Tex Med 104: 52–57, 51, 2008. 6. Bessac BF, Jordt SE. Breathtaking TRP channels: TRPA1 and TRPV1 in airway chemosensation and reflex control. Physiology (Bethesda) 23: 360 –370, 2008. 7. Bir N, Lafargue M, Howard M, Goolaerts A, Roux J, Carles M, Cohen MJ, Iles KE, Fernandez JA, Griffin JH, Pittet JF. Cytoprotectiveselective activated protein C attenuates Pseudomonas aeruginosa-induced lung injury in mice. Am J Respir Cell Mol Biol 45: 632–641, 2011. 8. Bost F, Diarra-Mehrpour M, Martin JP. Inter-alpha-trypsin inhibitor proteoglycan family—a group of proteins binding and stabilizing the extracellular matrix. Eur J Biochem 252: 339 –346, 1998. 9. Chiba Y, Matsusue K, Misawa M. RhoA, a possible target for treatment of airway hyperresponsiveness in bronchial asthma. J Pharm Sci 114: 239 –247, 2010. 10. Clark KA, Chanda D, Balte P, Karmaus WJ, Cai B, Vena J, Lawson AB, Mohr LC, Gibson JJ, Svendsen ER. Respiratory symptoms and lung function 8 –10 months after community exposure to chlorine gas: a public health intervention and cross-sectional analysis. BMC Public Health 13: 945, 2013. 11. Danielsson J, Yim P, Rinderspacher A, Fu XW, Zhang Y, Landry DW, Emala CW. Chloride channel blockade relaxes airway smooth muscle and potentiates relaxation by beta-agonists. Am J Physiol Lung Cell Mol Physiol 307: L273–L282, 2014. 12. Dudek SM, Garcia JG. Cytoskeletal regulation of pulmonary vascular permeability. J Appl Physiol 91: 1487–1500, 2001. 13. Eldridge L, Moldobaeva A, Wagner EM. Increased hyaluronan fragmentation during pulmonary ischemia. Am J Physiol Lung Cell Mol Physiol 301: L782–L788, 2011. 14. Evans RB. Chlorine: state of the art. Lung 183: 151–167, 2005. 14a.Fahys J. Groups sue railroad over chlorine cargo. The Salt Lake Tribune, July 2, 2009. 15. Fanucchi MV, Bracher A, Doran SF, Squadrito GL, Fernandez S, Postlethwait EM, Bowen L, Matalon S. Post-exposure antioxidant treatment in rats decreases airway hyperplasia and hyperreactivity due to chlorine inhalation. Am J Respir Cell Mol Biol 46: 599 –606, 2012.

