Identification and Characterization of a Putative Manganese Export Protein in Vibrio cholerae.

crossmark

Identification and Characterization of a Putative Manganese Export Protein in Vibrio cholerae Carolyn R. Fisher, Elizabeth E. Wyckoff, Eric D. Peng, Shelley M. Payne Department of Molecular Biosciences, The University of Texas at Austin, Austin, Texas, USA

ABSTRACT

Manganese plays an important role in the cellular physiology and metabolism of bacterial species, including the human pathogen Vibrio cholerae. The intracellular level of manganese ions is controlled through coordinated regulation of the import and export of this element. We have identified a putative manganese exporter (VC0022), named mneA (manganese exporter A), which is highly conserved among Vibrio spp. An mneA mutant exhibited sensitivity to manganese but not to other cations. Under high-manganese conditions, the mneA mutant showed an almost 50-fold increase in intracellular manganese levels and reduced intracellular iron relative to those of its wild-type parent, suggesting that the mutant’s manganese sensitivity is due to the accumulation of toxic levels of manganese and reduced iron. Expression of mneA suppressed the manganese-sensitive phenotype of an Escherichia coli strain carrying a mutation in the nonhomologous manganese export gene, mntP, further supporting a manganese export function for V. cholerae MneA. The level of mneA mRNA was induced approximately 2.5-fold after addition of manganese to the medium, indicating regulation of this gene by manganese. This study offers the first insights into understanding manganese homeostasis in this important pathogen. IMPORTANCE

Bacterial cells control intracellular metal concentrations by coordinating acquisition in metal-limited environments with export in metal-excess environments. We identified a putative manganese export protein, MneA, in Vibrio cholerae. An mneA mutant was sensitive to manganese, and this effect was specific to manganese. The mneA mutant accumulated high levels of intracellular manganese with a concomitant decrease in intracellular iron levels when grown in manganese-supplemented medium. Expression of mneA in trans suppressed the manganese sensitivity of an E. coli mntP mutant. This study is the first to investigate manganese export in V. cholerae.

V

ibrio cholerae, the causative agent of the severe diarrheal disease cholera, is a Gram-negative bacterium residing primarily in estuarine and marine waters. Upon ingestion by the human host, pathogenic strains of V. cholerae colonize the small intestine by adhering to the epithelial cells via the toxin-coregulated pilus (TCP) (1). The bacterium secretes a potent enterotoxin that deregulates cyclic AMP in the epithelial cells, causing the massive ion and water efflux that produces the characteristic “rice-water” stool seen in cholera patients (2). An estimated 2.8 million cases occur annually, resulting in greater than 90,000 deaths (3). Metal cations are essential nutrients for all forms of life, and the concentrations of these ions vary widely between the human digestive tract and the various aquatic environments inhabited by V. cholerae. Manganese is one such essential nutrient, since it functions as a cofactor for a variety of enzymes involved in central carbon metabolism, phosphorylation, hydrolysis, decarboxylation, and, notably, protection from oxidative stress (4). The chemical properties of manganese are similar to those of ferrous (Fe2⫹) iron, an essential cofactor in a large number of cellular enzymes, and manganese and iron can substitute for each other in some, but not all, enzymatic reactions (5, 6). Both metals are toxic when present in excess amounts in the cell, and their levels are tightly controlled (4, 7). Studies in Escherichia coli and Salmonella enterica species have demonstrated that the ratio between these metals is regulated, such that excess iron represses manganese import (8, 9) and excess manganese suppresses iron uptake (7). Some of this regulation is likely due to the major iron-responsive regulator Fur, which can bind both iron and manganese as

2810

jb.asm.org

a cofactor to repress its DNA targets (9). The relationship between manganese and iron transport has not been extensively studied in V. cholerae. Like other enteric pathogens, V. cholerae encodes a Fur protein that functions primarily to control iron acquisition genes, but there are additional targets in the V. cholerae Fur regulon, including genes for manganese homeostasis and virulence (10, 11). The intracellular level of manganese may be regulated through the coordinated activity of import and export proteins. Manganese import in enteric bacteria was initially studied in Salmonella and E. coli (12, 13). These studies showed that manganese import is primarily due to the action of MntH, an NRAMP-like import protein, and SitABCD, a periplasmic binding protein-dependent ABC transport system. Interestingly, these systems were both found to also import iron, but with lower efficiency than the import of manganese (13). Genes that encode both MntH and Sit are under the transcriptional control of both the manganese regulator MntR and the iron regulator Fur (9, 14). Homologues of Sit and

Received 6 March 2016 Accepted 23 July 2016 Accepted manuscript posted online 1 August 2016 Citation Fisher CR, Wyckoff EE, Peng ED, Payne SM. 2016. Identification and characterization of a putative manganese export protein in Vibrio cholerae. J Bacteriol 198:2810 –2817. doi:10.1128/JB.00215-16. Editor: V. J. DiRita, Michigan State University Address correspondence to Shelley M. Payne, [email protected]. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Journal of Bacteriology

October 2016 Volume 198 Number 20

Manganese Export in Vibrio cholerae

TABLE 2 Primers used in this study

TABLE 1 Bacterial strains and plasmids Strain or plasmid

Descriptiona

Reference or source

V. cholerae O395 CA401 mneA

Classical biotype Classical biotype O395 mneA::kan

43 44 This study

S. flexneri SA101 SM100 UR003 UR003w

SA100 wild-type serotype 2a Crb⫺ SA100 wild-type serotype 2a Strr SM100 sitA::cam mntH::kan Avirulent derivative of UR003

45 S. Seliger 21 This study

E. coli DH5␣(␭ pir) MM294 BW25113 JW5830

Cloning strain Host strain for mobilization plasmid Keio Collection parental strain BW25113 mntP::kan

46 47 48 49

Plasmids pGEM-T Easy pWKS30 pUC4K pCVD442N pLAFR3 pB7 pRK2013 pMneA

High-copy-no. cloning vector Low-copy-no. cloning vector Carries cloned kanamycin resistance gene pCVD442 with a NotI adaptor in the SacI site Cosmid vector CA401 genomic DNA in pLAFR3 Mobilization plasmid pWKS30 carrying mneA

Promega 23 Pharmacia 24 50 This study 47 This study

a

Strr, streptomycin resistant.

