Developmental and Comparative Immunology 50 (2015) 9–18

Contents lists available at ScienceDirect

Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i

Identification, expression pattern and functional characterization of As-MyD88 in bacteria challenge and during different developmental stages of Artemia sinica Tong Qin a, Xinxin Zhao a, Hong Luan a, Huazhong Ba a, Lei Yang a, Zhenegmin Li a, Lin Hou a,*, Xiangyang Zou b,** a b

College of Life Sciences, Liaoning Normal University, Dalian 116081, China Department of Biotechnology, Dalian Medical University, Dalian, 116044, China

A R T I C L E

I N F O

Article history: Received 18 November 2014 Revised 20 November 2014 Accepted 19 December 2014 Available online 30 December 2014 Keywords: Artemia sinica MyD88 Gene expression pattern Development Bacterial infection

A B S T R A C T

Myeloid differentiation factor 88 (MYD88), a key adapter protein in Toll-like receptor signaling, affects the immune response and the formation of the dorsal–ventral axis. Here, the 1555bp full-length cDNA of MyD88 from Artemia sinica (As-MyD88) was obtained. Molecular characterization revealed that the sequence includes an 1182bp open reading frame encoding a predicted protein of 393 amino acids. The predicted protein contains a death domain in the N-terminus, and box1 and 2 motifs of the TIR domain in the C-terminus. Real-time quantitative PCR, Western blotting and immunohistochemistry were used to determine the expression level, protein production and location of As-MYD88 during embryonic development and bacterial challenge. The highest expression level during embryonic development was at the 0h and 5h stages of A. sinica. As-MYD88 was remarkably upregulated after bacterial challenge. Our results suggested that As-MYD88 plays a vital role in response to bacterial challenge, and during post-diapause embryonic development of A. sinica. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Myeloid differentiation factor 88 (MyD88) is a key adapter protein associated with the intracellular roles of IL-1R and Toll. It has been proposed that MYD88 should be classified in the signal transduction molecule family, which has an immunomodulatory function (Hultmark, 1994; Lord et al., 1990). Wesche et al. (1997) showed that MYD88 mediated the combination of IRAK and receptors by combining with the intracellular region of IRAK and IL-1R. MYD88 has also been linked to the Toll-like receptor (TLR) signaling pathway (Medzhitov et al., 1998; Muzio et al., 1998). During innate

Abbreviations: MyD88, myeloid differentiation factor 88; As-MyD88, myeloid differentiation factor 88 gene from Artemia sinica; As-MYD88, myeloid differentiation factor 88 protein from Artemia sinica; ORF, open reading frame; DD, death domain; PCR, polymerase chain reaction; RT-qPCR, real-time quantitative PCR; UTR, untranslated region; PAMPs, pathogen-associated molecular patterns; PRRs, pattern recognition receptors; IL-1R, interleukin-1 receptor; TLR, Toll-like receptor; TIR, Toll/ Il-1 receptor homologous region; IRAK, IL-1 receptor-associated kinase; IMD, immune deficiency; PBS, phosphate buffer saline. * Corresponding author. College of Life Sciences, Liaoning Normal University, No.1, Liushu South Street, Ganjingzi District, Dalian 116081, China. Tel.: +86 0411 85827082; fax: 86 411 85827069. E-mail address: [email protected] (L. Hou). ** Corresponding author. Department of Biotechnology, Dalian Medical University, Dalian 116044, China, Tel.: +86 0411 86110296; fax: 86 411 86110350. E-mail address: [email protected] (X. Zou). http://dx.doi.org/10.1016/j.dci.2014.12.013 0145-305X/© 2014 Elsevier Ltd. All rights reserved.

immunity, the only defense system in invertebrates, the process of identifying the highly conserved structure of an intrusive antigen, which is known as pathogen-associated molecular patterns (PAMPs), is heavily dependent on specific receptors on the cell membrane termed pattern recognition receptors (PRRs) (Janeway and Medzhitov, 2002). Among these PRRs, Toll receptors and/or TLRs are considered as canonical pathogen-recognition molecules in metazoans (Li et al., 2012; Medzhitov et al., 1997). Toll was initially recognized as a protein closely related to the Drosophila embryo anterior– posterior axis development (Belvin and Anderson, 1996). The Toll signaling pathway is also necessary for antimicrobial peptide expression in organisms resistant to fungi and Gram-positive bacteria (Hoffmann et al., 1999; Lemaitre et al., 1997). The MYD88 protein comprises three functional regions: the N-terminal death domain (DD), the intermediate domain and the C-terminal Toll/interleukin-1 receptor (TIR) homology domain. The TIR domain includes three typical box motifs, namely box1, box2 and box3 (Qiu et al., 2007). The TIR may trigger a series of signal responses through interactions with other proteins having TIR domains (Janssens et al., 2002; Luke et al., 2007). The DD domain’s main responsibility is the recruitment of downstream signaling molecules that have a death domain to enable signal transduction. The intermediate region’s function remains unknown; NF-κB was activated when MYD88’s DD sequence and intermediate domain were expressed simultaneously (Linehan et al., 2000; Xu and Shen, 2007).

10

T. Qin et al./Developmental and Comparative Immunology 50 (2015) 9–18

Although the Toll pathway is more sensitive to the amount of MYD88 during the immune response than during dorsoventral development, MYD88 plays a crucial role in the dorsoventral patterning of the embryo through the Toll pathway (Charatsi et al., 2003). In insects like Drosophila melanogaster, the formation of the embryonic dorsoventral axis is regulated by the Toll/Dorsal pathway (Morisato and Anderson, 1995), which is homologous to the vertebrate Toll/IL-1 receptor signaling pathway (Belvin and Anderson, 1996). MyD88 is a new member of the dorsal group of genes. Prior to initiating signaling, MYD88 is stably associated via death domain interactions. In the pre-signaling state, the intracellular TIR domain of Toll must be inaccessible to MYD88 binding. Absence of MYD88 disrupts ventral or lateral cuticle formation in Drosophila (Sun et al., 2004). In addition, MYD88 activity is required for normal Spemann organizer formation, implying an essential role for maternal Toll/ IL-1 receptors in Xenopus axis formation (Prothmann et al., 2000). Artemia sinica (Phylum Arthropoda, Class Crustacea, Subclass Branchiopoda, Order Anostaca, Family Artemiidae, Genus Artemia) is distributed widely in the hyperosmotic environment of salt pools and salt lakes in China (Jiang et al., 2007). It is a commercially important crustacean because of its use as a main food resource to feed newborn fish in aquaculture. Its resistance to high salinity, drying, low temperature, pressure and other adverse environments stress has led to Artemia being widely used in various fields, ranging from developmental biology to evolution and ecology (Janeway and Medzhitov, 2002), especially in innate immune research, where it is widely studied as an animal model. The role of the MyD88 gene during early embryonic development and immune response of A. sinica remains unknown. We investigated its expression pattern, expression location and potential roles during different developmental stages of A. sinica, and during the immune response bacterial challenge. Therefore, in the present study, the As-MyD88 cDNA from A. sinica was cloned and its expression level during early embryonic development and in response to bacterial challenge was analyzed by real-time qPCR. In addition As-MYD88 was expressed in E. coli by a prokaryotic expression plasmid, pET-28a. Meanwhile, the protein yield of AsMYD88 and the location of its protein expression were investigated using Western blotting and whole mount immunohistochemistry, respectively. Our aim was to further understand the role of MYD88 during early embryonic development and during the immune response of A. sinica.

