Yeast Yeast 2015; 32: 567–581. Published online 14 July 2015 in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/yea.3080

Research Article

iAID: an improved auxin-inducible degron system for the construction of a ‘tight’ conditional mutant in the budding yeast Saccharomyces cerevisiae Seiji Tanaka1,3*, Mayumi Miyazawa-Onami1, Tetsushi Iida2,3 and Hiroyuki Araki1,3 1

Division of Microbial Genetics, National Institute of Genetics, Mishima, Shizuoka, Japan Division of Cytogenetics, National Institute of Genetics, Mishima, Shizuoka, Japan 3 Department of Genetics, School of Life Science, Graduate University for Advanced Studies (SOKENDAI), Mishima, Shizuoka, Japan 2

*Correspondence to: S. Tanaka, Division of Microbial Genetics, National Institute of Genetics, Mishima, Shizuoka 411-8540, Japan. E-mail: [email protected]

Received: 10 April 2015 Accepted: 5 June 2015

Abstract Isolation of a ‘tight’ conditional mutant of a gene of interest is an effective way of studying the functions of essential genes. Strategies that use ubiquitin-mediated protein degradation to eliminate the product of a gene of interest, such as heat-inducible degron (td) and auxin-inducible degron (AID), are powerful methods for constructing conditional mutants. However, these methods do not work with some genes. Here, we describe an improved AID system (iAID) for isolating tight conditional mutants in the budding yeast Saccharomyces cerevisiae. In this method, transcriptional repression by the ‘Tet-OFF’ promoter is combined with proteolytic elimination of the target protein by the AID system. To provide examples, we describe the construction of tight mutants of the replication factors Dpb11 and Mcm10, dpb11-iAID, and mcm10-iAID. Because Dpb11 and Mcm10 are required for the initiation of DNA replication, their tight mutants are unable to enter S phase. This is the case for dpb11-iAID and mcm10-iAID cells after the addition of tetracycline and auxin. Both the ‘Tet-OFF’ promoter and the AID system have been shown to work in model eukaryotes other than budding yeast. Therefore, the iAID system is not only useful in budding yeast, but also can be applied to other model systems to isolate tight conditional mutants. Copyright © 2015 John Wiley & Sons, Ltd. Keywords: auxin-inducible degron; Mcm10; Dpb11; S. cerevisiae; conditional mutant

Introduction Gene knockout is an effective strategy for analysing the functions of a gene of interest and the biological process influenced by that gene. However, a gene knockout strategy cannot be applied simply to genes essential for growth. Conditional mutants of a gene, such as temperature-sensitive (ts) mutants, are effective tools in the analysis of essential genes. However, such mutants frequently show leakiness or hypomorphic phenotypes of the gene. Such leakiness is probably caused by the residual activity of the gene product, even in the restrictive conditions. A ‘tight’ ts mutant that shows almost no leakiness might overcome such problems because it loses its activity almost completely upon a shift of Copyright © 2015 John Wiley & Sons, Ltd.

temperature. Although a tight ts mutant would be useful for analysing the function of an essential gene, it is laborious to isolate tight ts mutants, even in unicellular model eukaryotes such as yeast. Another way to construct a conditional mutant is ‘promoter shut-off’. Construction of the promoter shut-off mutant is rather simple – replace its own promoter with other regulatable promoter(s). The Tet-OFF promoter is an often-used solution for the construction of ‘promoter shut-off’ in the budding yeast Saccharomyces cerevisiae. The rationale of the Tet-OFF system is as follows. The Tet-OFF system comprises three parts: a tandem array of Tet operators (TetOn); a transcriptional activator, in which the Tet repressor is fused with a VP16 transactivator (tTA); and a transcriptional repressor,

S. Tanaka et al.

568

in which the reverse Tet repressor is fused with a transcriptional repressor, Ssn6 (TetR′–Ssn6) (Belli et al., 1998). When doxycycline, a tetracycline analogue, is absent, tTA associates with the TetOn to activate transcription. Once doxycycline is added to the medium, tTA dissociates from TetOn. At the same time, TetR′–Ssn6 associates with the TetOn because of the ‘reverse’ nature of TetR′. Because Ssn6 is a component of the general repressor of transcription in S. cerevisiae, addition of doxycycline converts the active Tet promoter into a silenced promoter (for more detail, see Belli et al., 1998). However, promoter shut-off mutants sometimes show leakiness. For example, in a study that constructed Tet-OFF strains for 602 essential genes of S. cerevisiae, only 24% of the strains showed very severe growth defects in the presence of doxycycline (Mnaimneh et al., 2004). In such cases, leakiness might be caused by very stable gene products or mRNA, or by continuing transcription that has escaped from the repression of transcription. To overcome these problems, the ‘temperatureinducible degron’ (td) method was developed (Dohmen et al., 1994). In this method, a conditional mutant is constructed by combining the regulated proteolytic elimination of a protein product of the gene of interest and a transcriptional shutoff. In the td system, the td cassette, which comprises a ubiquitin moiety and a ts derivative of DHFR, is fused to the NH2-terminal of the protein of interest and induces the proteolysis of the target protein at 37°C via the N-end rule pathway. The td cassette is under the control of the copperinducible CUP1 promoter for the transcriptional regulation of the target gene (Dohmen et al., 1994). It has been shown that this system works very well with some genes, although the original td system is not sufficient for isolating the tight mutant of some genes. Therefore, further improvements in the method have been reported for isolating td mutants of such genes. For example, overexpression of Ubr1, an E3 enzyme in ubiquitination through the N-end rule pathway, improved the tightness of td mutants of Mcm2-7 (Labib et al., 2001), and the use of the ‘Tet-OFF’ promoter rather than the CUP1 promoter helped to isolate the tight mutant of Cdt1 (Tanaka and Diffley, 2002). As another new way for the proteolytic elimination of the target protein, the auxin-inducible Copyright © 2015 John Wiley & Sons, Ltd.

degron (AID) method has been developed (Nishimura et al., 2009). This system uses the plant hormone auxin and its in vivo binding target, IAA17, and its adaptor for E3 ubiquitin ligase, TIR1. Ectopically expressed Tir1 protein allows cells to rapidly degrade IAA17-fused target protein upon the addition of auxin in yeasts and vertebrate cells. However, we have noticed that the AID system cannot generate tight mutants for some genes, such as DPB11 and MCM10, in the budding yeast S. cerevisiae. Because both Dpb11 and Mcm10 have essential functions in the initiation of DNA replication (Araki et al., 1995; Tanaka et al., 2013; van Deursen et al., 2012; Watase et al., 2012), their tight mutants are unable to enter S phase. Using DPB11 and MCM10 as models, we tried to improve the AID system. To do this, we combined it with the tight transcriptional regulation in S. cerevisiae, and we found that the addition of the Tet-OFF promoter to the AID system improved the tightness of the AID mutants. We call this Tet-OFF-AID system the ‘improved auxininducible degron’ (iAID). Because the Tet-OFF system is functional in a wide variety of eukaryotes, we believe this new iAID method would have wide applicability in eukaryotes.

