Vol. 12, No. 5
MOLECULAR AND CELLULAR BIOLOGY, May 1992, p. 2230-2240 0270-7306/92/052230-11$02.00/0
Identification of a cis-Acting DNA Antisilencer Element Which Modulates Vimentin Gene Expression DENISE M. STOVERt
AND
ZENDRA E. ZEHNER*
Department of Biochemistry and Molecular Biophysics and The Massey Cancer Center, Medical College of Virginia/Virginia Commonwealth University, Richmond, Virginia 23298 Received 19 September 1991/Accepted 10 February 1992
Vimentin is a tissue-specific, developmentally regulated member of the intermediate filament protein family
normally expressed in cells of mesenchymal origin. Transcription factors which recognize specific cis-acting elements of the chicken gene include Sp-1 and the 95-kDa silencer protein which binds to a 40-bp silencer element at -608 (F. X. Farrell, C. M. Sax, and Z. E. Zehner, Mol. Cell. Biol. 10:2349-2358, 1990). In this study, we have identified a region upstream of the silencer element which restores gene activity. This region has been further delineated into two functional subelements of 75 and 260 bp. In transient transfection assays, the 75-bp element overrides the silencer effect of pStkCAT by 100%, while the 260-bp element is about half as active. Neither element affects gene activity when the silencer element is absent. Therefore, these elements do not function as enhancers, but they may serve only to override the silencer element and therefore can be viewed as antisilencers. In addition, the 75-bp element binds a specific 140-kDa protein, as determined by gel mobility shift assays and Southwestern (DNA-protein) blots, the binding site of which has been delineated to a 10- to 17-bp element by DNase I protection experiments. During myogenesis, a direct correlation can be made between the binding efficiency of the 140-kDa protein, the silencer protein, and gene activity in vivo. Genes known to contain a functional silencer element also contain at least one antisilencer element, as determined by sequence identity. Therefore, we have identified an antisilencer element and protein important in the developmental regulation of vimentin gene expression which may be involved in the regulation of other genes.
Vimentin is the type of IFP expressed in cells of mesenchymal origin. In addition, it is the only IFP which deviates from its tissue-specific and developmental pattern of expression (12) (for a review of IFPs, see reference 42). In this context, vimentin can be coexpressed with most IFPs and appears transiently in a variety of developing and differentiated tissues as well as in tissue culture (12). Evidence suggests that the expression pattern of vimentin is varied and complex (11). For example, during early erythropoiesis, both mammalian and avian erythrocytes contain vimentin filaments, but as differentiation proceeds, the mature avian erythrocyte continues to contain vimentin filaments while the mammalian erythrocyte does not (8, 15). Several tumor cells express vimentin even though their embryonic origin is not mesenchymal. For example, a non-hormone-inducible breast cancer cell line (MDA-MB-231) expresses vimentin, whereas a hormone-inducible breast cancer cell line (MCF-7) does not (5, 40). Overall, vimentin's complex expression pattern suggests an intricate regulatory circuit. Previously, vimentin expression has been demonstrated to be induced by serum, platelet-derived growth factor, and phorbol esters (16, 33). The differential expression pattern of the chicken vimentin gene was demonstrated to be dependent on multiple cis-acting elements and trans-acting factors (33, 36). In this case, basal expression has been attributed to a proximal promoter element (-161 to +1 bp) which is functional both in cells which express vimentin (mouse L cell) and in those which do not (MH1Cl) (36). Within this promoter element are five GC boxes (at least three of which are functional in binding Sp-1) (38), an inversely oriented CAAT box, and a poor TATA box. A proximal enhancer element (-321 to -161 bp) increases expression of a 5'-endchloramphenicol acetyltransferase (CAT) construct in mouse L cells, arguing for a tissue-specific enhancer element (36, 37). This same proximal enhancer element contributes
Mediation of tissue-specific, developmentally regulated expression necessitates a complex interplay between multiple cis-acting DNA elements and trans-acting factors. Vimentin, a member of the intermediate filament family, displays both of these patterns of expression, thereby providing an attractive model with which to study the interplay between cis-acting elements and their respective transacting factors. Determination of all regulatory elements, their mechanisms of action, and how they contribute to gene activity is necessary for an understanding of not only of the frequency of vimentin mRNA transcription in any given state, but also of its use as a prototype for other genes exhibiting similar expression patterns. The cellular cytoskeleton is comprised of three filamentous systems, the microtubules (25 nm in diameter), the microfilaments (6 nm), and the intermediate filaments (11 nm). Intermediate-filament proteins (IFPs) are major components of the cellular infrastructure which are thought to anchor both the nucleus and organelles and to maintain cellular compartmentalization as well as cellular morphology (16). IFPs are encoded by a large multigene family, members of which comprise parts of both the cytoskeleton and karyoskeleton. This large multigene family is divided into distinct sequence types: acidic keratins (type I), neutral-basic keratins (type II), desmin, vimentin, and glial fibrillary acidic protein (type III), neurofilaments (type IV), lamins (type V), and the recently described nestin (type VI) (22, 42). Unlike the constituent proteins of microtubules (tubulin) and microfilaments (actin), IFPs are unique in their cell type specificity (42). gene
* Corresponding author. t Present address: Institute of Cancer and Developmental Biology, Syntex Research, Palo Alto, CA 94304.