MntH have subsequently been found in a wide range of bacteria (15), and an additional, unrelated manganese importer, termed MntX, has recently been identified in several species (16); however, manganese import systems have not been identified in V. cholerae. Less is known about manganese export, but export genes have now been identified in numerous species (17, 18). Many of these have homology with the E. coli export protein MntP (formerly known as YebN) (19). In this work, we identified a gene, designated mneA (manganese exporter A), that is involved in V. cholerae manganese homeostasis but has no homology to previously characterized genes in bacteria. An mneA mutant exhibited elevated sensitivity to high manganese concentrations, and this sensitivity was specific to manganese. The mneA mutant accumulated high intracellular levels of manganese, suggesting that MneA may function as a manganese exporter. This was supported by the observation that MneA could functionally substitute for the nonhomologous E. coli manganese exporter MntP in manganese metal sensitivity assays. MATERIALS AND METHODS Strains and growth conditions. Strains and plasmids used in this study are listed in Table 1. Strains were cultured in LB broth or on LB agar (1.5% agar [wt/vol]) at 37°C. Antibiotics were included in the medium at final concentrations of 67 ␮g/ml for streptomycin, 25 ␮g/ml for kanamycin, 83 ␮g/ml for carbenicillin, 12.5 ␮g/ml for tetracycline, 7.5 ␮g/ml for chloramphenicol, and 50 ␮g/ml for ampicillin, as appropriate. Growth curves were determined in 96-well plates using a FlexStation 3 plate reader (Molecular Dynamics) as follows: overnight cultures were grown in LB broth with antibiotics and aeration at 37°C, subcultured 1:100 into LB broth without antibiotics, and grown to mid-log phase (optical density at 650 nm [OD650] of ⬃0.5). Cultures were then diluted to 4 ⫻ 107 CFU/ml in LB


Primer name

Sequence (5= to 3=)

Big Fragment For Big Fragment Rev Vc-B7-5 Vc-B7-6 Vc-B7-7 Vc-B7-8 VC0022 For VC0022 Rev 5= end VC0022 Screen For 5= end VC0022 Screen Rev 3= end VC0022 Screen For 3= end VC0022 Screen Rev 2 Fur5 Fur6 Fur7 Fur9 RyhB20 RyhB15

GATTTGGTTAGGTTGCGAATGC GTGTCTTGTTCGCTACGCATCTC TGACCTATCAATCTCCGCTGTTG AGTAATGGCAAAGCAATGGGG CCAACTGTTATCCTTGTTACTCGCC TTACCAATCAGCACCACTGGAAC GGTAACGAGGGTTGCGATTCTG ACTCTTGAACCCTGCTCATACCC ATCTCCACAACCACAGAAGCGG TGGCTGGGAAGTGTGGCTAAAC AAGGCGTAGATGATACTGGTGGAG TTTACAGGGCGTTGACTCCGTC TTGGATTGCTTTGTGCCGAC TCCGTTACGACATTCCTC AGGTGGGTTTGACAACGCA CATTTGCCGTACAAATAGAGGCT GCTCGATATCAAAACGTTCTACAGC ATTGTGGAAAAGACACTCGC

broth with or without addition of a final concentration of 10 ␮M MnCl2. Plates were incubated at 37°C with shaking, and measurements at OD650 were taken every 10 min for 6 h. To determine the effects of iron on the sensitivity to manganese, overnight cultures were grown as described above and diluted to 2 ⫻ 106 CFU/ml in 13- by 100-mm tubes containing 2 ml of LB broth and 0, 5, 10, 20, 40, or 50 ␮M MnCl2 with or without the addition of 100 ␮M FeSO4. After 18 h of growth at 37°C with shaking, OD650 measurements were taken. Library screen. An avirulent (Crb⫺) (20) variant of UR003, a Shigella flexneri sit mntH mutant (21), was used as the recipient strain to screen a V. cholerae genomic library. This strain, UR003w, is sensitive to a high manganese concentration in the medium (21). A triparental mating was used to transfer the V. cholerae strain CA401 pLAFR3 cosmid library (22) into UR003w. The donor (CA401/pLAFR3 library), recipient (UR003w), and mobilizing strain (MM294/pRK2013) were spread together on an LB agar plate and incubated for 7 h at 37°C. The bacteria were harvested from the plate, diluted in LB broth and plated on LB agar plates containing tetracycline, chloramphenicol, and 2 mM MnCl2. Colonies that grew in the presence of high manganese were restreaked on agar plates containing tetracycline, chloramphenicol, and 2 mM MnCl2. Cosmid DNA was isolated from manganese-resistant colonies by the BAC DNA isolation protocol (Qiagen) and sequenced with M13 forward and reverse primers at the University of Texas Institute for Cellular and Molecular Biology DNA core sequencing facility. Cloning of V. cholerae mneA (VC0022). To construct pmneA, the primers VC0022 For and VC0022 Rev (Table 2) were used to amplify a 988-bp fragment encompassing the mneA coding region using V. cholerae strain O395 whole cells as the template. The resulting fragment was inserted into pGEM-T Easy (Promega). After confirmation of the sequence, the fragment was subcloned as a NotI fragment into the low-copy-number plasmid vector pWKS30 (23). Construction of the mneA (VC0022) mutant. A 2.8-kb fragment was amplified from the V. cholerae strain O395 using primers Big Fragment For and Big Fragment Rev (Table 2) and cloned into pGEM-T Easy. The resulting plasmid was digested with Bpu10I and XcmI to remove an internal fragment encompassing approximately one-third of the VC0022 coding sequence. The digested ends were filled in with Klenow, and the kanamycinr cassette from pUC4K (Pharmacia) was inserted. This plasmid was then digested with NotI, and the fragment containing the disrupted VC0022 gene was ligated into the suicide vector pCVD442N. The allelic exchange mutant was then obtained as described previously (24). Manganese sensitivity assays. (i) Metal sensitivity assay. Overnight cultures of V. cholerae strains were diluted 10-fold into LB broth, and 400


jb.asm.org

2811

2812

jb.asm.org

UR003w/vector

UR003w/pB7

UR003w/vector

2

3

4

5

UR003w/pMneA

UR003w (MnS)

SA101 (MnR)