2. Materials and methods 2.1. Animal preparation A. sinica cysts were harvested from the salt lake of Yuncheng in Shanxi Province, China, and stored at −20 °C in the dark. The cysts were hatched in axenic seawater and allowed to propagate under these conditions: a temperature of 28 °C, salinity of 28‰, and light intensity of 1000 lx. A. sinica has five main developmental stages: the gastrula stage of Artemia sinica cysts (0h), umbrella stage (5~10h), the nauplius stage (15h~20h), the metanauplius stage (40h~3d), the pseudoadult stage (5d~7d) and the adult stage (10d). Animal samples (about 50 mg) were collected at different periods of development (0, 5, 10, 15, 20 and 40 h, and 3, 5, 7 and 10 d) for subsequent experiments. For the bacteria stimulation assay, nauplius stage A. sinica (20h) cultured in axenic sea water for 24h were used as the control group, and nauplius stage A. Sinica (20h) in the experimental groups were maintained at seawater with Halophilic Gram-negative bacterium Vibrio harveyi and Gram-positive bacteria Micrococcus lysodeikticus for 24h respectively. The bacterium concentrations were 104cellsL-1, 105 cellsL- and 106 cellsL-1.

Fig. 1. (A) Nucleotide sequences and deduced amino acid sequences of the MyD88 gene in A. sinica. The numbering of the nucleotide and amino acid sequences is shown to the left and right, respectively. The green letters represent the start codon; the pink letters represent the end codon; the red line represent the death domain (DD); the green line represents the box2 sequence motif of the TIR; and the blue line represent the box1sequence motif of the TIR. (B) Domain analysis of the putative As-MYD88 protein. The mature protein includes a death domain (DD) and a low complexity region in the N-terminus.

2.2. Cloning of As-MyD88 cDNA Total RNA from A. sinica cysts (0h) was extracted using TRIzolA+ (Tiangen, Beijing, China) in accordance with the manufacturer’s instructions. An oligo (dT) primer and MLV reverse transcriptase (Takara, Dalian, China) then reverse transcribed the RNA into cDNA. We obtained the gene library of A. franciscana from the GenBank, and related homologous sequence of MyD88 gene (GenBank Sequence Number: ES523270.1) was identified by bioinformatics

T. Qin et al./Developmental and Comparative Immunology 50 (2015) 9–18

Table 1 Oligonucleotide primers used in this study. Primer

Sequence(5’-3’)

Direction

MyD88F MyD88R 3’MyD88 Outer 3’MyD88 Inner 5’MyD88 RT-MyD88F RT-MyD88R β-actinF β-actinR ORF-MyD88F ORF-MyD88R

ACAAGTCCATCTGCCGTTAT GTGCCTTTACACCCGTTCTC CGGGAGTATCAAGTGTTCGC AGCAGCGCCAGAGACAGAAA CGGCATGTAGGACCCTCTCTCCCGTAC CTAACCCGAAGTTGGATGCTCT CAGATGGACTTGTTTGCTCGC GTGTGACGATGATGTTGCGG GCTGTCCTTTTGACCCATTCC CCGGAATTCATGAAAACTAACCCGAAGTTGGATG ACGCGTCGACTTAAAATGCAGGCGATCGAGGCGC

Forward Reverse Forward Forward Reverse Forward Reverse Forward Reverse Forward Reverse

11

analysis. Based on the gene sequence (ES523270.1) of A. franciscana, Primer Premier 5.0 was used to design the specific primers (MyD88F, MyD88R; Table 1), which were synthesized by Takara (Dalian, China). The PCR reaction conditions were as follows: initial incubation at 94 °C for 5 min; followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, and elongation at 72 °C for 1 min; with a final incubation at 72 °C for 10 min. The PCR products were separated on 1.0% agarose/TAE gels containing ethidium bromide, purified from the gel and subjected to DNA sequenced by Takara. An EST sequence of MyD88 was obtained. The full sequence of the mRNA transcript for MyD88 was obtained by 5’-3’ rapid amplification of cDNA ends (RACE) using the 3’ RACE Core Set Ver.2.0 (Takara) and the SMART™ RACE cDNA Amplification Kit (Clontech, Dalian, China), following the manufacturers’ instructions. The

Fig. 2. Protein sequence alignment of As-MYD88 and MYD88 proteins from 14 other species from GenBank. The sequences and their accession numbers are as follows: PtMYD88, Pan troglodytes, NM_001130463; HsMYD88, Homo sapiens, U70451; OaMYD88, Ovis aries, NM_001166183; RnMYD88, Rattus norvegicus, NM_198130; MumMYD88, Mus musculus, NM_010851; GgMYD88, Gallus gallus, EF544486; IpMYD88, Ictalurus punctatus, NM_001200278; DrMYD88, Danio rerio, NM_212814; SpMYD88, Strongylocentrotus purpuratus, XM_775570.2; DpMYD88, Daphnia pulex, JQ856503.1; MgMYD88, Mytilus galloprovincialis, JX112712.1; CqMYD88, Culex quinquefasciatus, XM_001868586.1; DmMYD88, Drosophila melanogaster, NM_136635.3; AsMYD88, Artemia sinica, JF965014; SfMYD88, Spodoptera frugiperda, JQ687409.1. The reed area indicates the sequence of the death domain (DD); the green area indicates the box2 sequence motifs of the TIR; and the blue zone indicates the box1 sequence motifs of the TIR.