Materials and methods Yeast strains and media All S. cerevisiae strains were from a W303 background and are listed in Table 1. The cells were grown in the rich medium YPA (1% yeast extract, 2% Bacto peptone and 40 μg/ml adenine) supplemented with 2% sugar (glucose, galactose or raffinose). When cells were arrested in G1, 40 ng/ml α-factor was added to the medium with Δbar1 strains. All strains used in this analysis are available from NBRP yeast (http://yeast.lab.nig. ac.jp/nig/index_en.html).

Plasmids and oligonucleotides Nucleotide sequences and maps of plasmids (pST1760, pST1868, pST1872, pST1873, pST1932 and pST1933) are included in the online supporting information. Each part of the plasmids was obtained as follows. The TDH3 promoter and terminator were isolated from the yeast genome. Hph and nat1 genes Yeast 2015; 32: 567–581. DOI: 10.1002/yea

Improved auxin-inducible degron in S. cerevisiae

569

Table 1. Yeast strains Name

Genotype

Reference

W303-1a Δbar1MATa ade2-1 ura3-1 his3-11,15 trp1-1 leu2-3,112 can1-100 Δbar1 Our stock YST1353 W303-1a Δbar1 ura3-1::ADH1p-OsTIR1-9Myc (URA3) This study YST1392 W303-1a Δbar1 ura3-1::ADH1p-OsTIR1-9Myc (URA3) dpb11-AID::kanMX This study YST1394 W303-1a Δbar1 ura3-1::ADH1p-OsTIR1-9Myc (URA3) mcm4-AID::kanMX This study YST1402 W303-1a Δbar1 ura3-1::ADH1p-OsTIR1-9Myc (URA3) cdc45-AID::kanMX This study YST1406 W303-1a Δbar1 ura3-1::ADH1p-OsTIR1-9Myc (URA3) mcm10-AID::kanMX This study YST2199 W303-1a Δbar1 SSN6::pST1760 (YML119Wp-tTA (TetR-VP16) YML120Cp-TetR′-SSN6, TDH3p-OsTIR1, HIS3) This study YST2363 W303-1a Δbar1 leu2-3,112::pST1868 (YBR188Cp-tTA (TetR-VP16) YBR189Wp-TetR′-SSN6, TDH3p-OsTIR1, LEU2)This study YST2384 W303-1a Δbar1 SSN6::pST1760 mcm10-iAID (N) This study YST2392 W303-1a Δbar1 SSN6::pST1760 TetO2-MCM10 This study YST2393 W303-1a Δbar1 SSN6::pST1760 dpb2-iAID (C) This study YST2395 W303-1a Δbar1 SSN6::pST1760 pol1-iAID (C) This study YST2396 W303-1a Δbar1 SSN6::pST1760 pri1-iAID (C) This study YST2397 W303-1a Δbar1 SSN6::pST1760 pol3-iAID (C) This study YST2408 W303-1a Δbar1 leu2-3,112::pST1868 mcm10-iAID (N) This study YST2458 W303-1a Δbar1 SSN6::pST1760 orc1-iAID (C) This study YST2571 W303-1a Δbar1 SSN6::pST1760 dpb11-iAID (C) This study YST2572 W303-1a Δbar1 leu2-3,112::pST1868 dpb11-iAID (C) This study YST2573 W303-1a Δbar1 SSN6::pST1760 dpb11-iAID (N) This study YST2574 W303-1a Δbar1 leu2-3,112::pST1868 dpb11-iAID (N) This study YST2575 W303-1a Δbar1 SSN6::pST1760 mcm10-iAID (C) This study YST2576 W303-1a Δbar1 leu2-3,112::pST1868 mcm10-iAID (C) This study YST2577 W303-1a Δbar1 SSN6::pST1760 mcm10-iAID (C)-5xFLAG This study YST2578 W303-1a Δbar1 leu2-3,112::pST1868 mcm10-iAID (C)-5xFLAG This study YST2630 W303-1a Δbar1 SSN6::pST1760 pol12-iAID (C) This study YST2705 W303-1a Δbar1 SSN6::pST1760 mcm10-3xmini-AID This study YST2706 W303-1a Δbar1 SSN6::pST1760 dpb11-3xmini-AID This study YST2708 W303-1a Δbar1 ura3-1::ADH1p-OsTIR1-9Myc (URA3) CUP1p-AID-DPB11::kanMX This study This study YST2791 W303-1a Δbar1 SSN6::pST1760 TetO2-DPB11 YST2794 W303-1a Δbar1 ura3-1::ADH1p-OsTIR1-9Myc (URA3) CUP1p-AID-MCM10::kanMX This study YST2795 W303-1a Δbar1 SSN6::pST1760 dpb2-3xmini-AID This study YST2796 W303-1a Δbar1 SSN6::pST1760 orc1-3xmini-AID This study YST2797 W303-1a Δbar1 SSN6::pST1760 pol1-3xmini-AID This study YST2799 W303-1a Δbar1 SSN6::pST1760 pol3-3xmini-AID This study YST2800 W303-1a Δbar1 SSN6::pST1760 pol12-3xmini-AID This study YST2801 W303-1a Δbar1 SSN6::pST1760 pri1-3xmini-AID This study

were isolated from pAG26 and pAG35 (Goldstein and McCusker, 1999). The Tet promoter unit (ADH1 terminator-2× Tet operators–CYC1 TATA) was isolated from pCM244 (Belli et al., 1998). The 3× mini-AID was either isolated from pMK151 (Kubota et al., 2013) or synthesized. The 5× FLAG tag was synthesized. The TEF promoterregulated kanMX cassette was isolated from pUG6 (Guldener et al., 1996). Bidirectional promoters on pST1760 and pST1868 were isolated from the yeast genome. tTA and TetR′–SSN6 were isolated from pCM244 and pCM224 (Belli et al., 1998), respectively. OsTIR1 was isolated from pYK6 (Kubota et al., 2013). All plasmids used in this analysis are Copyright © 2015 John Wiley & Sons, Ltd.

available from NBRP yeast (http://yeast.lab.nig.ac. jp/nig/index_en.html). The sequences of oligonucleotides used for the amplification of the iAID cassettes are shown in Table 2. Table 2. Oligonucleotides Name iAID iAID iAID iAID iAID

N1 N2 N3 C1 (= pFA6a F2) C2 (= pFA6a R1)

Sequence (5′ → 3′) ACAAGAACAATGCAATAGCGC GGAACCTCCTCTAGGTACAAGATC CGAATTGATCCGGTAATTTAGTG CGGATCCCCGGGTTAATTAA GAATTCGAGCTCGTTTAAAC

Yeast 2015; 32: 567–581. DOI: 10.1002/yea

570

Flow cytometry Flow cytometry was performed as described elsewhere (Tanaka and Diffley, 2002).