␮l was added to approximately 15 ml of LB top agar (0.75% [wt/vol] agar) and poured onto the surface of a 150-mm plate containing approximately 50 ml of LB agar. Sterile disks (Becton Dickinson, NJ) were placed at equidistant locations on the surface (5 per plate), and 10 ␮l of the following metal solutions was absorbed onto individual disks: MnCl2 (100 mM), ZnSO4 (100 mM), Na2MoO4 (100 mM), CdCl2 (100 mM), NiCl2 (100 mM), CoCl2 (100 mM), CuSO4 (100 mM), VCl3 (1 M), CrCl3 (1 M), and AlCl3·6H2O (1 M). After overnight incubation at 37°C, the diameter of the cleared zone around each disk was measured. (ii) Manganese resistance gradient plate assay. Gradient plates were prepared in 150-mm-square petri plates by setting the plate at a slight angle and pouring in 30 ml of LB agar containing 5 mM MnCl2 (S. flexneri) or 1 mM MnCl2 (V. cholerae). After the agar solidified, 30 ml of LB agar was added and allowed to solidify with the plate level on the bench. Plates were prepared fresh for each experiment. After brief drying of the plate, 15 ␮l of a 1:500 dilution of overnight cultures of the indicated strains was spread on the gradient plate starting at the high concentration side. Cultures were allowed to soak into the plate. The plate was incubated for 18 h at 37°C, and the growth of each strain was evaluated. (iii) Manganese resistance plate assay. To measure suppression of an E. coli mntP mutant by plasmid-encoded V. cholerae mneA, overnight cultures were diluted and grown to mid-log phase in LB broth with ampicillin. Plates containing LB agar with or without 0.5 mM MnCl2 were streaked with 5 ␮l of the indicated strains. Plates were scored for the presence of bacterial growth after overnight incubation at 37°C. H2O2 sensitivity assay. An agar diffusion growth sensitivity assay was used to test the sensitivity of the wild-type strain and the mneA mutant to oxidative stress induced by hydrogen peroxide. Two hundred microliters of overnight culture was spread on LB agar plates. A sterile filter paper disk (Becton Dickinson) was placed in the center of the plate, and 10 ␮l of 1 M H2O2 (Fisher Scientific) was added to the disk. Plates were incubated at 37°C overnight, and the zone of growth inhibition was measured in millimeters. Suppressor isolation and sequencing. Isolated colonies of the mneA mutant that appeared in zones of higher concentrations of manganese on the gradient plates were streaked onto LB agar plates containing 50 ␮M MnCl2 and kanamycin. Colonies were screened by PCR to confirm the presence of the original mutant mneA allele. Colony PCR of wild-type O395, the mneA mutant, and each suppressor was performed with primers that amplified fur and ryhB, including their respective promoter regions. The resulting PCR products from the suppressors were sequenced and compared to the parental strain, O395, and the mneA mutant. ICP-MS. For inductively coupled plasma-mass spectrometry (ICPMS), the wild-type and mneA strains were grown overnight with antibiotics, subcultured 1:25 into 5 ml of LB broth without antibiotics in 18- by 150-mm test tubes and grown to mid-log phase (OD650 of ⬃0.5) with aeration at 37°C. Cultures were diluted to 2 ⫻ 107 CFU/ml in 25 ml of LB broth or LB broth containing 100 ␮M MnCl2 in a 125-ml flask and grown for 2.5 h at 37°C with shaking. Approximately 4 ⫻ 109 CFU were pelleted and washed once with normal saline, and the resulting pellet was digested in 1 ml of 50% (wt/vol) trace-metal-grade nitric acid (Fisher Scientific) with heat (80°C) for 4 h in sealed Savillex vials (Fisher Scientific). Prior to use, the vials were cleaned by soaking overnight in aqua regia (HNO3HCl, 1:3), followed by extensive washing with deionized water to remove trace metal contaminants. Process control blanks of 50% (wt/vol) tracemetal-grade nitric acid were included to detect any residual metal contamination remaining in the vials. Digested samples were air dried overnight and resuspended in 2% (wt/vol) trace-metal-grade nitric acid for analysis on an Agilent 7500ce inductively coupled plasma mass spectrometer at the University of Texas at Austin Jackson School of Geological Sciences core facility. qRT-PCR. An overnight culture of the wild-type strain O395 was subcultured 1:100 into fresh LB medium and grown at 37°C with aeration to mid-log phase. The culture was divided in half, and MnCl2 was added to one culture at a final concentration of 1 mM. The two cultures (Mn-

Manganese Concentration

Fisher et al.

5mM

0 1

6

FIG 1 Suppression of manganese sensitivity by MneA. The indicated S. flexneri strains were spread on a 0 to 5 mM MnCl2 gradient plate starting at the high concentration side. Plates were incubated overnight at 37°C and assessed for growth. Lane 1, wild-type strain SA101, Mnr; lane 2, UR003w mntH sit, Mns; lane 3, UR003w carrying cosmid vector pLAFR3; lane 4, UR003w carrying cosmid B7; lane 5, UR003w carrying plasmid vector pWKS30; lane 6, UR003w carrying mneA in pWKS30.

treated and untreated) were then incubated for an additional 30 min. Samples were pelleted, and the pellet was resuspended in 1 ml of RNA-Bee (Tel-Test, Friendswood, TX) at room temperature. Samples were extracted with 100% chloroform, and the nucleic acids were precipitated by the addition of isopropanol. The samples were subjected to DNase I (Invitrogen) treatment, and RNA was quantified by a NanoDrop spectrophotometer (Thermo Scientific). Two micrograms of RNA was diluted to 200 ng/␮l, and 10 ␮l of the dilution was used to generate cDNA using a high-capacity cDNA archive kit (Invitrogen). SYBR green (Applied Biosystems) reverse transcriptase quantitative PCR (qRT-PCR) was performed on an ABI 7300 real-time PCR machine (Applied Biosystems) using 2.5 ␮l of a 1:10 dilution of the cDNA reaction as the template. The fold change in the Mn-treated versus untreated sample was assessed by the threshold cycle (⌬⌬CT) method. Reactions without templates were included as negative controls, and CT values were normalized to rpoZ. The results represent the means and standard deviations from three independent experiments.