12

T. Qin et al./Developmental and Comparative Immunology 50 (2015) 9–18

primers used in 5’-3’ RACE (3’MyD88 Outer, 3’MyD88 Inner, 5’MyD88; Table 1) were designed based on the obtained EST fragment of MyD88. The RACE-PCR products were purified, ligated into the pMD-19T vector, and sequenced by Takara. The 3’ and 5’ fragments were spliced together in silico using DNAMAN 6.0.3.48 (Lynnon Biosoft, USA) to obtain the full-length cDNA of MyD88. The nucleotide sequence was submitted to GenBank with the accession number JF965014.1. 2.3. Bioinformatic analysis Bioinformatics analysis of As-MyD88 was performed using software programs on the NCBI website (http://www.ncbi.nlm.nih.gov/). The ORF Finder tool (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to identify the open reading frame. ClustalX2.0, MEGA4.0 and the NCBI online service (http://www.ncbi.nlm.nih.gov/) were used for sequence alignment and phylogenetic analysis. The prosite tools of ExPASy (http://prosite.expasy.org/prosite.html/) and SMART (http://smart.embl-heidelberg.de/) were used to predict the AsMYD88 protein structure and functional domains. The ProtParam tool of ExPASy (http://web.expasy.org/protparam/) was used to predict the molecular weight and theoretical isoelectric point of the protein. The NetPhos 2.0 Server (http://www.cbs.dtu.dk/services /NetPhos/) was used to determine the phosphorylation sites. SignalP4.0 (http://www.cbs.dtu.Dk/services/SignalP/) and TMHMM2.0 (http://www.cbs.dtu.dk/services/TMHMM/) were used to predict the signal peptide and transmembrane regions. Protscale (http://web .expasy.org/protscale/) analyzed the hydrophobicity and hydrophilicity. PsortII (http://psort.hgc.jp/form2.html) was employed to predict the subcellular localization. ClustalX2.0 program, DNAman and the online service of ClustalW2 (http://www.ebi.ac.uk/Tools/msa /clustalw2/) were used to carry out protein multiple sequence alignments among different species. The Neighbor-joining (NJ) method using Clustal X 2.0 and MEGA4.1 software was used for additional phylogenetic analysis. The statistical significance of groups within the phylogenetic tree was evaluated using the bootstrap method with 1,000 replications. 2.4. Expression analysis of As-MyD88 by quantitative real-time qPCR 2.4.1. Expression of As-MyD88 during different developmental stages Total mRNA samples were extracted from A. Sinica at different development time points (0 h, 5 h, 10 h, 15 h, 20 h and 40 h; 3, 5,7 and 10d). The RNA concentration was measured, and then the RNA was reverse-transcribed to cDNA templates at the same concentration. A pair of primers specific for As-MyD88 (RT-MyD88F, RTMyD88R; Table 1) was used to amplify cDNA products. Real-time qPCR was performed in triplicate for each sample using the SYBR Premix Ex Taq (Takara) and Takara detection system, TaKaRa TP800.The reaction conditions were as follows: initial denaturation at 95 °C for 30 s, followed by 40 cycles (95 °C for 5 s, 58 °C for30 s, and 95 °C for 15 s, 60 °C for 30 s). The β-actin gene was used as a normalization control for each starting quantity of RNA (Sun et al., 2007). The β-actin primers are shown in Table 1. The Thermal Cycler Dice Real Time system software (Takara) analyzed the gene expression data, which was quantified using the comparative CT method (2−ΔΔCt method), based on Ct values for both As-MyD88 and β-actin to calculate the fold increase (Schmittgen and Livak, 2008). The data obtained from real-time qPCR analysis were analyzed by least square difference (LSD) and significance was set at P < 0.05, as assessed by a t-test using SPSS 16.0 software. 2.4.2. Expression of As-MyD88 in response of bacterial stimulation Halophilic Gram-negative bacteria Vibrio harveyi and Grampositive bacteria Micrococcus lysodeikticus were inoculated into 1 mL

liquid medium, respectively, and cultivated with shaking for 12h. A blood cell counter plate was used to count the number of bacterial cells. Bacteria were used at three dilutions. The nauplius stage of A. sinica (20 h) was challenged with two kinds of bacteria respectively, which were diluted to 104 cellsL-1, 105 cellsL-1 and 106 cellsL-1, for 24h. Total mRNA was extracted from A. sinica treated with each dilution and reverse transcribed into cDNA. Real-time qPCR was performed on the samples using the primers and reaction conditions detailed in Section 2.4.1. 2.5. Construction of the expression vector pET-28a-MYD88 The complete ORF of As-MyD88 was amplified using primers that added EcoRI and SalI sites to the 5’-and 3’-end. The primers were designed by Primer Premier 5.0 software (ORF-MyD88F, ORFMyD88R; Table 1). The PCR products were cloned into the pMD19-T vector. Both the recombinant plasmid pMD19-T-MYD88 and the pET-28a expression vector were digested with the enzymes EcoRI and SalI. The As-MyD88 DNA was ligated into the pET-28a expression vector using T4 DNA ligase (Takara) at 16 °C overnight. Takara sequenced the recombinant plasmid, pET-28a-MYD88. 2.6. Expression and purification of the recombinant protein from Escherichia coli To facilitate the overexpression of MYD88, the recombinant expression plasmid pET-28a-MYD88 was transformed into E. coli BL21 (DE3). Four different conditions were used to induce the expression of the fusion protein: 1 mM IPTG for 3 h at 37 °C, 1 mM IPTG for 3 h at 30 °C, 0.25 mM IPTG for 3 h at 37 °C, and 0.25 mM IPTG for 3 h at 30 °C. Cells were collected and washed with PBS three times. An aliquot of the products were subjected to SDS-PAGE to find the best induction conditions for large-scale purification. The remainders of the samples were sonicated on ice until the sample was clear. The cell lysate was collected by centrifugation and the supernatant collected for purification of the fusion protein. The cell lysate was resuspended in binding buffer (20 mM Tris-HCl, 50 mM NaCl and 20 mM imidazole), loaded onto an Ni-NTA HisTrapTM HP crude (GE Healthcare) and washed with imidazole elution buffer (20 mM Tris-Hcl, 50 mM Nacl, xm Mimindazole (x = 100, 200, 300, 500) at 1 ml/min. Fractions were collected and examined by SDS-PAGE on a 10% gel. 2.7. Production of polyclonal antibodies Polyclonal antibodies directed against the As-MYD88 recombinant protein were prepared in rabbits. Rabbits were immunized every two weeks by multipoint intradermal injections. For the first immunization, the purified protein (600 μg/ml) was emulsified with an equal volume of Freund’s complete adjuvant. For the three subsequent immunizations, 300 μg/ml purified protein was emulsified with an equal volume of Freund’s in complete adjuvant. The antiserum was collected from whole blood samples by centrifugation at 7000 × g for 5 min, and an enzyme linked immunosorbent assay (ELISA) was used to check the concentration. The specificity of the antibody for the purified protein was determined by Western blotting. The polyclonal antibodies were used for whole mount immunohistochemistry and Western blot assay. 2.8. Whole mount immunohistochemistry For whole mount immunohistochemical studies, polypides were collected in the tubes at different developmental stages (polypides from 0, 5 and 10h were completely dechlorinated with 50% sodium hypochlorite). Heptane and PEM-FA (PIPES 100 mmol/L, MgSO4 1.0 mmol/L, EGTA 2.0 mmol/L, formalde hyde 10% ) fixative