Antibodies Antibodies against Cdc45, Mcm4, Mcm10, Dpb11 and Orc6 are described elsewhere (Tanaka et al., 2011). FLAG and Myc tags were detected with the monoclonal antibodies M2 (F3105; Sigma-Aldrich) and 9E10 (our laboratory stock), respectively. Antibodies against mini-AID and OsTir1 were generated.

NAA and doxycycline A synthetic auxin, 1-naphthalene acetic acid (NAA; N0640, Sigma-Aldrich) was dissolved in 85% ethanol at 0.5 M and stored at 20°C. Doxycycline (D9891, Sigma-Aldrich Co.) was dissolved in 50% ethanol at 10 mg/ml and stored at 20°C.

Results and discussion The AID system is not sufficient for isolating tight mutants of some genes When we constructed AID mutants of replication factors in the budding yeast S. cerevisiae, the AID constructs of some genes, such as MCM4 and CDC45, showed severe growth defects on auxin-containing media, as reported previously (Figure 1A) (Nishimura et al., 2009). However, the presence of auxin did not cause severe growth inhibition with some genes, such as MCM10 and DPB11 (Figure 1A). All of these genes are involved in the initiation of chromosome DNA replication (for details, see reviews in Masai et al., 2010; Tanaka and Araki, 2013). Therefore, the tight mutants of all of these genes should arrest the cell cycle at the G1–S boundary. As expected, G1 cells accumulated in mcm4–AID and cdc45– AID after addition of the synthetic auxin NAA. However, in mcm10–AID and dpb11–AID, although G1 cells accumulated 1 h after the addition of NAA, the cell cycle progressed and was never arrested in G1 (Figure 1B). The levels of the COOH-terminally AID-tagged proteins from all of the tagged genes decreased and became undetectable with specific antibodies after the addition Copyright © 2015 John Wiley & Sons, Ltd.

S. Tanaka et al.

of NAA, indicating that the AID tag-dependent protein degradation seemed to work (Figure 1C, lanes 6–15 and 21–30). However, mcm10–AID or dpb11–AID cells grew even in the presence of NAA (Figure 1A). It was reported recently that the 3× mini-AID tag is better than the full-length IAA17 tag (Kubota et al., 2013). However, growth of the mcm10–3x mini–AID and dpb11–3x mini–AID mutants was not inhibited on NAA-containing plates, as in the case of mcm10–AID and dpb11–AID (Figure 1D). These findings suggested that the AID systemdependent elimination of Mcm10–AID or Dpb11–AID was not sufficient for constructing tight mutants of MCM10 and DPB11, respectively. A previous report on Mcm10 also showed that mcm10–AID does not show tight arrest and that the ts mutation of MCM10, mcm10-1 combined with AID tag, was needed to obtain the tight mutant of MCM10 (Watase et al., 2012). Generally, combining the pre-existing ts mutation with the degron tag was also effective for improving the tightness of the mutation, even in the case of the td, as shown in previous reports (e.g. Lindner et al., 2002; Tanaka et al., 2007). However, such approaches are not applicable if the appropriate ts mutation(s) are not pre-existent, and generally, the isolation of tight ts mutants is laborious. Therefore, we tried to improve the degron system itself. As for the reason for the cellular growth of mcm10–AID and dpb11–AID in the presence of auxin, we postulated that the continuous transcription caused continuous supply of these proteins even when they were hardly detectable. Because COOH-terminally tagged Mcm10– and Dpb11– AID are expressed from their own promoters, it was expected that the transcription from these genes occurs continuously. In contrast, in an NH2-terminally tagged AID, own promoter of a gene of interest is replaced with that of CUP1 (CUP1p). However, neither the NH2-terminally tagged CUP1p–AID–dpb11 nor CUP1p–AID– mcm10 showed a significant growth defect in the presence of auxin (Figure 1E). Recently, a variation of AID tag, which improves the phenotype of CUP1p–AID mutant by combining the CUP1p with a truncated AID tag, was reported (Morawska and Ulrich, 2013). However, neither the CUP1p– AID–dpb11 or the dpb11–3x mini–AID mutant showed a significant growth defect in the presence of auxin, as described above. We tried to combine Yeast 2015; 32: 567–581. DOI: 10.1002/yea

Improved auxin-inducible degron in S. cerevisiae

571

A

B

C

D

E

Figure 1. mcm10– and dpb11–AID are not sufficient for inhibiting cell growth. (A) YST1353 (Wt), YST1394 (mcm4–AID), YST1402 (cdc45–AID), YST1406 (mcm10–AID) and YST1392 (dpb11–AID) cells were serially diluted and grown on YPAD or YPAD containing 1 mM NAA at 30°C. (B) YST1353 (Wt), YST1394 (mcm4–AID), YST1402 (cdc45–AID), YST1406 (mcm10–AID) and YST1392 (dpb11–AID) cells were grown in YPAD medium until ~1E7 cells/ml; NAA was added to 1 mM (=0 h), the incubation was continued and cells were collected at the times indicated (1, 2, 3 and 4 h); the DNA contents of the samples were analysed by flow cytometry. (C) Whole-cell extracts were prepared from the samples described in (B) and analysed by western blotting: Mcm4-, Cdc45-, Mcm10-, Dpb11- and Myc-tagged OsTir1 proteins were detected with anti-Mcm4, anti-Cdc45, anti-Mcm10, anti-Dpb11 and anti-Myc antibodies, respectively; the loading control shows the corresponding region of the membrane stained with Ponceau-S; *non-specific bands. (D) YST2199 (Wt), YST2705 (mcm10–3× miniAID), YST2706 (dpb11–3× miniAID) and YST1394 (mcm4–AID) cells were grown as in (A). (E) YST1353 (Wt), YST2708 (AID–dpb11), YST2794 (AID–mcm10) and YST1394 (mcm4–AID) cells were grown as in (A)

Copyright © 2015 John Wiley & Sons, Ltd.

Yeast 2015; 32: 567–581. DOI: 10.1002/yea

572

a promoter other than CUP1p in the further construction of our mutants.