RESULTS

Identification of V. cholerae mneA. V. cholerae has no genes with homology to those for the manganese importers mntH or sit or for the exporter mntP. To identify genes involved in manganese homeostasis, a cosmid library derived from V. cholerae classical strain CA401 was screened in the S. flexneri sit mntH mutant UR003w. We found that this mutant was sensitive to high levels of manganese (ⱖ2 mM MnCl2), making it useful for screening for resistance, although the reason for its sensitivity is unknown. Cosmids that conferred growth of UR003w on plates containing 2 mM MnCl2 were selected for further analysis. A manganese gradient plate assay was then used to assess the level of manganese sensitivity (Fig. 1). In this assay, SA101, the wild-type S. flexneri, grew at the highest concentration of manganese (5 mM), while UR003w only grew at the lower manganese concentrations. The growth defect of UR003w was suppressed by several cosmid clones




WT mneA mneA/vector mneA/pMneA

A. LB

0.10

0.01

1.00

OD650

OD650

1.00

B. LB + Mn

0

1

2

3

4

5

6

0.10

0.01

Time (hr)

0

1

2

3

4

5

6

Time (hr)

FIG 2 The V. cholerae mneA mutant is sensitive to manganese. Cultures of the O395 parental strain (WT), the mneA mutant strain, the vector control strain (mneA/vector), and the complemented mutant strain (mneA/pMneA) were grown in LB medium (A) or LB medium plus 10 ␮M MnCl2 (B). Growth was monitored over 6 h with aeration at 37°C. Graphs represent the means ⫾ standard deviations (SD) of the OD650 at each time point shown from three biological replicates.

isolated in the screen but not by the cosmid vector pLAFR3. The UR003w mutant carrying a representative cosmid, pB7, is shown in Fig. 1, lane 4. DNA sequence analysis of the B7 cosmid DNA using the universal primer matched the N16961 (wild-type strain) genomic sequence near the origin of replication (bp 21,111 to 21,268, chromosome I; NCBI reference sequence NC_002505.1). Two open reading frames (ORF) near the sequenced region (VC0016 and VC0022) were successfully PCR amplified, confirming that cosmid B7 contained an insert that encompasses this region of the genome. PCR analysis of an additional 18 cosmids that suppressed the manganese sensitivity of UR003w indicated that all of the cosmids isolated contained DNA from this region. To identify the gene or genes encoded on the pB7 cosmid necessary to suppress the manganese-sensitive phenotype in the S. flexneri UR003w strain, candidate genes were amplified and cloned in the low-copy-number plasmid vector pWKS30. A clone containing only the VC0022 open reading frame conferred manganese resistance to UR003w at a level comparable to that of cosmid pB7 (Fig. 1, lanes 4 and 6). VC0022 is annotated as a hypothetical protein. A protein BLAST (25, 26) against the nonredundant protein sequences database showed that this protein sequence is highly conserved in V. cholerae (⬎98% amino acid identity) and in other Vibrio species (⬎85% amino acid identity). It is found in a number of other taxa, including Shewanella species (56% identity) and Pseudomonas species (61% identity), but not in E. coli or Salmonella. In silico translation of VC0022 yields a protein with a predicted molecular mass of 21.3 kDa and a pI of 7.12. It is predicted to be embedded in the inner membrane, with 6 transmembrane segments and the amino terminus in the periplasm (27). No signal peptide is predicted for the protein (28). The MneA protein contains two UPF0016 domains with conserved motifs of EXGDK. UPF0016 domains are conserved among eukaryotic and prokaryotic organisms (29). A hu-


man protein, TMEM165, containing this domain has been linked to calcium efflux from the Golgi apparatus (30), suggesting that UPF0016 domain proteins may play a role in cation transport. We named the VC0022 ORF mneA, for manganese exporter A. MneA is required for manganese resistance in V. cholerae. To investigate whether MneA plays a role in manganese homeostasis in V. cholerae, a mutation in this gene was constructed in the classical strain O395. While the growth of the V. cholerae mneA mutant was similar to that of the wild type in LB broth (Fig. 2A), it exhibited an early plateau in medium containing 10 ␮M MnCl2 (Fig. 2B). The growth defect in the mneA mutant was complemented by expression of mneA on a plasmid (Fig. 2B). To determine whether the manganese sensitivity was the result of iron starvation caused by manganese-dependent repression of iron transport genes or by competition with iron for transport into the cell, the cells were grown overnight in medium containing up to 50 ␮M MnCl2 with or without the addition of 100 ␮M FeSO4. Iron suppressed the manganese sensitivity of the mneA mutant in medium containing up to 20 ␮M MnCl2 (Fig. 3), suggesting that the effect was related to reduced iron availability. Metal sensitivity of the mneA mutant. Our initial testing did not determine whether the metal sensitivity of the mneA mutant was specific to manganese or whether it included other metals as well. We tested the sensitivity of the V. cholerae wild type and mneA mutant strains with various metals by observing the inhibition of growth of a bacterial lawn around sterile disks infused with a metal solution (Table 3). The zone of inhibition around the disk containing MnCl2 was approximately 11 mm for the wild type and 24 mm for mneA, showing significant sensitivity of the mneA mutant to manganese in this assay. In contrast, we found that the sensitivity of the mneA mutant was the same as that of the wildtype strain to nickel, copper, zinc, vanadium, aluminum, chromium, cobalt, and cadmium solutions (Table 3). Both strains


jb.asm.org

2813

Fisher et al.

µM Mn 0 5 10 20 40 50

1.6

OD650

1.4 1.2

WT mneA WT + Mn mneA + Mn

300

ng/109 bacteria

1.8

1

* 200

** *

100

0.8 0.6

0

0.4

Fe

Zn

FIG 4 The mneA mutant accumulates manganese when grown in the presence

0.2 0

WT

WT+Fe

mneA

mneA+Fe

FIG 3 High iron suppresses the high-manganese growth defect of mneA. Cultures of wild-type O395 and the mneA mutant were grown with aeration in LB medium with various concentrations of MnCl2, with or without addition of 100 ␮M FeSO4. The OD650 of the cultures was measured after 18 h of growth at 37°C.

overgrew the disk infused with molybdenum. Molybdenum is transported through anion channels (31) and would not be expected to use the MneA transporter. Measurement of intracellular cation levels. The increased sensitivity of the mneA mutant to high manganese concentrations suggested that it accumulated high levels of intracellular manganese in the presence of elevated environmental manganese. To test this, we used ICP-MS to measure selected intracellular metal concentrations in the wild-type and the mneA mutant strains grown in LB medium with or without supplementation with 100 ␮M MnCl2 (Fig. 4). During growth in LB medium, the intracellular manganese level was similar between the wild type and the mneA mutant. In medium supplemented with manganese, the wild type exhibited an approximate 7.5-fold increase in intracellular concentration of manganese compared to that in unsupplemented medium, while the increase in the mneA mutant was greater than 45-fold in the same comparison. Thus, the mneA mutant was unable to regulate intracellular manganese levels and maintain manganese homeostasis under these conditions. Intracellular iron concentrations also were measured and found to be approximately 2-fold reduced in the wild type grown in high manganese relative to that grown in LB medium alone, while in the mneA TABLE 3 Sensitivity of the V. cholerae mneA mutant to various metals compared to that of the wild typea Mean diameter ⫾ SD (mm) for: Metal (metal salt, concn)