T. Qin et al./Developmental and Comparative Immunology 50 (2015) 9–18

were added and the tube was shaken gently. After fixing, the polypides were resuspended in PBST(1 × PBS, Triton X-100 10%) and sonicated to expose the antigen. The polypides were blocked with hydrogen peroxidase for 30 min, washed with PBST and then incubated with non-specific immune serum of animals for 30 min.The Rabbit anti-MYD88 polyclonal antibody (diluted 1:150 with PBS) was added and incubated overnight at 4 °C. After several washes in PBST, the sample was further incubated with HRP-conjugated Rabbit Anti-Goat IgG (Proteintech, Wuhan, China). Streptavidin peroxidase was added, followed by the AEC reagent. The polypides were then examined under a microscope.

Table 2 Predicted phosphorylation sites in As-MyD88. Name Positon Contexta

Scoreb Name Position Contexta

Scoreb

Ser

0.976 0.997 0.544 0.898 0.519 0.932 0.957 0.968 0.619 0.982 0.903 0.978 0.837 0.994 0.998

0.517 0.630 0.792 0.939 0.955 0.756 0.763 0.639 0.931 0.686

2.9. Western blotting 2.9.1. Protein production of As-MYD88 in different stages of early embryo development Total proteins were extracted from each sample (0, 5, 10, 15, 20, and 40 h; 3 d) using RIPA Lysis Buffer and quantified by the Bradford method (Bradford, 1976). 70 μg of each sample was subjected to fractionation by SDS- PAGE and transferred to PVDF membranes. The membrane was blocked with 5% non-fat powdered milk (Sangon, Shanghai, China) for 1 h at room temperature. Rabbit antiAs-MYD88 polyclonal antibody and GAPDH antibody were diluted 1:200 and 1:500, respectively, with PBST and incubated with the membrane overnight at 4 °C. The membrane was then washed with PBST three times (3 × 10 min), and then incubated with HRPconjugated goat anti-rabbit IgG (Transgen, Beijing, China) antibody for 1 h at 37 °C, followed by washing with PBST three times (3 × 10 min) and PBS once (10 min). The reactive protein bands on the membrane were visualized using the ECL reagent (Transgen) and exposed to an x-ray film in the darkroom. Image gray scale analysis in the Image J software was used to compare the density (equivalent to the intensity) of bands on the Western blot. The expression intensities of As-MYD88 specific bands were normalized against the GAPDH bands.

13

a b

13 16 30 128 140 160 163 164 167 169 172 218 314 316 361

ALRSSVPSP SSVPSPPDI RWLKSGENV LFSISPYLG QLYNSGYPP NNSDSGVSS DSGVSSVRS SGVSSVRSI SSVRSISMF VRSISMFST ISMFSTGQA KSCDSKGEI QSIDSDSCF IDSDSCFDA DQRASMKNP

Thr

Tyr

21 86 93 152 194 87 100 142 291 322

PPDITPMYE RIENTYGRE REGPTCRVL EPDETPEDN AAPETEKDE IENTYGREG VLEEYLNIK YNSGYPPLP YEVDYIVPI FDARYVRLI

The sequences surrounding the phosophorylation sites. The likelyhood of the phosphorlation site being real.

cytoplasmic, 8.7% mitochondrial, 4.3% Golgi, 4.3% cytoskeletal, 4.3% peroxisomal and 4.3% plasma membrane. Multiple protein sequence alignment revealed the conserved amino acid sequences between MYD88 proteins from different species, especially in the DD (from residues 38 to 131 in A. sinica) and C-terminal box domains (box2 from residues 143 to 159 and box1 from residues 219 to 221 in A. sinica), which supported the results of a previous study (Fig. 2). Bioinformatic analysis suggested that As-MyD88 had the highest sequence homology with MYD88 from Artemia franciscana. The MyD88 sequences of 15 species were selected to construct a phylogenetic tree (Bootstrapping = 1000). Analysis of the phylogenetic tree (Fig. 3) showed that there were four main clusters: vertebrates (the mammalian cluster contained Pan troglodytes, Homo sapiens, Ovis aries, Rattus norvegicus and Mus musculus; the lower vertebrates cluster comprised Gallus gallus, Danio rerio and Ictalurus punctatus), invertebrate mollusca and echinoderm (Mytilus