Construction of a tetracycline-repressible AID system We have shown previously that the Tet-OFF promoter works better than CUP1p when it is combined with the cdt1-td allele (Tanaka and Diffley, 2002). Therefore, we decided to combine the AID system with the Tet-OFF promoter system, and we constructed the plasmids as PCR templates as follows (Figure 2). In constructing the plasmids, we chose the 3× mini-AID tag rather than the fulllength IAA17, based on the data in recent reports (Figure 2) (Kubota et al., 2013). As described below, the combination of the Tetrepressible system and AID worked better than the original AID system. As noted above, we named the combined system iAID. In the iAID system, the AID tag can be fused to either the NH2- or COOH-terminal of the gene of interest. Construction of the iAID mutant is shown schematically in Figure 2A–D. Briefly, to construct the NH2-terminally tagged iAID [iAID (N)] mutant, the DNA fragment that contained the 5′ upstream of the gene of interest, the N-terminal cassette (Figure 2A) and the NH2terminal portion of the ORF of the gene of interest were amplified by PCR and was used for transformation (Figure 2C). To construct the COOH-terminally tagged iAID [iAID (C)], two DNA fragments were amplified by PCR and were used for transformation (Figure 2D). One of them contained the 5′ upstream of the gene of interest, the Tet promoter cassette (Figure 2A) and the NH2 terminal portion of the ORF of the gene of interest. Another one contained the COOH-terminal portion of the ORF of the gene of interest, the C-terminal cassette (Figure 2B) and the 3′ downstream of the gene of interest (Figure 2D). These two fragments can be introduced into yeast either separately or simultaneously. Notably, for COOH-terminal tagging of the gene of interest, plasmids constructed on the pFA6a vector are often used as PCR templates in yeasts. In this system, the common primer sequences (F2 and R1) are used for the amplification of the tag cassettes (Bahler et al., 1998; Longtine et al., 1998). Therefore, we placed the same sequences at both ends of the C-terminal cassette, Copyright © 2015 John Wiley & Sons, Ltd.

S. Tanaka et al.

so that one can use these primers for COOHterminal tagging (Figure 2B). To make the iAID work, in addition to the iAIDtagged gene of interest, the host cells must express tTA, TetR′–Ssn6 and TIR1, an adaptor of E3 ligase, for the AID tag. If these three components are expressed separately, as in the case of previous reports, at least three selection markers are consumed. To maintain usable selection markers and for easier strain construction, we combined these three factors on one plasmid and thus obtained pST1760 and pST1868 (Figure 2E). In this plasmid, the tTA and TetR′–Ssn6 for Tet-OFF are expressed from the bidirectional promoter. To obtain a better ‘off’ phenotype, TetR′–Ssn6 was put under the control of the stronger side of the bidirectional promoter (the YML120c side in pST1760 and the YBR189w side in pST1868), based on the information described in previous genome-wide analysis (Xu et al., 2009). OsTIR1 was put under the control of the TDH3 promoter, which is strong and constitutive (Figure 2E). When the expressions of tTA, TetR′–Ssn6 and OsTir1 were tested in cells harbouring pST1760 and pST1868, OsTir1 was detected in the cellular extracts (Figure 2F). However, tTA and TetR′– Ssn6 could not be detected simultaneously, probably because of the technical limitations of commercial anti-TetR antibodies (data not shown). Although tTA and TetR′–Ssn6 were not detected simultaneously, our iAID constructs showed poor growth on medium containing doxycycline, a tetracycline analogue (Figure 3A), which indicates that the TetOFF was working as expected. Therefore, we concluded that tTA and TetR′–Ssn6 are simultaneously expressed in cells harbouring these plasmids, and we used these plasmids for further analysis.

Construction and characterization of iAID mutants of replication factors To test the effectiveness of iAID, we constructed iAID mutants of MCM10 and DPB11, whose AID mutants did not show tight growth inhibition on an auxin-containing plate (Figure 1A, D). The cellular growth of newly constructed mcm10–iAID and dpb11–iAID mutants was tested on plates containing NAA and/or doxycycline (Figure 3A). mcm10–iAID (C), dpb11–iAID (N) and dpb11–iAID (C) mutants showed very severe growth defects on the plates containing 20 μg/ml doxycycline and 1 mM NAA. Yeast 2015; 32: 567–581. DOI: 10.1002/yea

Improved auxin-inducible degron in S. cerevisiae

573

A

B

C

D

E

F

Figure 2. Schematic drawings of the construction of iAID mutants. (A) Schematic drawing of the structure of the PCR cassette for N-terminal tagging of the gene of interest; the positions and directions of PCR primers are shown by arrows in magenta. (B) Schematic drawings of the structure of the PCR cassette for C-terminal tagging of the gene of interest; the positions and directions of the PCR primers are shown by arrows in magenta. (C) Schematic drawing of the construction of iAID (N) mutant. (D) Schematic drawing of the construction of the iAID (C) mutant. (E) Schematic drawing of the plasmid for the expression of Tir1, tTA and TetR′–Ssn6. (F) Whole-cell extracts were prepared from the logarithmically growing cells of W303-1a Δbar1 (Wt), YST2199 (+pST1760) and YST2363 (+pST1868) and were analysed by western blotting: OsTir1 proteins were detected with anti-OsTir1 antibodies; the loading control shows the corresponding region of the membrane stained with Ponceau-S

This finding indicated that the iAID system was working well in these cells. By contrast, mcm10– iAID (N) did not show severe growth defects, even on the doxycycline- and NAA-containing plate, although cell growth was somehow inhibited. We noted that mcm10–iAID (C), dpb11–iAID (N) and dpb11–iAID (C) also conferred severe Copyright © 2015 John Wiley & Sons, Ltd.

growth defects on the plates containing a high concentration of doxycycline (Figure 3A). Therefore, we asked whether Tet-OFF alone is sufficient for inducing severe growth defects, although the previous systematic analysis reported that both TetO7 –MCM10 and TetO7 –DPB11 showed only slight growth defects (Mnaimneh et al., 2004). Yeast 2015; 32: 567–581. DOI: 10.1002/yea