L901

16. Forteza R, Lieb T, Aoki T, Savani RC, Conner GE, Salathe M. Hyaluronan serves a novel role in airway mucosal host defense. FASEB J 15: 2179 –2186, 2001. 17. Gallos G, Remy KE, Danielsson J, Funayama H, Fu XW, Chang HY, Yim P, Xu D, Emala CW Sr. Functional expression of the TMEM16 family of calcium-activated chloride channels in airway smooth muscle. Am J Physiol Lung Cell Mol Physiol 305: L625–L634, 2013. 18. Gallos G, Townsend E, Yim P, Virag L, Zhang Y, Xu D, Bacchetta M, Emala CW. Airway epithelium is a predominant source of endogenous airway GABA and contributes to relaxation of airway smooth muscle tone. Am J Physiol Lung Cell Mol Physiol 304: L191–L197, 2013. 19. Gallos G, Yim P, Chang S, Zhang Y, Xu D, Cook JM, Gerthoffer WT, Emala CW Sr. Targeting the restricted ␣-subunit repertoire of airway smooth muscle GABAA receptors augments airway smooth muscle relaxation. Am J Physiol Lung Cell Mol Physiol 302: L248 –L256, 2012. 20. Gao F, Koenitzer JR, Tobolewski JM, Jiang D, Liang J, Noble PW, Oury TD. Extracellular superoxide dismutase inhibits inflammation by preventing oxidative fragmentation of hyaluronan. J Biol Chem 283: 6058 –6066, 2008. 21. Garantziotis S, Li Z, Potts EN, Kimata K, Zhuo L, Morgan DL, Savani RC, Noble PW, Foster WM, Schwartz DA, Hollingsworth JW. Hyaluronan mediates ozone-induced airway hyperresponsiveness in mice. J Biol Chem 284: 11309 –11317, 2009. 22. Garantziotis S, Li Z, Potts EN, Lindsey JY, Stober VP, Polosukhin VV, Blackwell TS, Schwartz DA, Foster WM, Hollingsworth JW. TLR4 is necessary for hyaluronan-mediated airway hyperresponsiveness after ozone inhalation. Am J Respir Crit Care Med 181: 666 –675, 2010. 23. Gessner MA, Doran SF, Yu Z, Dunaway CW, Matalon S, Steele C. Chlorine gas exposure increases susceptibility to invasive lung fungal infection. Am J Physiol Lung Cell Mol Physiol 304: L765–L773, 2013. 24. Gosens R, Stelmack GL, Dueck G, McNeill KD, Yamasaki A, Gerthoffer WT, Unruh H, Gounni AS, Zaagsma J, Halayko AJ. Role of caveolin-1 in p42/p44 MAP kinase activation and proliferation of human airway smooth muscle. Am J Physiol Lung Cell Mol Physiol 291: L523– L534, 2006. 25. Goto K, Chiba Y, Matsusue K, Hattori Y, Maitani Y, Sakai H, Kimura S, Misawa M. The proximal STAT6 and NF-kappaB sites are responsible for IL-13- and TNF-alpha-induced RhoA transcriptions in human bronchial smooth muscle cells. Pharmacol Res 61: 466 –472, 2010. 26. Hawkins CL, Davies MJ. Degradation of hyaluronic acid, poly- and monosaccharides, and model compounds by hypochlorite: evidence for radical intermediates and fragmentation. Free Radic Biol Med 24: 1396 – 1410, 1998. 27. Henneberger PK, Olin AC, Andersson E, Hagberg S, Toren K. The incidence of respiratory symptoms and diseases among pulp mill workers with peak exposures to ozone and other irritant gases. Chest 128: 3028 – 3037, 2005. 28. Henry PJ, Mann TS, Goldie RG. A rho kinase inhibitor, Y-27632 inhibits pulmonary eosinophilia, bronchoconstriction and airways hyperresponsiveness in allergic mice. Pulm Pharmacol Ther 18: 67–74, 2005. 29. Hewitt M, Creel A, Estell K, Davis IC, Schwiebert LM. Acute exercise decreases airway inflammation, but not responsiveness, in an allergic asthma model. Am J Respir Cell Mol Biol 40: 83–89, 2009. 30. Hollingsworth JW, Cook DN, Brass DM, Walker JK, Morgan DL, Foster WM, Schwartz DA. The role of Toll-like receptor 4 in environmental airway injury in mice. Am J Respir Crit Care Med 170: 126 –132, 2004. 30a.Howe D. Scenario 8: Chemical attack — chlorine tank explosion. In: Planning Scenarios: Executive Summaries. Washington, DC: Homeland Security Council, 2004. 31. Huang PM, Syrkina O, Yu L, Dedaj R, Zhao H, Shiedlin A, Liu YY, Garg H, Quinn DA, Hales CA. High MW hyaluronan inhibits smoke inhalation-induced lung injury and improves survival. Respirology 15: 1131–1139, 2010. 32. Hyde DM, Hubbard WC, Wong V, Wu R, Pinkerton K, Plopper CG. Ozone-induced acute tracheobronchial epithelial injury: relationship to granulocyte emigration in the lung. Am J Respir Cell Mol Biol 6: 481–497, 1992. 33. Janssen LJ. Airway smooth muscle as a target in asthma and the beneficial effects of bronchial thermoplasty. J Allergy (Cairo) 2012: 593784, 2012. 34. Janssen LJ. Airway smooth muscle electrophysiology in a state of flux? Am J Physiol Lung Cell Mol Physiol 302: L730 –L732, 2012.