2.9.2. Protein production analysis of As-MYD88 in response to bacterial stimulation A. sinica cysts were hatched in 28‰ salinity seawater for 20h and then treated with the halophilic Gram-negative bacteria Vibrio harveyi and Gram-positive bacteria Micrococcus lysodeikticus, separately, which were diluted to 104 cellsL-1, 105 cellsL-1 and 106 cellsL-1 for 24h. Total proteins were extracted from each sample and quantified. The expression trend of As-MYD88 in response to increasing bacteria stimulation concentration was assayed by Western blotting, as described in Section 2.9.1, with GAPDH as the control. 3. Results 3.1. Cloning and bioinformatic analysis of As-MyD88 A 1555bp full-length cDNA of As-MyD88 was obtained (GenBank accession number: JF965014) with an open reading frame of 1182bp, and 123bp 5’- and 250bp 3’-untranslated regions. The putative As-MYD88 protein contained 393 amino acids, had a calculated molecular mass of 42 kDa and a pI of 5.21. The protein has a predicted N-terminal death domain (DD), an intermediate domain and two C-terminal sequence motifs that are important for TIR (Fig. 1A and 1B). As-MYD88 has 25 phosphorylation sites, including 15 Serine phosphorylation sites, five Threonine phosphorylation sites, five Tyrosine phosphorylation sites and no threshold phosphorylation sites (Table 2). Analysis of hydrophobicity and hydrophilicity showed that As-MYD88 is a hydrophilic protein. As-MYD88 was predicted to have no signal peptide and no transmembrane domains. The predicted subcellular localizations of As-MYD88 were 47.8% nuclear, 26.1%

Fig. 3. A phylogenetic tree of aligned amino acid sequences of As-MYD88 and MYD88 from 14 other species. The neighbor-joining phylogenetic tree was constructed on the basis of the sequences from A. sinica and from those obtained from GenBank, utilizing the sequence analysis tool MEGA 4.1. The sequences and their accession numbers are the same as in the legend of Fig. 2. A rhombus (◆) indicates As-MYD88 from Artemia sinica. Bootstrap = 1000.

14

T. Qin et al./Developmental and Comparative Immunology 50 (2015) 9–18

Fig. 4. The expression of As-MyD88 in different development stages of A. sinica. The expression level at 0h stage of As-MyD88 was set as the control. The x-axis represents different development stages (0h to 7d). The y-axis represents the expression level of MyD88 relative to the 0h stage. Data are means ± SD of triplicate experiments. Significant differences relative to the control are indicated with asterisks (*) (P < 0.05).

galloprovincialis and Strongylocentrotus purpuratus), invertebrate arthropod diptera (including Daphnia pulex, Drosophila melanogaster and Culex quinquefasciatus), and invertebrate arthropod crustacean and Lepidoptera (Artemia sinica and Spodoptera frugiperda). The phylogenetic tree showed that the evolutionary kinship between Artemia sinica and other species is distant.

developmental stages of A. sinica (Fig. 8). The results showed that As-MYD88 was expressed at the upper side of the developing cyst membrane surface of A. sinica at 0h (Fig. 8A1). A. sinica entered the umbrella stage at 5h, As-MYD88 was expressed at the lower side, and formed a pattern of corresponding to the head and tail (Fig. 8B1). At 10h, the upper side of the embryo was located out of the cyst shell, and the lower side of embryo was narrow and connected with the cyst shell. As-MYD88 was expressed in the upper side at positions that developed into flank of A. sinica (Fig. 8C1). A. sinica entered the nauplius at 15h, where the embryo was completely out of the cyst shell. As-MYD88 was expressed in the head, chest and tail (Fig. 8D1). At 20h, As-MYD88 was mainly expressed in the head and chest, as well as the roots of the worm appendages, while the expression in the tail had gradually disappeared (Fig. 8E1). A. sinica developed into metanauplius at 40h, the body length had not increased, but As-MYD88 was mainly expressed in the head and chest, with weak expression in the tail (Fig. 8F1). At 3d, As-MYD88 was mainly expressed in the head and chest (Fig. 8G1). A. sinica developed into pseudoadult after 5d, the parasite abdomen began to form sub-sections, and As-MYD88 showed slight expression in sections of the abdomen, but was mainly expressed in the head and chest (Fig. 8H1 and 8I1). When the parasite reached 10d, A. sinica developed into adult stage. The expression of As-MYD88 was significantly different from other periods: it was only expressed at a low level in the appendages (Fig. 8J1).

3.2. Expression analysis of As-MyD88 by quantitative real-time qPCR Real-time qPCR analysis was used to detect the expression levels of As-MyD88 during different stages of development (Fig. 4). The data showed that the expression level of As-MyD88 was high at 0h and 5h but decreased at 10h and stayed at a low level throughout the rest of the developmental stages. Real-time qPCR was then used to determine the response of MyD88 to bacterial stimulation. Under stimulation by Gram-positive bacteria, when the bacteria concentration decreased from 10 6 cellsL -1 to 10 cellsL -1 , the relative expression of As-MyD88 decreased to a similar level to the control group (Fig. 5A). When stimulated by Gram-negative bacteria, AsMyD88 was expressed at a level under stimulation with 106 cellsL1, but was expressed at control levels at low bacterial concentrations (105cellsL-1and 104 cellsL-1) (Fig. 5B). 3.3. Purification and expression of As-MYD88 protein The 1555bp open reading frame was obtained by digestion with restriction enzymes EcoRI and SalI (Fig. 6) and cloned into an expression vector for recombinant expression in E. col. There was no significant difference in expression quantity under the four different induction conditions (Fig. 7A), so we adopted the relative low stringency condition of 0.25 mM IPTG at 30 °C for further research. SDS-PAGE analysis showed that the recombinant protein was present in the insoluble fraction (Fig. 7B). After purification and dialysis, a relatively pure protein was obtained (Fig. 7C). 3.4. Expression location analysis by whole mount immunohistochemistry Whole mount Immunohistochemistry was performed to determine the spatial expression pattern of As-MYD88 at different

Fig. 5. (A) The relative expression of As-MyD88 stimulated by gram-positive bacteria. The expression level at sterile seawater was set as the control. The x-axis represents Different bacteria concentration of gram-positive bacteria (106cellsL-1 to 104 cellsL-1). The y-axis represents the expression level of As-MyD88 relative to the level in sterile seawater. Data are means ± SD of triplicate experiments. Significant differences between treatment and control groups are indicated with asterisks (*) (P < 0.05) (B) The relative expression of As-MyD88 stimulated by gram-negative bacteria. The expression level at sterile seawater was set as the control. The x-axis represents different bacteria concentration of gram-negative bacteria (106cellsL-1 to 104 cellsL-1). The y-axis represents the expression level of As-MyD88 relative to the level in sterile seawater. Data are means ± SD of triplicate experiments. Significant differences between treatment and control groups are indicated with asterisks (*) (P < 0.05).