574

S. Tanaka et al.

Figure 3. Characterization of iAID mutants. (A) YST2199 (Wt), YST1394 (mcm4–AID), YST1406 (mcm10–AID), YST2408 [mcm10–iAID (N)], YST2575 [mcm10–iAID (C)], YST1392 (dpb11–AID), YST2573 [dpb11–iAID (N)] and YST2571 [dpb11–iAID (C)] cells were serially diluted and grown on YPAD or YPAD containing 1 mM NAA, various amounts of doxycycline and both 20 μg/ml doxycycline and 1 mM NAA at 30°C. (B) YST2199 (Wt), YST2791 (TetO2–DPB11) and YST2392 (TetO2–MCM10) cells were serially diluted and then grown in YPAD alone or in YPAD containing 10 or 20 μg/ml doxycycline at 30°C. (C) YST2199 (Wt), YST2791 (TetO2–DPB11) and YST2392 (TetO2–MCM10) cells were grown in YPAD medium until ~5×106 cells/ml (Asyn), and α-factor was added to 40 ng/ml: 1 h after α-factor addition, the culture was divided into two and doxycycline was added to 20 μg/ml to one portion (+Dox); the cells were incubated for a further 2.5 h at 30°C. Finally, the cells were washed twice and then released in fresh YPAD ( Dox) or YPAD containing 20 μg/ml doxycycline (+Dox) and collected every 20 min after release (0–80 min); the DNA contents of the samples were analysed by flow cytometry. (D) YST2199 (Wt), Y, YST2575 [mcm10–iAID (C)], YST2573 [dpb11–iAID (N)] and YST2571 [dpb11–iAID (C)] cells were grown in YPAD medium until ~5×106 cells/ml (Asyn), and α-factor was added to 40 ng/ml: 1 h after α-factor addition, the culture was divided into two and NAA and doxycycline were added to 1 mM and 20 μg/ml, respectively, to one portion (+Dox, NAA); the cells were incubated further for 2.5 h at 30°C. Finally, the cells were released in fresh YPAD ( Dox, NAA) or YPAD containing 1 mM NAA and 20 μg/ml doxycycline (+Dox, NAA) after two washes and were collected every 20 min after release (0–80 min); the DNA contents of the samples were analysed by flow cytometry. (E) Whole-cell extracts were prepared from the samples described in (B) and analysed by western blotting: Mcm10, Dpb11 and Orc6 proteins were detected with anti-Mcm10, anti-Dpb11 and anti-Orc6 antibodies, respectively; the loading control shows the corresponding region of the membrane stained with Ponceau-S; *non-specific bands Copyright © 2015 John Wiley & Sons, Ltd.

Yeast 2015; 32: 567–581. DOI: 10.1002/yea

Improved auxin-inducible degron in S. cerevisiae

575

Our TetO2–MCM10 and TetO2–DPB11 also showed mild growth defects on doxycyclinecontaining plates (Figure 3B) and no significant replication defects (Figure 3C). Therefore, these results indicate that iAID is better than AID or Tet-OFF alone. We characterized mcm10–iAID (C), dpb11– iAID (N) and dpb11–iAID (C) mutants further to see whether these mutants would show the tight phenotype. Mcm10 and Dpb11 are required for the initiation of DNA replication. Therefore, tight mutants of these genes should arrest the cell cycle in G1. We reasoned that if mcm10–iAID (C), dpb11–iAID (N) and dpb11–iAID (C) were ‘tight’ mutants, severe replication defects would be observed in a single cell cycle. We thus examined synchronized cells as follows. Cells of mcm10– iAID (C), dpb11–iAID (N) and dpb11–iAID (C) mutants were arrested in G1 with α-factor, with or without doxycycline and NAA, and then released synchronously (Figure 3D). Without doxycycline and NAA (Figure 3D; Dox, NAA), these cells entered and finished S phase at 20–40 min, as did the wild-type, and then they finally entered into the next cell cycle at 80 min. By contrast, in the presence of doxycycline and NAA, dpb11-iAID (N) cells did not enter S phase and stayed in G1, as shown by the flow-cytometry profiles (Figure 3D; dpb11–iAID (N), +Dox, NAA). During the time course, the slow-migrating band of phosphorylated Orc6, a protein phosphorylated by S- and M-phase CDK, appeared from 20 min after the release from G1 arrest in both conditions (Figure 3E), which indicated that S-phase CDK was activated in these cells by starting a new cell cycle in both conditions. This finding indicated that dpb11–iAID (N) is a tight mutant of dpb11 (Figure 3D). However, the profiles of mcm10– iAID (C) and dpb11–iAID (C) cells showed that these cells entered S phase even in the presence of doxycycline, which indicates that mcm10–iAID (C) and dpb11–iAID (C) did not show tight arrest in this condition (Figure 3D). To confirm that Mcm10–iAID (C), Dpb11–iAID (N) and Dpb11–iAID (C) proteins were degraded, their protein levels were monitored (Figure 3E). Dpb11–iAID (N) protein was undetectable in the condition with doxycycline and NAA, which reflected its tight phenotype (Figure 3E, lanes 24–27). By contrast, Mcm10–iAID (C) and Dpb11–iAID (C) proteins could be detected even

in the condition with doxycycline and NAA (Figure 3E, lanes 15–18, 33–36), although the protein amount was clearly decreased. This condition seemed to cause the leaky phenotype of mcm10– iAID (C) and dpb11–iAID (C) mutants. Although it appeared that there was more Mcm10–iAID (C) protein than Dpb11–iAID (C) protein in this condition (Figure 3E, lanes 15–18, 33–36), cell cycle progression was delayed more in dpb11–iAID (C) cells than in mcm10–iAID (C) after doxycycline and NAA were added (Figure 3D). We assume that the threshold levels of minimal protein amount required for the essential function of these proteins differs between proteins, and/or the 3× mini-AID tag might also differently affect the function of target protein. Regardless of the reason, these data indicated that only the dpb11–iAID (N) mutant showed the tight phenotype in this condition.

Copyright © 2015 John Wiley & Sons, Ltd.

Improvement in the iAID mutant phenotype As described above, although the growth of mcm10–iAID (C) and dpb11–iAID (C) cells was severely inhibited on doxycycline- and NAAcontaining plates, they did not show tight arrest in the single-cell cycle analysis (Figure 3A, D). The growth of these cells was also inhibited on plates containing only a high concentration of doxycycline (Figure 3A, 10 and 20 μg/ml Dox), and a lower concentration of doxycycline did not inhibit cell growth (Figure 3A, 0.25 μg/ml Dox). These results indicated that doxycycline affects the expression of iAID genes in a dose-dependent manner. Therefore, we assumed that we could increase the tightness of mcm10–iAID (C) and dpb11–iAID (C) mutant cells if the amount of pre-existing mutant protein was decreased by pregrowing the cells in the medium containing a low doxycycline concentration. To test this possibility, mcm10–iAID (C) and dpb11–iAID (C) cells were grown in medium containing a low doxycycline concentration (0.25 μg/ml). α-Factor was then added to arrest the cells in G1 phase, and the high doxycycline concentration (20 μg/ml) and NAA (1 mM) were then added to induce the degradation of the AID-tagged protein. Finally, G1-arrested cells were released synchronously into fresh medium containing a high doxycycline concentration and NAA, and the progression of the cell cycle was monitored (Figure 4A). DNA replication occurred at 20–60 min in wild-type Yeast 2015; 32: 567–581. DOI: 10.1002/yea