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

L902

HYALURONAN AND Cl2 INJURY

35. Jiang D, Liang J, Fan J, Yu S, Chen S, Luo Y, Prestwich GD, Mascarenhas MM, Garg HG, Quinn DA, Homer RJ, Goldstein DR, Bucala R, Lee PJ, Medzhitov R, Noble PW. Regulation of lung injury and repair by Toll-like receptors and hyaluronan. Nat Med 11: 1173–1179, 2005. 36. Jiang D, Liang J, Noble PW. Regulation of non-infectious lung injury, inflammation, and repair by the extracellular matrix glycosaminoglycan hyaluronan. Anat Rec (Hoboken) 293: 982–985, 2010. 37. Jones R, Wills B, Kang C. Chlorine gas: an evolving hazardous material threat and unconventional weapon. West J Emerg Med 11: 151–156, 2010. 38. Kraft R. The Na⫹/Ca2⫹ exchange inhibitor KB-R7943 potently blocks TRPC channels. Biochem Biophys Res Commun 361: 230 –236, 2007. 39. Kudo M, Melton AC, Chen C, Engler MB, Huang KE, Ren X, Wang Y, Bernstein X, Li JT, Atabai K, Huang X, Sheppard D. IL-17A produced by alphabeta T cells drives airway hyper-responsiveness in mice and enhances mouse and human airway smooth muscle contraction. Nat Med 18: 547–554, 2012. 40. Kume H. RhoA/Rho-kinase as a therapeutic target in asthma. Curr Med Chem 15: 2876 –2885, 2008. 41. Lang JD, McArdle PJ, O’Reilly PJ, Matalon S. Oxidant-antioxidant balance in acute lung injury. Chest 122: 314S–320S, 2002. 42. Lazrak A, Chen L, Jurkuvenaite A, Doran SF, Liu G, Li Q, Lancaster JR Jr, Matalon S. Regulation of alveolar epithelial Na⫹ channels by ERK1/2 in chlorine-breathing mice. Am J Respir Cell Mol Biol 46: 342–354, 2012. 43. Lazrak A, Jurkuvenaite A, Ness EC, Zhang S, Woodworth BA, Muhlebach MS, Stober VP, Lim YP, Garantziotis S, Matalon S. Inter-alpha-inhibitor blocks epithelial sodium channel activation and decreases nasal potential differences in DeltaF508 mice. Am J Respir Cell Mol Biol 50: 953–962, 2014. 44. Lazrak A, Matalon S. cAMP-induced changes of apical membrane potentials of confluent H441 monolayers. Am J Physiol Lung Cell Mol Physiol 285: L443–L450, 2003. 45. Lennon FE, Singleton PA. Hyaluronan regulation of vascular integrity. Am J Cardiovasc Dis 1: 200 –213, 2011. 46. Li Z, Potts-Kant EN, Garantziotis S, Foster WM, Hollingsworth JW. Hyaluronan signaling during ozone-induced lung injury requires TLR4, MyD88, and TIRAP. PLoS One 6: e27137, 2011. 47. Lim YP, Bendelja K, Opal SM, Siryaporn E, Hixson DC, Palardy JE. Correlation between mortality and the levels of inter-alpha inhibitors in the plasma of patients with severe sepsis. J Infect Dis 188: 919 –926, 2003. 48. Liu YY, Lee CH, Dedaj R, Zhao H, Mrabat H, Sheidlin A, Syrkina O, Huang PM, Garg HG, Hales CA, Quinn DA. High-molecular-weight hyaluronan—a possible new treatment for sepsis-induced lung injury: a preclinical study in mechanically ventilated rats. Crit Care 12: R102, 2008. 49. Mackie E, Svendsen E, Grant S, Michels JE, Richardson WH. Management of chlorine gas-related injuries from the Graniteville, South Carolina, train derailment. Disaster Med Public Health Prep 8: 411–416, 2014. 50. Malki N, Balduyck M, Maes P, Capon C, Mizon C, Han KK, Tartar A, Fournet B, Mizon J. The heavy chains of human plasma inter-alphatrypsin inhibitor: their isolation, their identification by electrophoresis and partial sequencing. Differential reactivity with concanavalin A. Biol Chem Hoppe Seyler 373: 1009 –1018, 1992. 51. Martin JG, Campbell HR, Iijima H, Gautrin D, Malo JL, Eidelman DH, Hamid Q, Maghni K. Chlorine-induced injury to the airways in mice. Am J Respir Crit Care Med 168: 568 –574, 2003. 52. McGovern TK, Goldberger M, Allard B, Farahnak S, Hamamoto Y, O’Sullivan M, Hirota N, Martel G, Rousseau S, Martin JG. Neutrophils mediate airway hyperresponsiveness following chlorine-induced airway injury in the mouse. Am J Respir Cell Mol Biol. 2014 Sep 5. [Epub ahead of print]. 53. Miller BA. The role of TRP channels in oxidative stress-induced cell death. J Membr Biol 209: 31–41, 2006. 54. Mo Y, Chen J, Humphrey DM Jr, Fodah RA, Warawa JM, Hoyle GW. Abnormal epithelial structure and chronic lung inflammation after repair of chlorine-induced airway injury. Am J Physiol Lung Cell Mol Physiol 308: L168 –L178, 2015. 55. Mo Y, Chen J, Schlueter CF, Hoyle GW. Differential susceptibility of inbred mouse strains to chlorine-induced airway fibrosis. Am J Physiol Lung Cell Mol Physiol 304: L92–L102, 2013. 56. Oh MW, Honavar J, Doran S, Benavides G, Darley-Usmar V, Matalon S, Ford DA, Patel RP. Chlorinated fatty acids are biomarkers and