T. Qin et al./Developmental and Comparative Immunology 50 (2015) 9–18

15

Under stimulation by Gram-positive bacteria, the protein production of As-MYD88 decreased with decreasing bacteria concentration, although it remained higher than the control group (Fig. 10). When stimulated by Gram-negative bacteria, As-MYD88 was highly expressed under the high bacterial concentration but showed control level expression under lower bacterial concentrations (Fig. 11). 4. Discussion

Fig. 6. Electrophoretic analysis of recombinant plasmid pMD19-T-MYD88. Lane M: 100–2000 bp DNA size markers. Lane 1: double digestion of recombinant plasmid pMD19-T-MYD88 with EcoRI and SalI restriction enzymes.

3.5. Protein production of As-MYD88 by Western blotting in the developing early embryo under bacterial stimulation The expression pattern of As-MYD88 at different developmental stages in A. sinica showed an initial high expression at 0h, a sight decrease at 5 h and a dramatic reduction at 10h, after which the expression remained low and relatively stable (Fig. 9).

In this study, the 1555bp full-length cDNA of As-MyD88 was obtained, which contained an ORF of 1182bp encoding a deduced protein of 393 amino acids. Sequence analysis revealed two conserved domains: the N-terminal DD and C-terminal TIR domain (Fornarino et al., 2011), which was consistent with MYD88 proteins from other species (Shizuo and Kiyoshi, 2004). The TIR contained two sites : box1 and box2, which play a key role in the TIR function. The difference between As-MYD88 and MYD88 in other species is that the TIR family in other species includes three critical sites: box1, box2 and box3 (Medzhitov et al., 1997; Miggin and O’Neill, 2006); A. sinica lacks box 3, and box1 and box2’s positions are reversed. There is no report about the function of box3 in signal transduction. However, amino acid point mutations had no affect on the structure and signal transduction function (Janssens and Beyaert, 2002; Qiu et al., 2007). Except in TLR3 (Biswas and Tergaonkar, 2007), there is a “BB loop” that is exposed at the surface of the three-dimensional structure of box2 of the TIR domain (Ohnishi et al., 2009). The “BB loop” is formed by Lys and Arg in the RD**PG sequence motif of box2. It plays an important role in the processing of downstream proteins collected by the TIR domain (Yao et al., 2009). Compared with other species, As-MYD88 proteins lacks box3 sequence motif, but the “BB loop” sequence motif is 11 amino acids longer at C-terminus (Ohnishi et al., 2009), which perhaps increases the signal transduction function and perhaps performs the function of box3. Moreover, transmembrane analysis shows that As-MYD88 is a non-membrane protein, which correlates with its

Fig. 7. (A) The expression of Artemia sinica MYD88 recombinant protein. M: protein markers from 30 to 200 kDa. Lanes 1–4 show the expression of As-MYD88 recombinant protein from four induction treatments (1 mM IPTG at 37 °C, 1 mM IPTG at 30 °C, 0.25 mM IPTG at 37 °C, and 0.25 mM IPTG at 30 °C, respectively). Lane 5 indicates total proteins from non-induced cells. Lane 6 shows total proteins from induced cells harboring pET-28a (control). (B) Detection of the solubility of As-MYD88 recombinant protein. Lane 1: total As-MYD88 recombinant protein. Lane 2: soluble fraction of the lysate from induced cells harboring pET-28a-MYD88. Lane 3: insoluble fraction of the lysate from induced cells harboring pET-28a-MYD88. (C) Purification of As-MYD88 recombinant protein. M: protein markers from 30 to 200 kDa. Lane 1 shows unpurified, induced As-MYD88 recombinant protein and Lane 2 shows purified As-MYD88.

16

T. Qin et al./Developmental and Comparative Immunology 50 (2015) 9–18

Fig. 8. Immunohistochemistry of Artemia sinica in different developmental stages.A1–J1: experimental groups, A–J: control groups. (A) 0 h, the gastrula stage of Artemia; (B and C) 5h~10h, umbrella stage; (D and E) 15h and 20h, nauplius stage; (F and G) 40h and 3d, metanaupius stage; (H and I) 5d and 7d, pseudoadult stage; (J) 10d, adult stage. Arrows indicate positive signal regions.

function. As-MYD88 is a soluble cytoplasmic protein; therefore, it is present downstream of transmembrane proteins Toll and Tolllike receptor protein in the Toll/TRs signaling pathway (Hayashi et al., 2001). The phylogenetic analysis showed that its evolutionary relationship with other species is not close, and may be related to the structural features of its C-terminus. This may explain its stronger stress resistance than other species. Immunohistochemical studies showed high expression of AsMYD88 in the side that will develop into the head and chest of A. sinica at 0h. In addition, As-MYD88 was expressed in the upside and downside of the cysts at 5h to 10h. This phenomenon suggested that As-MYD88 plays an important role in the development of the

embryonic dorsal–ventral axis. A. sinica develop into the nauplius stage at 15h to 20h, and develop into the metanauplius stage at 40h; appendages also develop at this stage. Thus, As-MYD88 may be involved in breast appendage formation on account of its expression in the primordial head and chest appendage. The abdominal limbs begin to form at 5d~7d. The expression signals appeared in the ventral limb at this time, which reflected As-MYD88’s regulatory role in embryonic development of A. sinica. The vital organs of A. sinica, such as the digestive gland, are present in the head and chest, and the developmental mechanisms and immune mechanisms of these organs are not perfect at this stage and As-MYD88 may perform its immune function at same time. At 10d, A. sinica enters into the

T. Qin et al./Developmental and Comparative Immunology 50 (2015) 9–18

Fig. 9. (A) The expression of As-MYD88 at different developmental stages of A. sinica detected by western blotting. The intensities of As-MYD88 protein bands were normalized against that of GAPDH. (B) Values are expressed as arbitrary units of relative value. The expression of As-MYD88 at 0h was used as a control, and statistically significant differences are indicated with asterisks (**) for P < 0.01.

adult stage. The various parts of its body segments are mature at this time, and the distribution of As-MYD88 is irregular. Thus, the expression of As-MYD88 may be only related to immunity after A. sinica enters the adult stage. Real-time qPCR showed that the expression of As-MYD88 was significantly high at 0h and 5h. This corresponds to the stage when the resting cysts of A. sinica are in the gastrulation stage of embryonic development. MYD88 is associated with innate immunity and is located upstream of the innate immune signaling pathway; thus, the expression of As-MYD88 may aid resistance to the invasion of unfavorable factors at the vital hatching stage. In addition,

Fig. 10. (A) Western blotting analysis of the expression of As-MYD88 stimulated by Gram-positive bacteria. The band intensities for As-MYD88 were normalized against that GAPDH. (B) Values are expressed as arbitrary units of relative value. The expression of As-MYD88 protein with no bacterial challenge was used as a control, and statistically significant differences are indicated with asterisks (*) for 0.01 < P < 0.05.