S. Tanaka et al.

576 A

B

C

D

Figure 4. Further characterization of mcm10–iAID (C) and dpb11–iAID (C) mutants. (A) YST2199 (Wt), YST2575 [mcm10– iAID (C)] and YST2571 [dpb11–iAID (C)] cells were grown in YPAD medium containing 0.25 μg/ml doxycycline until ~5×106 cells/ml (Asyn), and α-factor was added to 40 ng/ml; 1 h after α-factor addition, NAA and doxycycline were added to 1 mM and 20 μg/ml, respectively, and the cells were incubated further for 2.5 h at 30°C. Finally, the cells were released in fresh YPAD medium containing 1 mM NAA and 20 μg/ml doxycycline and samples were collected every 20 min after release (0–80 min); the DNA contents of the samples were analysed by flow cytometry. (B, C) Whole-cell extracts were prepared from the samples described in (A) and were analysed by western blotting: Mcm10, Dpb11 and Orc6 proteins were detected with anti-Mcm10, anti-Dpb11 and anti-Orc6 antibodies, respectively; the loading control shows the corresponding region of the membrane stained with Ponceau-S; *non-specific bands. (D) YST2199 (Wt), YST2575 [mcm10–iAID (C)] and YST2571 [dpb11–iAID (C)] cells were grown and arrested in G1 with α-factor, as in (A); 1 h after α-factor addition, doxycycline was added to 20 μg/ml. At the same time, the culture was divided into two, NAA was added to 1 mM to one portion (+Dox and NAA) and the cells were incubated for a further 2.5 h at 30°C. Finally, the cells were released in fresh YPAD medium containing 20 μg/ml doxycycline (+Dox only) or 20 μg/ml doxycycline and 1 mM NAA (+Dox and NAA), and the samples were collected every 20 min after release (0–80 min); the DNA contents of the samples were analysed by flow cytometry Copyright © 2015 John Wiley & Sons, Ltd.

Yeast 2015; 32: 567–581. DOI: 10.1002/yea

Improved auxin-inducible degron in S. cerevisiae

577

cells, but the DNA content of mcm10–iAID (C) and dpb11–iAID (C) cells stayed at G1 after release throughout the experiment (Figure 4A). This indicated that DNA replication was inhibited in the mcm10–iAID (C) and dpb11–iAID (C) cells. Judging from the phosphorylation status of Orc6, Sphase CDK seemed to be activated in these cells as well as in wild-type cells (Figure 4B, C). This indicated that the commitment to the new cell cycle occurred similarly in all of these cells. Therefore, we concluded that Mcm10–iAID (C) and Dpb11– iAID (C) proteins were fully inactivated and that mcm10–iAID (C) and dpb11–iAID (C) cells showed the tight arrest phenotype under this condition. This conclusion was supported by the results of western blotting, in which Mcm10–iAID (C) and Dpb11–iAID (C) bands could not be detected (Figure 4B, C, lanes 7–10). Notably, as expected, the initial amounts of Mcm10–iAID (C) and Dpb11–iAID (C) proteins were reduced in cells pregrown in medium containing a low doxycycline concentration [cf. Figure 3C, lane 10, and Figure 4B, lane 6, for Mcm10–iAID (C), and Figure 3C, lane 28, and Figure 4C, lane 6, for Dpb11–iAID (C)]. These findings suggested that pregrowing cells in the medium containing the low doxycycline concentration was an effective way to obtain the tight phenotype in mcm10–iAID (C) and dpb11–iAID (C) cells. Because mcm10–iAID (C) and dpb11–iAID (C) cells showed severe growth defects on plates containing doxycycline, we compared the condition containing doxycycline alone with that containing both doxycycline and NAA. Both mcm10–iAID (C) and dpb11–iAID (C) cells showed tighter arrest when both drugs were included (Figure 4D). Interestingly, the difference between these conditions was moderate for dpb11–iAID (C) cells. Because neither TetO2–DPB11 nor dpb11–3x mini-AID cells showed severe growth defects on drug-containing plates (Figures 1D, 3B), iAID seemed to be responsible for the severe phenotype of dpb11–iAID (C) cells in the condition with doxycycline. Constitutively expressed OsTir1 in our system might have destabilized Dpb11–iAID (C) protein at some levels, even in the absence of NAA. As shown in Figure 4, the strategy in which cells are pregrown in medium containing a low doxycycline concentration worked well with the two independent mutant strains. This suggested that the strategy could be widely applicable to iAID mutant

strains to be constructed in the future. We have already confirmed that this is true with other replication mutants; examples are shown in Figure 5. iAID mutants of six essential replication genes, orc1–iAID (C), pol1–iAID (C), dpb2–iAID (C), pol3–iAID (C), pol12–iAID (C) and pri1–iAID (C), were constructed, and all of them showed severe growth defects on NAA- and doxycyclinecontaining plates (Figure 5A). Three of the genes, pol1–iAID (C), dpb2–iAID (C) and pol3–iAID (C), were tested further to examine their phenotypes (Figure 5B). POL1, DPB2 and POL3 encode essential subunits of replicative DNA polymerase α, ε and δ, respectively. In all mutants, the pregrowth of cells in medium containing a low doxycycline concentration resulted in severe replication defects (Figure 5B, C; cf. ‘+Dox, NAA’ with ‘Low Dox → +Dox, NAA’).

Copyright © 2015 John Wiley & Sons, Ltd.

Versatility of the iAID system We made two versions of plasmids, pST1760 and pST1868, to supply OsTIR1, tTA and TetR′– Ssn6. These had different bidirectional promoters to express tTA and TetR′–Ssn6 and different selective markers (Figure 2E). The above-mentioned mcm10–iAID (C), dpb11–iAID (N) and dpb11– iAID (C) mutants were constructed in cells harbouring pST1760 in the SSN6 locus in the genome. mcm10–iAID (C), constructed in cells harbouring pST1868 in the LEU2 locus, also showed severe growth inhibition on medium containing doxycycline and NAA (Figure 6A), which indicates that pST1868-harbouring cells are also a good host for constructing iAID mutants. Because TetR′–Ssn6 on pST1868 is under the control of the promoter of YBR189w, which encodes ribosomal 40S subunit protein S9B and is highly expressed in growing cells (Xu et al., 2009), mcm10–iAID (C) cells constructed in the pST1868-harbouring host was more sensitive to doxycycline than was the equivalent mutant constructed in the pST1760-harbouring host (Figure 6A, right panel). Therefore, if the constructed iAID mutant in the pST1868-harbouring host is very sensitive to doxycycline, one might not need to pregrow mutant cells in medium containing a low doxycycline concentration, although the sensitivity to doxycycline must be tested in individual mutants. This was the case for mcm10–iAID (C) cells. mcm10– iAID (C) introduced into the pST1868-harbouring Yeast 2015; 32: 567–581. DOI: 10.1002/yea