57.

58.

59.

60.

61. 62.

63. 64.

65.

66.

67.

68.

69. 70.

71.

72.

73.

74.

75.

potential mediators of chlorine gas toxicity. Free Radic Biol Med 76, Suppl 1: S165–S166, 2014. Osterholt HC, Dannevig I, Wyckoff MH, Liao J, Akgul Y, Ramgopal M, Mija DS, Cheong N, Longoria C, Mahendroo M, Nakstad B, Saugstad OD, Savani RC. Antioxidant protects against increases in low molecular weight hyaluronan and inflammation in asphyxiated newborn pigs resuscitated with 100% oxygen. PLoS One 7: e38839, 2012. Petrigni G, Allegra L. Aerosolised hyaluronic acid prevents exercise-induced bronchoconstriction, suggesting novel hypotheses on the correction of matrix defects in asthma. Pulm Pharmacol Ther 19: 166–171, 2006. Possa SS, Charafeddine HT, Righetti RF, da Silva PA, Almeida-Reis R, Saraiva-Romanholo BM, Perini A, Prado CM, Leick-Maldonado EA, Martins MA, Tiberio IF. Rho-kinase inhibition attenuates airway responsiveness, inflammation, matrix remodeling, and oxidative stress activation induced by chronic inflammation. Am J Physiol Lung Cell Mol Physiol 303: L939 –L952, 2012. Postlethwait EM, Joad JP, Hyde DM, Schelegle ES, Bric JM, Weir AJ, Putney LF, Wong VJ, Velsor LW, Plopper CG. Three-dimensional mapping of ozone-induced acute cytotoxicity in tracheobronchial airways of isolated perfused rat lung. Am J Respir Cell Mol Biol 22: 191–199, 2000. Pryor WA. Mechanisms of radical formation from reactions of ozone with target molecules in the lung. Free Radic Biol Med 17: 451–465, 1994. Pryor WA, Houk KN, Foote CS, Fukuto JM, Ignarro LJ, Squadrito GL, Davies KJ. Free radical biology and medicine: it’s a gas, man! Am J Physiol Regul Integr Comp Physiol 291: R491–R511, 2006. Rees MD, McNiven TN, Davies MJ. Degradation of extracellular matrix and its components by hypobromous acid. Biochem J 401: 587–596, 2007. Runkle JR, Zhang H, Karmaus W, Brock-Martin A, Svendsen ER. Long-term impact of environmental public health disaster on health system performance: experiences from the Graniteville, South Carolina chlorine spill. South Med J 106: 74 –81, 2013. Samal AA, Honavar J, Brandon A, Bradley KM, Doran S, Liu Y, Dunaway C, Steele C, Postlethwait EM, Squadrito GL, Fanucchi MV, Matalon S, Patel RP. Administration of nitrite after chlorine gas exposure prevents lung injury: effect of administration modality. Free Radic Biol Med 53: 1431–1439, 2012. Scuri M, Forteza R, Lauredo I, Sabater JR, Botvinnikova Y, Allegra L, Abraham WM. Inhaled porcine pancreatic elastase causes bronchoconstriction via a bradykinin-mediated mechanism. J Appl Physiol 89: 1397–1402, 2000. Song W, Wei S, Liu G, Yu Z, Estell K, Yadav AK, Schwiebert LM, Matalon S. Postexposure administration of a ␤2-agonist decreases chlorine-induced airway hyperreactivity in mice. Am J Respir Cell Mol Biol 45: 88 –94, 2011. Song W, Wei S, Zhou Y, Lazrak A, Liu G, Londino JD, Squadrito GL, Matalon S. Inhibition of lung fluid clearance and epithelial Na⫹ channels by chlorine, hypochlorous acid, and chloramines. J Biol Chem 285: 9716 –9728, 2010. Spindler V, Schlegel N, Waschke J. Role of GTPases in control of microvascular permeability. Cardiovasc Res 87: 243–253, 2010. Squadrito GL, Postlethwait EM, Matalon S. Elucidating mechanisms of chlorine toxicity: reaction kinetics, thermodynamics, and physiological implications. Am J Physiol Lung Cell Mol Physiol 299: L289 –L300, 2010. Todd JL, Wang X, Sugimoto S, Kennedy VE, Zhang HL, Pavlisko EN, Kelly FL, Huang H, Kreisel D, Palmer SM, Gelman AE. Hyaluronan contributes to bronchiolitis obliterans syndrome and stimulates lung allograft rejection through activation of innate immunity. Am J Respir Crit Care Med 189: 556 –566, 2014. Townsend EA, Emala CW Sr. Quercetin acutely relaxes airway smooth muscle and potentiates ␤-agonist-induced relaxation via dual phosphodiesterase inhibition of PLC␤ and PDE4. Am J Physiol Lung Cell Mol Physiol 305: L396 –L403, 2013. White CW, Martin JG. Chlorine gas inhalation: human clinical evidence of toxicity and experience in animal models. Proc Am Thorac Soc 7: 257–263, 2010. Yadav AK, Bracher A, Doran SF, Leustik M, Squadrito GL, Postlethwait EM, Matalon S. Mechanisms and modification of chlorine-induced lung injury in animals. Proc Am Thorac Soc 7: 278 –283, 2010. Yadav AK, Doran SF, Samal AA, Sharma R, Vedagiri K, Postlethwait EM, Squadrito GL, Fanucchi MV, Roberts LJ, Patel RP, Matalon S. Mitigation of chlorine gas lung injury in rats by postexposure administration of sodium nitrite. Am J Physiol Lung Cell Mol Physiol 300: L362– L369, 2011.