17

Fig. 11. (A) Western blotting analysis of the expression of As-MYD88 stimulated by Gram-negative bacteria. The band intensities for As-MYD88 were normalized against that of GAPDH. (B) Values are expressed as arbitrary units of relative value. The expression of As-MYD88 with no bacterial challenge was used as a control, and statistically significant differences are indicated with asterisks (*) for 0.01 < P < 0.05.

in contrast to mammalian TLRs (Wang and Lehmann, 1991), MYD88 can activate two NF-kB-like proteins: DIF and Dorsa1, which are key proteins in the Toll signaling pathway in Drosophila (Rutschmann et al., 2000). The DIF protein regulates the transcription of antimicrobial peptide genes, and is activated by microbial infection. Dorsa1 regulates the development of the embryonic dorsal–ventral axis (Belvin and Anderson, 1996; Rutschmann et al., 2000). As-MYD88 may also act as a maternal gene, whose expression products perform their function at gene regulatory networks’ upstream in embryonic development. As-MYD88 may induce the expression of other genes that control the polarization of the dorsal–ventral axis. At 10h and in the later stages of embryonic development, until entry into the adult stage, the expression levels of MYD88 are stable and low. It estimated that MYD88 maintains the immune functions instead, after regulating the expression of effector genes at 0–5h. The relative stability of their environment may reflect the subtle changes in As-MYD88 expression. Stimulation of A. sinica at the same developmental stage with different concentrations of Gram-positive bacteria showed that the expression levels of As-MYD88 increased as the bacterial concentration increased, which is consistent with the literature (An et al., 2002; Means et al., 1999; Underhill et al., 1999; Visintin et al., 2001; Yoshimura et al., 1999). This suggested that As-MYD88 plays an important role in immunity. When A. sinica at the same developmental stage were stimulated with different concentrations of Gramnegative bacteria, the expression levels of MYD88 changed subtly (Wright, 1999), and increased only if the Gram-negative bacterial concentration was high. In invertebrates, the innate immune system identifies Grampositive bacteria and fungi mainly via the Toll signaling pathways, while the identification of Gram-negative bacteria mainly relies on the IMD pathway. (Parker et al., 2001) Thus, we presume that AsMYD88 is involved in immune resistance to Gram-positive bacteria and fungi. However, if there are too many Gram-negative bacteria in the environment, the Toll signaling pathway or other signaling pathways (Diebold et al., 2004; Hemmi et al., 2000; Ulevitch, et al., 1999) may activate the MYD88 protein or increase its expression. Thus, the different immune regulatory mechanisms may be linked.

18

T. Qin et al./Developmental and Comparative Immunology 50 (2015) 9–18

5. Conclusions For invertebrates, innate immune system is a unique mode to resist the invasion of pathogenic microorganisms due to the absence of a specific immune system, such as those found in vertebrates. Under bacterial challenge, As-MYD88 plays an important role in immunity, and it shows a greater role against Gram-positive bacterial than Gram- negative bacterial. Also MYD88 plays a crucial role in the dorsoventral patterning of the embryo through the Toll pathway in insects. Our study showed that As-MYD88 plays an important role in the gastrulation stage of embryonic development. The study of invertebrate As-MYD88 is of great significance to the understanding of adapter factors involved in the immune response pathway and the formation of the dorsal–ventral axis. The role of AsMYD88 in during early embryonic development and immune response has emerged recently, with convincing evidence of its central role. Though the expression of As-MYD88 at different development stages of A. sinica and under different concentration bacterial challenge was investigated in this study, and the function of As-MYD88 was explained to some extent, more research is needed to unravel the function of MYD88 and in more depth.

Conflict of interest The authors have no conflict of interest to declare.

Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (31272644). We thank anonymous referees for their valuable comments on an earlier version of the manuscript.

References An, H., Yu, Y., Zhang, M., Xu, H., Qi, R., Yan, X., et al., 2002. Involvement of ERK, p38 and NF-kappa B signal transduction in regulation of TLR2, TLR4 and TLR9 gene expression induced by lipopolysaccharide in mouse dendritic cells. J. Immunol. 106, 38–45. Belvin, M.P., Anderson, K.V., 1996. A conserved signaling pathway: the Drosophila Toll-dorsal pathway. Annu. Rev. Cell. Dev. Biol. 12, 393–416. Biswas, S.K., Tergaonkar, V., 2007. Myeloid differentiation factor 88-independent Toll-like receptor pathway: sustaining inflammation or promoting tolerance. Int. J. Biochem. Cell Biol. 39, 1582–1592. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Charatsi, I., Luschnig, S., Bartoszewski, S., Nüsslein-Volhard, C., Moussian, B., 2003. Krapfen/dMyd88 is required for the establishment of dorsoventral pattern in the Drosophila embryo. Mech. Develop. 120, 219–226. Diebold, S.S., Kaisho, T., Hemmi, H., Akira, S., Reise Sousa, C., 2004. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303, 1529–1531. Fornarino, S., Laval, G., Barreiro, L.B., Manry, J., Vasseur, E., Quintana-Murci, L., 2011. Evolution of the TIR-domain-containing adaptors in humans: swinging between constraint and adaptation. Mol. Biol. Evol. 9, 1537–1719. Hayashi, F., Smith, K.D., Ozinsky, A., Hawn, T.R., Yi, E.C., Goodlett, D.R., et al., 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410, 1099–1103. Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., et al., 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408, 740–745. Hoffmann, J.A., Kafatos, F.C., Janeway, C.A., Ezekowitz, R.A., 1999. Phylogenetic perspectives in innate immunity. Science 248, 1313–1318. Hultmark, D., 1994. Macrophage differentiation marker MyD88 is a member of the Toll/IL-1 receptor family. Biochem. Biophys. Res. Commun. 199, 144–184. Janeway, C.A., Jr., Medzhitov, R., 2002. Innate immune recognition. Annu. Rev. Immunol. 20, 197–216. Janssens, S., Beyaert, R., 2002. A universal role for MyD88 in TLR/IL-1R-mediated signaling. Trends Biochem. Sci. 27, 474–482.