Wild type

mneA mutant

Manganese (MnCl2, 100 mM) Nickel (NiCl2, 100 mM) Copper (CuSO4, 100 mM) Zinc (ZnSO4, 100 mM) Vanadium (VCl3, 1 M) Aluminum (AlCl3·6H2O, 1 M) Chromium (CrCl3, 1 M) Cobalt (CoCl2, 100 mM) Cadmium (CdCl2, 100 mM) Molybdenum (Na2MoO4, 100 mM)

11 ⫾ 0 11 ⫾ 1 9 ⫾ 0.6 9 ⫾ 0.6 15 ⫾ 2 14 ⫾ 1.2 15 ⫾ 0 18 ⫾ 0.6 24 ⫾ 1.2 0

24 ⫾ 1.7 11 ⫾ 1 9⫾0 9 ⫾ 0.6 15 ⫾ 1 14 ⫾ 0.6 14 ⫾ 0.6 18 ⫾ 1.5 22 ⫾ 1.2 0

a

Solutions of the indicated metal salts were spotted onto plates seeded with V. cholerae. The diameter of the zone of inhibition was measured after overnight incubation.

2814

Mn

jb.asm.org

of high manganese. Cultures of the wild-type and mneA mutant strains were grown in LB medium with or without the addition of 100 ␮M MnCl2 for 2.5 h. Cells were washed once with saline and then digested for 4 h at 80°C in 50% nitric acid. Digested samples were dried, resuspended in 2% trace metal grade nitric acid, and subjected to ICP-MS analysis. The total concentrations of manganese, iron, and zinc were measured. Data presented are the means and standard deviations from three analyses per 109 bacteria. One-way analysis of variance (ANOVA) statistical analysis was performed for each metal: *, P ⬍ 0.05; **, P ⬍ 0.01. Comparisons were made between all strains under each condition for each metal, but significance brackets were omitted for clarity.

mutant, iron was reduced approximately 4-fold in high manganese. The cause of this effect is unknown, but it might be due in part to the binding of manganese to the regulatory protein Fur, which would repress expression of iron acquisition genes (32, 33). Zinc concentrations did not vary significantly between the strains grown with or without the presence of excess manganese, suggesting that the mneA mutation does not cause a generalized defect in metal homeostasis. H2O2 sensitivity. Because Mn and Fe play roles in sensitivity and resistance to oxidative stress, we measured the sensitivity of the mneA mutant to H2O2. The mneA mutant showed a small, but significant, increase in resistance to oxidative stress induced by hydrogen peroxide. Mean and standard deviation values for the zone of growth inhibition for the mneA mutant (27.0 ⫾ 1.2 mm) differed significantly (P ⬍ 0.01, t test) from that for the wild type (31.3 ⫾ 1.0 mm). This may be a result of both the reduced amount of intracellular iron that can cause oxidative damage and the increased Mn available for the Mn-dependent superoxide dismutase. Manganese regulation of mneA. If mneA has a role in exporting excess manganese, it is likely that its expression is regulated by manganese, and we therefore examined the effects of increased manganese on the amount of mneA mRNA. A culture of wild-type V. cholerae was grown to mid-log phase and then divided. Manganese was added to one of the cultures at a final concentration of 1 mM, and the cultures were incubated for an additional 30 min. The amounts of mneA mRNA were compared in the samples grown with and without added manganese by qRT-PCR. The level of mneA mRNA increased 2.6- ⫾ 0.3-fold in relative expression (n ⫽ 3) following growth in the presence of manganese, suggesting that mneA expression is positively regulated by manganese. Characterization of mneA suppressors. We observed that, during growth of the mneA mutant on manganese gradient plates, isolated colonies were found at a manganese concentration inhibitory to the rest of the culture. We tested six of these colonies and confirmed their resistance to increased levels of manganese by restreaking the colonies on LB agar containing 50 ␮M MnCl2. PCR analysis confirmed that the mneA mutation was still present,




Ec mntP

Ec mntP Ec mntP/ pMneA

Ec WT

Vc mneA/ pMneA

Vc WT

Ec mntP/ pMneA

Ec WT

Vc mneA/ pMneA

Vc WT

Vc mneA

Vc mneA

LB

LB + Mn

FIG 5 MneA suppresses the growth defect of an mntP mutant. The E. coli (Ec) mntP mutant and the V. cholerae (Vc) mneA mutant were transformed with a plasmid encoding MneA or with the plasmid vector alone. The indicated strains were streaked onto an LB agar plate (A) or an LB agar plate containing 500 ␮M MnCl2 (B). Plates were incubated overnight at 37°C and assessed for growth.

suggesting that the strains had acquired a suppressor mutation. One of the toxic effects of increased intracellular manganese is the binding of manganese to the iron-binding regulatory protein Fur, causing misregulation of iron acquisition genes and other regulatory defects. Growth in high manganese has been used to select for fur mutations in E. coli, Salmonella, and other species (34). To test whether our suppressor strains contained fur mutations, the fur gene from each of the suppressor mutants was PCR amplified and sequenced. Five of the suppressor strains had different, independent mutations in the coding sequence of the fur gene. The sixth suppressor did not have a mutation in the fur gene, suggesting that additional genes play a role in the response to high manganese levels. To check for other mutations that may influence iron homeostasis, the gene encoding the small, regulatory RNA RyhB (35) was sequenced from all six suppressors and found to match exactly with that of the parental strain, O395. mneA suppresses a mutation in an E. coli manganese export gene, mntP. MntP is a putative manganese exporter in E. coli (19). MneA and MntP have no sequence similarity, but like the mneA mutant, the mntP mutant exhibited accumulation of intracellular manganese and growth inhibition when excess manganese was present in the medium. If MneA functions as a manganese export protein, we predicted that V. cholerae mneA would suppress the manganese sensitivity of the E. coli mntP mutant. As expected, wild-type E. coli grew well on LB agar containing 0.5 M manganese, but the mntP mutant did not grow under the same conditions (Fig. 5). Providing mneA on a plasmid allowed growth of the E. coli mntP mutant and the V. cholerae mneA mutant (Fig. 5). The ability of mneA to functionally substitute for mntP suggests that these proteins may have a similar function. DISCUSSION