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

HYALURONAN AND Cl2 INJURY 76. Yoshii A, Iizuka K, Dobashi K, Horie T, Harada T, Nakazawa T, Mori M. Relaxation of contracted rabbit tracheal and human bronchial smooth muscle by Y-27632 through inhibition of Ca2⫹ sensitization. Am J Respir Cell Mol Biol 20: 1190 –1200, 1999. 77. Zarogiannis SG, Jurkuvenaite A, Fernandez S, Doran SF, Yadav AK, Squadrito GL, Postlethwait EM, Bowen L, Matalon S. Ascorbate and deferoxamine administration after chlorine exposure decrease mortality and lung injury in mice. Am J Respir Cell Mol Biol 45: 386 –392, 2011.

L903

78. Zarogiannis SG, Noah JW, Jurkuvenaite A, Steele C, Matalon S, Noah DL. Comparison of ribavirin and oseltamivir in reducing mortality and lung injury in mice infected with mouse adapted A/California/04/2009 (H1N1). Life Sci 90: 440 –445, 2012. 79. Zhang S, Skinner D, Hicks SB, Bevensee MO, Sorscher EJ, Lazrak A, Matalon S, McNicholas CM, Woodworth BA. Sinupret activates CFTR and TMEM16A-dependent transepithelial chloride transport and improves indicators of mucociliary clearance. PLoS One 9: e104090, 2014.

AJP-Lung Cell Mol Physiol • doi:10.1152/ajplung.00377.2014 • www.ajplung.org

Copyright of American Journal of Physiology: Lung Cellular & Molecular Physiology is the property of American Physiological Society and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.