2230
VIMENTIN DEVELOPMENTAL GENE EXPRESSION
VOL. 12, 1992 to the decrease in vimentin expression during myogenesis in several muscle cell lines (11, 36). Recently, Farrell et al.
have delineated a negative element located 568 bp from the start site of transcription (11). This 40-bp element binds a 95-kDa protein, as determined by gel mobility shift assays (GMSAs), Southwestern (DNA-protein; SW) blots, and DNase I footprinting analysis (11). All vimentin genes studied to date (human, hamster, and chicken) have been shown to contain similar regulatory circuits consisting of a promoter and proximal enhancer elements (33). Both the human and chicken 5'-flanking sequences contain functional silencing elements, i.e., a potential negative element at -853 to -795 bp in the human
5'-flanking sequence and at -607 to -568 bp in the chicken vimentin gene (see Fig. 7). In the human vimentin gene, an element residing at -700 bp has been demonstrated to be responsible for both serum and phorbol ester inducibility. This 48-bp element contains an Sp-1 site flanked by two AP-1/Jun binding sites. The presence of a distal enhancer element in the human vimentin gene prompted an investigation for a yet unidentified distal enhancer element in the 5'-flanking region of the chicken vimentin gene. Previous work suggested that this element resided at least 767 nucleotides upstream of the initiation site for transcription. The notion of such a network of cis-acting elements is not novel, as positive and negative elements have been described for several other genes, including the alpha I protease inhibitor gene (28) and the chicken lysozyme gene (3). In this study, a distal element has been localized upstream of the transcriptional start site. This element is composed of two subelements, a 75-bp and a 260-bp element. Both can overcome vimentin's silencer element. However, the 75-bp element exhibits stronger regulating activity than does the 260-bp element and is the focus of this report. Neither element enhances the transcription of the vimentin promoter or a heterologous thymidine kinase promoter element alone. When the 40-bp negative element is present, these elements serve to override the silencer effect and restore gene activity to presilencer levels. For this reason, they represent a new type of element which we will refer to as an antisilencer element. Moreover, increasing copies of the silencer element require a coordinate increase in the number of antisilencer elements in order to restore reporter gene activity. A specific protein responsible for the activity of the 75-bp element has been identified by GMSAs, SW analysis, and DNase I footprinting protection experiments. In addition, the interplay between the antisilencer and silencer proteins was investigated during myogenesis, when vimentin is differentially expressed. A direct correlation exists between the expression state of vimentin and the binding activities of these two proteins. MATERIALS AND METHODS Cell culture, DNA transfections, and CAT assays. Mouse L cells were grown in Dulbecco modified minimal essential medium supplemented with 10% fetal calf serum, L-glutamine, and antibiotics. Mouse L cells were seeded at 5 x 105 cells per 100-mm dish 24 h prior to transfection. Chimeric
plasmids (15 ,ug) were transfected by the calcium phosphate precipitation method, with slight modifications (14). Precipitates were allowed to absorb to the cells for 24 h and then subjected to a glycerol shock. Twenty-four hours later, cells were harvested and lysates were obtained by repeated freeze-thawing in 250 mM Tris (pH 7.8). Standardization among different transfections was achieved by cotransfect-
2231
ing 3 ,ug of pCMV-f-galactosidase to serve as an internal control (29). CAT assays were performed and analyzed by thin-layer chromatography as described by Gorman et al. (13). Experiments were quantitated by excising the radioactive product and substrate from silica plates and determining their 14C content by liquid scintillation counting (CAT activity). P-Galactosidase activity was assayed in all cultures as described by Nielsen et al. (29). CAT enzyme activity was expressed as picomoles of chloramphenicol acetylated per minute per microgram of protein per unit of 3-galactosidase activity. All values reported for mouse L cells are averages of at least four separate transfections. DNA sequencing. A chicken genomic bacteriophage Charon 4A (clone 1A) containing the vimentin gene plus 5'and 3'-flanking sequences was digested with EcoRI-HindIII to produce a 5' fragment of 837 bp which was subcloned into pUC18 (45). Both strands were sequenced by the method of Sanger et al. (35), with slight modifications, as well as by the method of Maxam and Gilbert (24). Double-stranded sequencing