To gain information about manganese homeostasis in V. cholerae, we screened a V. cholerae library for genes conferring resistance to high manganese. In this screen, we identified mneA, encoding a putative manganese export protein. Evidence for the export function of MneA includes poor growth of the mneA mutant in high manganese, together with accumulation of extremely high levels of intracellular manganese in the mutant under those conditions. Deletion of mneA also resulted in a slight but significant decrease in hydrogen peroxide sensitivity. Further, mneA suppressed the manganese sensitivity of an E. coli mntP mutant. MntP functions


in manganese export, and the ability of mneA to substitute for mntP suggests that it also encodes a manganese exporter. The control of both import and export functions is critical to maintaining proper intracellular levels of essential metals. High levels of manganese can inhibit cell growth through mismetalation of enzymes and disruption of their function (7). Many bacteria regulate manganese transport genes via a repertoire of metalresponsive transcription factors such as MntR or Mur. Although mneA was regulated in response to manganese, V. cholerae lacks an identifiable homolog of MntR, a transcriptional regulator. Interestingly, a yybP/ykoY manganese-responsive riboswitch is present upstream of E. coli mntP (36, 37), and a very similar structural element is also present upstream of V. cholerae mneA. In E. coli, this riboswitch binds manganese to induce a conformational change in the mRNA that exposes the start codon, leading to increased translation. Additionally, elements upstream of the E. coli riboswitch contribute to increased transcription in the presence of manganese (37). This suggests that there are independent transcriptional and translational effects of manganese on the expression of mntP. Although we do not yet have evidence for translational control of mneA through its predicted riboswitch, our observation that mneA mRNA levels are increased by manganese is consistent with the transcriptional regulation observed for mntP, and it is possible that mneA is similarly regulated at both the transcriptional and translational level by manganese. The yybP/ ykoY riboswitch upstream of mneA is the only regulatory element identified thus far for this gene in V. cholerae. Extensive searches for Fur boxes and other regulatory elements in this region have not yielded results, and work is continuing to elucidate the regulation of mneA. To date, no homologs of the manganese importers MntH and Sit have been identified in V. cholerae (38; C. R. Fisher, unpublished results). Recently, however, the protein encoded by the V. cholerae gene VC1688 was found to have 39% sequence identity with the manganese importer MntX of Ruegeria nubinhibens, and the R. nubinhibens gene was shown to suppress the growth defect of a sitA mutant in the related strain R. pomeroyi during growth in 10 ␮M manganese (16). VC1688 is annotated as an ORF of unknown function in V. cholerae, and although it is regulated by Fur in response to the level of available iron (10, 11), it does not appear to function in iron acquisition (34; E. Peng, unpublished results). Fur regulation of manganese transporter genes has been observed


jb.asm.org

2815

Fisher et al.

in other organisms (8, 9), which is consistent with VC1688 functioning in manganese transport. However, a mutant defective in VC1688 has the wild-type phenotype on Mn gradient plates (data not shown), suggesting that it has no, or a subtle, effect on Mn homeostasis in V. cholerae. V. cholerae lives in a variety of environmental habitats from fresh water to brackish sediments, as well as in the human host. The concentration of available metal ions may vary across a broad range between these environments. At the mouth of the Ganges River where it joins the Bay of Bengal, an area in which the bacteria are often found, the levels of Mn can vary from approximately 1 ␮M in the surface waters to ⬎5 mM in sediments in this area (39). The bacteria must be able to control the intracellular concentration of Mn and other metal ions in each environment and adapt quickly to changes. There is significant available information about the homeostasis of iron (40, 41) and, to a lesser extent, of zinc (42) in V. cholerae. In contrast, there is little information on the biology of manganese in V. cholerae. We show here for the first time that manganese homeostasis is an essential and regulated process in V. cholerae. Our data suggest that manganese export plays a critical role in maintaining the manganese balance in the cell and may represent the primary mechanism by which V. cholerae copes with manganese toxicity.

9.

10.

11.

12.

13.

14.

15.

ACKNOWLEDGMENTS

16.

We thank Laura Runyen-Janecky for the gift of strain UR003, the Keio Collection for the strain JW5830, and Alexandra Mey for critical reading of the manuscript. We also thank Nathaniel R. Miller of the Jackson School of Geological Sciences for expert ICP-MS analysis and advice on experimental protocols. This work was supported by National Institutes of Health grant AI091957 to S.M.P.

17.

18.

FUNDING INFORMATION This work, including the efforts of Shelley M. Payne, was funded by HHS | National Institutes of Health (NIH) (AI091957).

19.

REFERENCES 1. Taylor RK, Miller VL, Furlong DB, Mekalanos JJ. 1987. Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin. Proc Natl Acad Sci U S A 84:2833–2837. http://dx.doi .org/10.1073/pnas.84.9.2833. 2. Morris JG, Acheson D. 2003. Cholera and other types of vibriosis: a story of human pandemics and oysters on the half shell. Clin Infect Dis 37:272– 280. http://dx.doi.org/10.1086/375600. 3. Ali M, Lopez AL, You YA, Kim YE, Sah B, Maskery B, Clemens J. 2012. The global burden of cholera. Bull World Health Organ 90:209A⫺218A. http://dx.doi.org/10.2471/BLT.11.093427. 4. Porcheron G, Garénaux A, Proulx J, Sabri M, Dozois CM. 2013. Iron, copper, zinc, and manganese transport and regulation in pathogenic Enterobacteria: correlations between strains, site of infection and the relative importance of the different metal transport systems for virulence. Front Cell Infect Microbiol 3:90. http://dx.doi.org/10.3389/fcimb.2013.00090. 5. Anjem A, Varghese S, Imlay JA. 2009. Manganese import is a key element of the OxyR response to hydrogen peroxide in Escherichia coli. Mol Microbiol 72:844 – 858. http://dx.doi.org/10.1111/j.1365-2958.2009 .06699.x. 6. Imlay JA. 2014. The mismetallation of enzymes during oxidative stress. J Biol Chem 289:28121–28128. http://dx.doi.org/10.1074/jbc .R114.588814. 7. Martin JE, Waters LS, Storz G, Imlay JA. 2015. The Escherichia coli small protein MntS and exporter MntP optimize the intracellular concentration of manganese. PLoS Genet 11:e1004977. http://dx.doi.org/10.1371 /journal.pgen.1004977. 8. Kehres DG, Janakiraman A, Slauch JM, Maguire ME. 2002. Regulation of Salmonella enterica serovar Typhimurium mntH transcription by

2816

jb.asm.org

20. 21. 22.