S. Tanaka et al.

578 A

l

l

B

C

Figure 5. Construction of iAID mutants for other replication proteins. (A) YST2199 (Wt), YST2796 (orc1–3× miniAID), YST2458 [orc1–iAID (C)], YST2797 (pol1–3× miniAID), YST2395 [pol1–iAID (C)], YST2795 (dpb2–3× miniAID), YST2393 [dpb2–iAID (C)], YST2799 (pol3–3× miniAID), YST2397 [pol3–iAID (C)], YST2800 (pol12–3× miniAID), YST2630 [pol12–iAID (C)], YST2801 (pri1–3× miniAID) and YST2396 [pri1–iAID (C)] cells were serially diluted and grown on the plates indicated at 30°C. (B) YST2395 [pol1–iAID (C)], YST2393 [dpb2–iAID (C)] and YST2397 [pol3–iAID (C)] cells were grown and samples were collected as described in Figure 3D (’–Dox, NAA’ and ’ + Dox, NAA’) or as in Figure 4A (’low Dox → +Dox, NAA’). The initial concentrations of doxycycline for ’low Dox → +Dox, NAA’ were 0.25, 0.25 and 0.1 μg/ml for YST2395, YST2393 and YST2397, respectively. The DNA contents of the samples were analysed by flow cytometry. (C) Whole-cell extracts were prepared from the samples described in (B) and analysed by western blotting: Orc6 protein was detected with anti-Orc6 antibody; the loading control shows the corresponding region of the membrane stained with Ponceau-S Copyright © 2015 John Wiley & Sons, Ltd.

Yeast 2015; 32: 567–581. DOI: 10.1002/yea

Improved auxin-inducible degron in S. cerevisiae

579

A

l

l

B

C

D

E

l

l

l

Figure 6. Characterization of various iAID mutants under various conditions. (A) YST2199 (Wt, +pST1760), YST2575 [mcm10-iAID (C), +pST1760], YST2577 [mcm10-iAID (C)-5Flag, +pST1760], YST2363 (Wt, +pST1868), YST2576 [mcm10-iAID (C), +pST1868] and YST2578 [mcm10-iAID (C)-5Flag, +pST1868] cells were serially diluted and grown on the indicated medium at 30°C. (B) YST2363 [Wt (+pST1868)] and YST2576 [mcm10-iAID (C) (+pST1868)] cells were grown and samples were taken as in Figure 3D; the DNA contents of the samples were analysed by flow cytometry. (C) YST2575 (+pST1760) and YST2576 (+pST1868) cells were collected and analysed by western blotting; Mcm10 protein was detected with anti-Mcm10 antibodies. (D) Whole-cell extract was prepared from YST2199 (Wt), YST2577 [mcm10–iAID (C)–5Flag] and YST2575 [mcm10–iAID (C)] and analysed by western blotting; Mcm10 proteins were detected with anti-Mcm10, anti-Mini-AID and anti-FLAG antibodies, respectively; the loading control shows the corresponding region of the membrane stained with Ponceau-S. (E) YST2199 (Wt, +pST1760), YST2384 [mcm10–iAID (N), +pST1760], YST2575 [mcm10–iAID (C), +pST1760], YST2573 [dpb11–iAID (N), +pST1760], YST2571 [dpb11–iAID (C), +pST1760], YST2363 (Wt, +pST1868), YST2408 [mcm10–iAID (N), +pST1868], YST2576 [mcm10–iAID (C), +pST1868], YST2574 [dpb11–iAID (N), +pST1868] and YST2572 [dpb11–iAID (C), +pST1868] cells were serially diluted and grown on the indicated medium at 30°C Copyright © 2015 John Wiley & Sons, Ltd.

Yeast 2015; 32: 567–581. DOI: 10.1002/yea

580

host showed a tighter phenotype than that introduced into the pST1760-harbouring host (cf. Figures 6B, 3D). As expected, the amount of Mcm10–iAID protein was lower in the pST1868harbouring host than in the pST1760-harbouring host (Figure 6C). We also included a slight modification of the iAID (C) cassette by adding five tandem copies of FLAG (5× FLAG) tag for the easier detection of AID-tagged protein (Figure 2B). A 5× FLAGtagged version of the iAID (C) mutant of MCM10, mcm10–iAID (C)–5xFLAG, responded well to doxycycline and NAA, as did mcm10–iAID (C) (Figure 6A). 5× FLAG-tagged protein was detected by the commonly used anti-FLAG antibody (Figure 6D). Interestingly, mcm10–iAID (C)–5xFLAG seemed to respond slightly better to the drugs than did mcm10–iAID (C) in this case. However, the 5× FLAG tag seemed to stabilize the tagged protein in other cases (data not shown). Therefore, one can make both versions of iAID (C) for the gene of interest and choose the better degron after testing their behaviours. In our iAID system, OsTir1, an adaptor protein to target AID-tagged protein to the ubiquitindependent degradation machinery, is expressed from a strong constitutive promoter of TDH3. Because the TDH3 promoter seems active in many carbon sources used in yeast experiments, we tested our iAID mutants [mcm10–iAID (N), mcm10–iAID (C), dpb11–iAID (N) and dpb11– iAID (C)] on different carbon sources. iAID mutants showed the same behaviour on different carbon sources, such as glucose, raffinose and galactose (Figure 6E). This indicates that the experiment can be designed so that the iAID mutant is combined with a galactose-inducible promoter. This means that the gene of interest can be induced after the inactivation of other essential gene(s) of interest, and that this kind of analysis would be helpful for investigating more precisely the functions of the gene(s) of interest. In the original AID system, galactose-inducible TIR1 (GALp–TIR1) is used frequently in S. cerevisiae (Kubota et al., 2013; Watase et al., 2012). We also combined GALp–TIR1 with our iAID mutants and tested their phenotype. However, we found no significant difference between our constitutive TDH3p–TIR1 and GALp–TIR1 (data not shown). Although GALp–TIR1 may have an advantage in some severe conditions, we prefer Copyright © 2015 John Wiley & Sons, Ltd.