Janssens, S., Burns, K., Tschopp, J., Beyaert, R., 2002. Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88. Curr. Biol. 12, 467–471. Jiang, L., Hou, L., Zou, X., Zhang, R., Wang, J., Sun, W., et al., 2007. Cloning and expression analysis of p26 gene in Artemia sinica. Acta Biochem. Biophys. Sin. 39, 351–358. Lemaitre, B., Reichhart, J.M., Hoffmann, J.A., 1997. Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc. Natl. Acad. Sci. U.S.A. 94, 14614–14619. Li, X.C., Zhu, L., Li, L.G., Ren, Q., Huang, Y.Q., Lu, J.X., et al., 2012. A novel myeloid differentiation factor 88 homolog, SpMyD88, exhibiting SpToll-binding activity in the mud crab Scylla paramamosain. Dev. Comp. Immunol. 39, 313–323. Linehan, S.A., Martinez Pomares, L., Gordon, S., 2000. Mannose receptor and scavenger receptor: two macrophage pattern recognition receptors with diverse functions in tissue homeostasis and host defense. Adv. Exp. Med. Biol. 479, 1–14. Lord, K.A., Hoffman-Liebermann, B., Liebermann, D.A., 1990. Nucleotide sequence and expression of a cDNA encoding MyD88, a novel myeloid differentiation primary response gene induced by IL6. Oncogene 5, 1095–1097. Luke, A.J., O’Neill, L.A., Andrew, G.B., 2007. The family of five TIR-domain containing adaptors in Toll-like receptor signaling. Nat. Rev. Immunol. 7, 353–364. Means, T.K., Wang, S., Lien, E., Yoshimura, A., Golenbock, D.T., Fenton, M.J., 1999. Human Toll-like receptors mediate cellular activation by Mycobacterium tuberculosis. J. Immunol. 163, 3920–3927. Medzhitov, R., Preston-Hurlburt, P., Janeway, C.A., Jr., 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388, 394–397. Medzhitov, R., Preston-Hurlburt, P., Kopp, E., Stadlen, A., Chen, C., Ghosh, S., et al., 1998. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol. Cell 2, 253–258. Miggin, S.M., O’Neill, L.A., 2006. New insights into the regulation of TLR signaling. J. Leukoc. Biol. 80, 220–226. Morisato, D., Anderson, K.V., 1995. Signaling pathways that establish the dorsalventral pattern of the Drosophila embryo. Annu. Rev. Genet. 29, 371–399. Muzio, M., Natoli, G., Saccani, S., Levrero, M., Mantovani, A., 1998. The human toll signaling pathway: divergence of nuclear factor kappaB and JNK/SAPK activation upstream of tumor necrosis factor receptor-associated factor 6(TRAF6). J. Exp. Med. 187, 2097–2101. Ohnishi, H., Tochio, H., Kato, Z., Orii, K.E., Li, A., Kimura, T., et al., 2009. Structural basis for the multiple interactions of the MyD88 TIR domain in TLR4 signaling. PNAS 106, 10260–10265. Parker, J.S., Mizuguchi, K., Gay, N.J., 2001. A family of proteins related to Spätzle, the toll receptor ligand, are encoded in the Drosophila genome. Proteins 45, 71–80. Prothmann, C., Armstrong, N.J., Rupp, R.A., 2000. The Toll/IL-1 receptor binding protein MyD88 is required for Xenopus axis formation. Mech. Develop. 97, 85–92. Qiu, L., Song, L., Yu, Y., Xu, W., Ni, D., Zhang, Q., 2007. Identification and characterization of a myeloid differentiation factor 88(MyD88) cDNA from Zhikong scallop Chlamys farreri. Fish Shellfish Immunol. 23, 614–623. Rutschmann, S., Jung, A.C., Hetru, C., Reichhart, J.M., Hoffmann, J.A., Ferrandon, D., 2000. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity 12, 569–580. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time qPCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108. Shizuo, A., Kiyoshi, T., 2004. Functions of Toll-like receptors: lessons from KO mice. C. R. Biol. 327, 581–589. Sun, H., Towb, P., Chiem, D.N., Foster, B.A., Wasserman, S.A., 2004. Regulated assembly of the Toll signaling complex drives Drosophila dorsoventral patterning. EMBO J. 23, 100–110. Sun, P.S., Soderlund, M., Venzon, N.C., Ye, D., Lu, Y., 2007. Isolation and characterization of two actins of the Pacific white shrimp, Litopenaeus vannamei. Mar. Biol. 151, 2145–2151. Ulevitch, R.J., 1999. Toll gates for pathogen selection. Nature 401, 755–756. Underhill, D.M., Ozinsky, A., Hajjar, A.M., Stevens, A., Wilson, C.B., Bassetti, M., et al., 1999. The Toll-like receptor 2 is recruited to macrophage Phagosomes and discriminates between pathogens. Nature 401, 811–815. Visintin, A., Mazzoni, A., Spitzer, J.H., Wyllie, D.H., Dower, S.K., Segal, D.M., 2001. Regulation of Toll-like receptors in human monocytes and dendritic cells. J. Immunol. 66, 249–255. Wang, C., Lehmann, R., 1991. Nanos is the localized posterior determinant in Drosophila. Cell 66, 637–647. Wesche, H., Henzel, W.J., Shillinglaw, W., Li, S., Cao, Z., 1997. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7, 837–847. Wright, S.D., 1999. Toll, a new piece in the puzzle of innate immunity. J. Exp. Med. 189, 605–609. Xu, S.J., Shen, Y.J., 2007. The progress of MyD88, a critical adapter molecule in TLR signaling pathway. J. Tradit. Chin. Med. 25, 2504–2506. Yao, C.L., Kong, P., Wang, Z.Y., Ji, P.F., Liu, X.D., Cai, M.Y., et al., 2009. Molecular cloning and expression of MyD88 in large yellow croaker Pseudosciaena crocea. Fish Shellfish Immunol. l26, 249–255. Yoshimura, A., Lien, E., Ingalls, R.R., Tuomanen, E., Dziarski, R., Golenbock, D., 1999. Cutting Edge: recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via Toll-like receptor 2. J. Immunol. 163, 2382–2386.