23. 24. 25.

26.

27. 28.

H2O2, Fe2⫹, and Mn2⫹. J Bacteriol 184:3151–3158. http://dx.doi.org/10 .1128/JB.184.12.3151-3158.2002. Ikeda JS, Janakiraman A, Kehres DG, Maguire ME, Slauch JM. 2005. Transcriptional regulation of sitABCD of Salmonella enterica serovar Typhimurium by MntR and Fur. J Bacteriol 187:912–922. http://dx.doi.org /10.1128/JB.187.3.912-922.2005. Mey AR, Wyckoff EE, Kanukurthy V, Fisher CR, Payne SM. 2005. Iron and Fur regulation in Vibrio cholerae and the role of fur in virulence. Infect Immun 73:8167– 8178. http://dx.doi.org/10.1128/IAI.73 .12.8167-8178.2005. Davies BW, Bogard RW, Mekalanos JJ. 2011. Mapping the regulon of Vibrio cholerae ferric uptake regulator expands its known network of gene regulation. Proc Natl Acad Sci U S A 108:12467–12472. http://dx.doi.org /10.1073/pnas.1107894108. Makui H, Roig E, Cole ST, Helmann JD, Gros P, Cellier MF. 2000. Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol Microbiol 35:1065–1078. http://dx.doi.org/10.1046/j.1365-2958.2000.01774.x. Kehres DG, Janakiraman A, Slauch JM, Maguire ME. 2002. SitABCD is the alkaline Mn2⫹ transporter of Salmonella enterica serovar Typhimurium. J Bacteriol 184:3159 –3166. http://dx.doi.org/10.1128/JB.184.12 .3159-3166.2002. Patzer SI, Hantke K. 2001. Dual repression by Fe2⫹-Fur and Mn2⫹-MntR of the mntH gene, encoding an NRAMP-like Mn2⫹ transporter in Escherichia coli. J Bacteriol 183:4806 – 4813. http://dx.doi.org/10.1128/JB.183 .16.4806-4813.2001. Papp-Wallace KM, Maguire ME. 2006. Manganese transport and the role of manganese in virulence. Annu Rev Microbiol 60:187–209. http://dx.doi .org/10.1146/annurev.micro.60.080805.142149. Green RT, Todd JD, Johnston AWB. 2013. Manganese uptake in marine bacteria; the novel MntX transporter is widespread in Roseobacters, Vibrios, Alteromonadales and the SAR11 and SAR116 clades. ISME J 7:581–591. http://dx.doi.org/10.1038/ismej.2012.140. Veyrier FJ, Boneca IG, Cellier MF, Taha M-K. 2011. A novel metal transporter mediating manganese export (MntX) regulates the Mn to Fe intracellular ratio and Neisseria meningitidis virulence. PLoS Pathog 7:e1002261. http://dx.doi.org/10.1371/journal.ppat.1002261. Li C, Tao J, Mao D, He C. 2011. A novel manganese efflux system, YebN, is required for virulence by Xanthomonas oryzae pv. oryzae. PLoS One 6:e21983. http://dx.doi.org/10.1371/journal.pone.0021983. Waters LS, Sandoval M, Storz G. 2011. The Escherichia coli MntR miniregulon includes genes encoding a small protein and an efflux pump required for manganese homeostasis. J Bacteriol 193:5887–5897. http://dx .doi.org/10.1128/JB.05872-11. Daskaleros PA, Payne SM. 1987. Congo red binding phenotype is associated with hemin binding and increased infectivity of Shigella flexneri in the HeLa cell model. Infect Immun 55:1393–1398. Runyen-Janecky L, Dazenski E, Hawkins S, Warner L. 2006. Role and regulation of the Shigella flexneri Sit and MntH systems. Infect Immun 74:4666 – 4672. http://dx.doi.org/10.1128/IAI.00562-06. Henderson DP, Payne SM. 1993. Cloning and characterization of the Vibrio cholerae genes encoding the utilization of iron from haemin and haemoglobin. Mol Microbiol 7:461– 469. http://dx.doi.org/10.1111/j .1365-2958.1993.tb01137.x. Wang RF, Kushner SR. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195–199. http://dx.doi.org/10.1016/0378-1119(91)90366-J. Wyckoff EE, Mey AR, Leimbach A, Fisher CF, Payne SM. 2006. Characterization of ferric and ferrous iron transport systems in Vibrio cholerae. J Bacteriol 188:6515– 6523. http://dx.doi.org/10.1128/JB.00626-06. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389 –3402. http: //dx.doi.org/10.1093/nar/25.17.3389. Altschul SF, Wootton JC, Gertz EM, Agarwala R, Morgulis A, Schäffer AA, Yu Y-K. 2005. Protein database searches using compositionally adjusted substitution matrices. FEBS J 272:5101–5109. http://dx.doi.org/10 .1111/j.1742-4658.2005.04945.x. Claros MG, von Heijne G. 1994. TopPred II: an improved software for membrane protein structure predictions. Bioinformatics 10:685– 686. http://dx.doi.org/10.1093/bioinformatics/10.6.685. Petersen TN, Brunak S, von Heijne G, Nielsen H. 2011. SignalP 4.0:




29. 30.

31. 32. 33.

34. 35.

36.

37.

38.