S. Tanaka et al.

TDH3p–TIR1 because of the versatility of the system, as described above. The AID system is also effective in the fission yeast Schizosaccharomyces pombe (Kanke et al., 2011). In the fission yeast system, Tir1 protein is fused with SpSkp1, a conserved component of SCF E3 ubiquitin ligase, and the nuclear localization signal (NLS) to improve the degradation of AID-tagged protein (Kanke et al., 2011). By contrast, ectopically expressed Tir1 seems sufficient for targeting AID-tagged protein to ubiquitin-dependent protein degradation and does not require Skp1 and NLS fusion for functioning in the budding yeast system. The phenotype of Tir1 fused with SV40 NLS was similar to that of Tir1 alone in our system (data not shown). In this report, we describe our development of the iAID system, in which the Tet-OFF promoter and AID are combined, using the budding yeast S. cerevisiae as a model system. Tet-OFF is achieved by simply adding the tetracycline analogue, doxycycline, to the culture medium. Therefore, the combination of Tet-OFF and AID maintains the easy-to-use characteristics of the original AID system, in which the degradation of the AID-tagged protein is triggered by auxin addition to the culture medium. In the above-mentioned fission yeast system, transcription of AID-tagged protein is also controlled by introducing the nmt-repressible promoter and this worked well (Kanke et al., 2011), as did our iAID system. Unfortunately, however, the nmt promoter is specific to fission yeast. The Tet-OFF system is applicable in fission yeast (Zilio et al., 2012) and we expect that our iAID type setup would also work in fission yeast. Notably, because the iAID system simultaneously introduces both tTA and TetR′–Ssn6, cells show dosedependent doxycycline sensitivity, and pregrowing cells in the medium containing a low doxycycline concentration can sensitize the cells’ response to the restriction condition (Figures 4, 6). This seems to be an advantage of the iAID system. To date, we have made iAID (N) and iAID (C) mutants with more than 10 replication factors, and either or both of the iAID (N) and iAID (C) mutants showed severe growth inhibition on media containing doxycycline and NAA for all genes tested (six examples are shown in Figure 5A; other results will be published elsewhere). Therefore, the success rate of tight mutant construction with the iAID system is very high. Both Tet-OFF and AID have been shown to work in other eukaryotic systems (Gossen Yeast 2015; 32: 567–581. DOI: 10.1002/yea

Improved auxin-inducible degron in S. cerevisiae

581

and Bujard, 1992; Nishimura et al., 2009), and we can expect that this iAID system will be easily applicable to wide varieties of eukaryotic systems and to contribute to the analysis of gene functions.

Lindner K, Gregan J, Montgomery S, Kearsey SE. 2002. Essential role of MCM proteins in premeiotic DNA replication. Mol Biol Cell 13: 435–444. Longtine MS, McKenzie A III, Demarini DJ, et al. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14: 953–961. Masai H, Matsumoto S, You Z, et al. 2010. Eukaryotic chromosome DNA replication: where, when, and how? Annu Rev Biochem 79: 89–130. Mnaimneh S, Davierwala AP, Haynes J, et al. 2004. Exploration of essential gene functions via titratable promoter alleles. Cell 118: 31–44. Morawska M, Ulrich HD. 2013. An expanded tool kit for the auxininducible degron system in budding yeast. Yeast 30: 341–351. Nishimura K, Fukagawa T, Takisawa H, et al. 2009. An auxin-based degron system for the rapid depletion of proteins in non-plant cells. Nat Methods 6: 917–922. Tanaka S, Araki H. 2013. Helicase activation and establishment of replication forks at chromosomal origins of replication. Cold Spring Harb Perspect Biol 5: a010371. Tanaka S, Diffley JF. 2002. Interdependent nuclear accumulation of budding yeast Cdt1 and Mcm2–7 during G1 phase. Nat Cell Biol 4: 198–207. Tanaka S, Komeda Y, Umemori T, et al. 2013. Efficient initiation of DNA replication in eukaryotes requires Dpb11/TopBP1–GINS interaction. Mol Cell Biol 33: 2614–2622. Tanaka S, Nakato R, Katou Y, et al. 2011. Origin association of sld3, sld7, and cdc45 proteins is a key step for determination of origin-firing timing. Curr Biol 21: 2055–2063. Tanaka S, Umemori T, Hirai K, et al. 2007. CDK-dependent phosphorylation of Sld2 and Sld3 initiates DNA replication in budding yeast. Nature 445: 328–332. van Deursen F, Sengupta S, De Piccoli G, et al. 2012. Mcm10 associates with the loaded DNA helicase at replication origins and defines a novel step in its activation. EMBO J 31: 2195–2206. Watase G, Takisawa H, Kanemaki MT. 2012. Mcm10 plays a role in functioning of the eukaryotic replicative DNA helicase, Cdc45–Mcm–GINS. Curr Biol 22: 343–349. Xu Z, Wei W, Gagneur J, et al. 2009. Bidirectional promoters generate pervasive transcription in yeast. Nature 457: 1033–1037. Zilio N, Wehrkamp-Richter S, Boddy MN. 2012. A new versatile system for rapid control of gene expression in the fission yeast Schizosaccharomyces pombe. Yeast 29: 425–434.

Acknowledgements We thank H. Masukata, M. Yagura and Y. Tanaka for discussions and M. Kanemaki for the plasmids for the original AID system. This study was supported by the Ministry of Education, Culture, Sports, Science and Technology (MEXT) and the Japan Society for the Promotion of Science (JSPS; Grant Nos 24370075, 25131721 and 26114716 to S.T., and 2664017 to T.I.).

References Araki H, Leem SH, Phongdara A, Sugino A. 1995. Dpb11, which interacts with DNA polymerase II(ε) in Saccharomyces cerevisiae, has a dual role in S-phase progression and at a cell cycle checkpoint. Proc Natl Acad Sci U S A 92: 11791–11795. Bahler J, Wu JQ, Longtine MS, et al. 1998. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14: 943–951. Belli G, Gari E, Piedrafita L, et al. 1998. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Res 26: 942–947. Dohmen RJ, Wu P, Varshavsky A. 1994. Heat-inducible degron: a method for constructing temperature-sensitive mutants. Science 263: 1273–1276. Goldstein AL, McCusker JH. 1999. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15: 1541–1553. Gossen M, Bujard H. 1992. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci U S A 89: 5547–5551. Guldener U, Heck S, Fielder T, et al. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res 24: 2519–2524. Kanke M, Nishimura K, Kanemaki M, et al. 2011. Auxin-inducible protein depletion system in fission yeast. BMC Cell Biol 12: 8. Kubota T, Nishimura K, Kanemaki MT, Donaldson AD. 2013. The Elg1 replication factor C-like complex functions in PCNA unloading during DNA replication. Mol Cell 50: 273–280. Labib K, Kearsey SE, Diffley JF. 2001. MCM2–7 proteins are essential components of prereplicative complexes that accumulate cooperatively in the nucleus during G1-phase and are required to establish, but not maintain, the S-phase checkpoint. Mol Biol Cell 12: 3658–3667.

Copyright © 2015 John Wiley & Sons, Ltd.

Supporting information Additional supporting information may be found in the online version of this article at the publisher’s web-site: Figure S1. Maps and sequences of the plasmids

Yeast 2015; 32: 567–581. DOI: 10.1002/yea