discriminating signal peptides from transmembrane regions. Nat Methods 8:785–786. http://dx.doi.org/10.1038/nmeth.1701. Demaegd D, Colinet A-S, Deschamps A, Morsomme P. 2014. Molecular evolution of a novel family of putative calcium transporters. PLoS One 9:e100851. http://dx.doi.org/10.1371/journal.pone.0100851. Demaegd D, Foulquier F, Colinet A-S, Gremillon L, Legrand D, Mariot P, Peiter E, Van Schaftingen E, Matthijs G, Morsomme P. 2013. Newly characterized Golgi-localized family of proteins is involved in calcium and pH homeostasis in yeast and human cells. Proc Natl Acad Sci U S A 110: 6859 – 6864. http://dx.doi.org/10.1073/pnas.1219871110. Grunden AM, Shanmugam KT. 1997. Molybdate transport and regulation in bacteria. Arch Microbiol 168:345–354. http://dx.doi.org/10.1007 /s002030050508. Mills SA, Marletta MA. 2005. Metal binding characteristics and role of iron oxidation in the ferric uptake regulator from Escherichia coli. Biochemistry (Mosc) 44:13553–13559. http://dx.doi.org/10.1021/bi0507579. Sheikh MA, Taylor GL. 2009. Crystal structure of the Vibrio cholerae ferric uptake regulator (Fur) reveals insights into metal co-ordination. Mol Microbiol 72:1208 –1220. http://dx.doi.org/10.1111/j.1365-2958 .2009.06718.x. Hantke K. 1987. Selection procedure for deregulated iron transport mutants (fur) in Escherichia coli K 12: fur not only affects iron metabolism. Mol Gen Genet 210:135–139. http://dx.doi.org/10.1007/BF00337769. Mey AR, Craig SA, Payne SM. 2005. Characterization of Vibrio cholerae RyhB: the RyhB regulon and role of ryhB in biofilm formation. Infect Immun 73:5706 –5719. http://dx.doi.org/10.1128/IAI.73.9.5706 -5719.2005. Barrick JE, Corbino KA, Winkler WC, Nahvi A, Mandal M, Collins J, Lee M, Roth A, Sudarsan N, Jona I, Wickiser JK, Breaker RR. 2004. New RNA motifs suggest an expanded scope for riboswitches in bacterial genetic control. Proc Natl Acad Sci U S A 101:6421– 6426. http://dx.doi.org /10.1073/pnas.0308014101. Dambach M, Sandoval M, Updegrove TB, Anantharaman V, Aravind L, Waters LS, Storz G. 2015. The ubiquitous yybP-ykoY riboswitch is a manganese-responsive regulatory element. Mol Cell 57:1099 –1109. http: //dx.doi.org/10.1016/j.molcel.2015.01.035. Heidelberg JF, Eisen JA, Nelson WC, Clayton RA, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Umayam L, Gill SR, Nelson KE, Read TD, Tettelin H, Richardson D, Ermolaeva MD, Vamathevan J, Bass S, Qin H, Dragoi I, Sellers P, McDonald L, Utterback T, Fleishmann RD, Nierman WC, White O, Salzberg SL, Smith HO, Colwell RR,


39. 40. 41. 42.

43. 44. 45. 46. 47.

48.

49.

50.

Mekalanos JJ, Venter JC, Fraser CM. 2000. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406:477– 483. http://dx.doi.org/10.1038/35020000. Ajmal M, Khan MA, Nomani AA. 1987. Monitoring of heavy metals in the water and sediments of the Ganga River, India. Water Sci Technol 19:107–117. Wyckoff EE, Mey AR, Payne SM. 2007. Iron acquisition in Vibrio cholerae. Biometals 20:405– 416. http://dx.doi.org/10.1007/s10534-006-9073-4. Payne SM, Mey AR, Wyckoff EE. 2016. Vibrio iron transport: evolutionary adaptation to life in multiple environments. Microbiol Mol Biol Rev 80:69 –90. http://dx.doi.org/10.1128/MMBR.00046-15. Sheng Y, Fan F, Jensen O, Zhong Z, Kan B, Wang H, Zhu J. 2015. Dual zinc transporter systems in Vibrio cholerae promote competitive advantages over gut microbiome. Infect Immun 83:3902–3908. http://dx.doi .org/10.1128/IAI.00447-15. Mekalanos JJ. 1983. Duplication and amplification of toxin genes in Vibrio cholerae. Cell 35:253–263. http://dx.doi.org/10.1016/0092-8674(83)90228-3. Gardner EW, Lyles ST, Lankford CE. 1964. A comparison of virulence of Vibrio cholerae strains for the embryonated egg. J Infect Dis 114:412– 416. http://dx.doi.org/10.1093/infdis/114.5.412. Lawlor KM, Daskaleros PA, Robinson RE, Payne SM. 1987. Virulence of iron transport mutants of Shigella flexneri and utilization of host iron compounds. Infect Immun 55:594 –599. Hanahan D. 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166:557–580. http://dx.doi.org/10.1016/S0022 -2836(83)80284-8. Figurski DH, Helinski DR. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci U S A 76:1648 –1652. http://dx.doi.org/10.1073 /pnas.76.4.1648. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640 – 6645. http://dx.doi.org/10.1073/pnas .120163297. Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H. 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2:2006.0008. Staskawicz B, Dahlbeck D, Keen N, Napoli C. 1987. Molecular characterization of cloned avirulence genes from race 0 and race 1 of Pseudomonas syringae pv. glycinea. J Bacteriol 169:5789 –5794.


jb.asm.org

2817

Identification of a lacZ gene in Vibrio cholerae.

Characterization of tryptophanase from Vibrio cholerae.

Purification and characterization of a novel hemagglutinin from Vibrio cholerae.

Lipid A mutants of Vibrio cholerae: isolation and partial characterization.

Characterization of the RstB2 protein, the DNA-binding protein of CTXϕ phage from Vibrio cholerae.

Homology of TcpN, a putative regulatory protein of Vibrio cholerae, to the AraC family of transcriptional activators.

Identification of the vibriobactin receptor of Vibrio cholerae.

Characterization of the Vibrio cholerae VolA surface-exposed lipoprotein lysophospholipase.

Outer Membrane Vesicle-Mediated Export of Processed PrtV Protease from Vibrio cholerae.

Characterization of 3 Megabase-Sized Circular Replicons from Vibrio cholerae.

antitoxin systems in Vibrio parahaemolyticus.

Chromosome segregation in Vibrio cholerae.

Letter: Isolation of Vibrio cholerae.

Identification of genes induced in Vibrio cholerae in a dynamic biofilm system.

Characterization of lipid A and polysaccharide moieties of the lipopolysaccharides from Vibrio cholerae.

Characterization of a human cytomegalovirus 1.6-kilobase late mRNA and identification of its putative protein product.

Identification and Characterization of a Putative Chemotaxis Protein, CheY, from the Oral Pathogen Campylobacter rectus.

Characterization of a periplasmic thiol:disulfide interchange protein required for the functional maturation of secreted virulence factors of Vibrio cholerae.

Induction of melanin biosynthesis in Vibrio cholerae.

Chlorine and survival of "rugose" Vibrio cholerae.

Characterization and Genetic Variation of Vibrio cholerae Isolated from Clinical and Environmental Sources in Thailand.

Identification and Initial Characterization of Prophages in Vibrio campbellii.

Dynamics in genome evolution of Vibrio cholerae.

Siderophore production by Vibrio cholerae.