via the method of Sanger et al. (35) was performed by using U.S. Biochemical protocols. The universal primer, primer A (U.S. Biochemical), was used to sequence the noncoding strand, and the reverse primer, M13 reverse primer (Bethesda Research Laboratoties), was used to sequence the coding strand. Three other specific primers, 5'-GGGAGGTGGTGAGATCTCTG-3', 5'-ATGGGAAGCA TCGGAGCCCG-3', and 5'-GATGCTGCACTCTGCACAC CG-3', were synthesized to complete the sequence of the 837-bp piece of DNA. Sequencing gels consisted of 8% acrylamide and 8 M urea in Tris-boric acid-EDTA buffer. Homologies to known DNA sequences present in GenBank were analyzed by the Genetics Computer Group (Madison, Wis.) DNA sequence analysis program. Plasmid constructions. The expression vector p8CAT is a derivative of pEMBL8 (9) in which the Fl origin of replication has been removed and the bacterial CAT gene has been inserted. pcV-767 was cloned into the multicloning site of p8CAT as previously described (36) and includes 823 nucleotides from -767 to +74 (with the initiation start site at +1) of the chicken vimentin gene. The 837-bp 5'-flanking sequence was subcloned into pcV-767 to produce pcV-1604, which contains 1,678 nucleotides from the 5'-flanking region of the chicken vimentin gene. A series of restriction fragments from the 837-bp sequence were subcloned blunt into a unique HindIII site upstream of the silencer element fused to the heterologous herpes simplex virus thymidine kinase promoter in the expression vector ptkCAT (11, 26). Two restriction fragments, EcoRI-AvaII (75 bp) and HaeIII-RsaI (260 bp), were then subcloned blunt into a unique HindIII site of the vector ptkCAT minus the chicken vimentin silencer element. Multiple copies of the 75-bp element were subcloned into the analogous site in front of p2StkCAT and p4StkCAT. The orientation of each subclone was verified by DNA sequencing (35). Footprints and GMSAs were performed with the 837-bp fragment in pUC18. Preparation of nuclear extracts. Nuclear extracts were prepared from mouse L cells, HeLa cells, and various tissues of the chicken embryo (11) as previously described by Dignam et al. (10). HeLa cells were grown to a density of 5 x 105 cells per ml in Spinner flasks. Nuclear extracts were typically obtained from 3 liters of cells. Extracts were fractionated by ammonium sulfate precipitation. The protein of interest was found in the 30 to 70% ammonium sulfate fraction and was desalted on a G-75 column (Sigma Chemical Co.) equilibrated in buffer D (minus KCl). Fractipns were collected, and those containing protein were pooled as
2232
MOL. CELL. BIOL.
STOVER AND ZEHNER
determined by UV absorbance at A280. Crude extracts not subjected to partial purification were adjusted to a final concentration of 0.1 M KCI. Further purification was performed as described below. Extracts were applied to a phosphocellulose column (3 by 5 cm; Whatman Inc.) equilibrated with buffer D minus KCl. The column was washed with 3 column bed volumes of buffer D minus KCl. Protein was eluted from the column with a step gradient of buffer D containing 0.1, 0.2, 0.3, 0.4, and 1.5 M KCl, respectively. Eluted fractions were precipitated with ammonium sulfate and desalted with Centricon 30 concentrators (Amicon) in buffer D. All extracts were stored at -70°C for up to 6 months. GMSAs. A radiolabeled fragment (1 to 2 ng) containing the region -1604 to -1529 of the 5'-flanking region of the chicken vimentin gene was incubated with 0 to 20 ,g of crude nuclear extract or column fractions plus 1 ,ug of poly(dI-dC) in a final buffer concentration of 25 mM Tris (pH 7.5), 6.25 mM MgCl2, 0.5 M EDTA, 50 mM KCl, 0.5 M dithiothreitol, and 10% glycerol in 25 RI. Reaction mixtures were incubated on ice for 15 min and then for 2 min at 22°C. Samples were loaded onto a 5% nondenaturing gel prepared in 0.25 x Tris-boric acid-EDTA. Electrophoresis was carried out for 90 min at 10 V/cm. Gels were dried and placed on XAR film overnight for visualization. Shifted bands were analyzed and quantitated with a densitometer (tungsten lamp, 555 nm). DNase I footprinting. The aforementioned radiolabeled DNA fragment (20 to 25 fmol) containing the 75-bp element was incubated in a 25-,ul solution containing crude nuclear extract or 0.3 M KCl column fractions in a final concentration of 25 mM Tris (pH 7.5), 6.25 mM MgCl2, 0.5 mM EDTA, 50 mM KC1, 0.5 M dithiothreitol, and 10% glycerol. These reaction mixtures were incubated on ice for 15 min and then for 2 min at 22°C. Following incubation, 50 ,u of a 5 mM CaCl2-10 mM MgCl2 solution was added, and the reaction was initiated with the addition of 2.5 [lI of freshly diluted DNase I (5 ,ug/ml; Sigma) for 1 min. Reactions were terminated by the addition of 645 RI of 100% ethanol, 3 ,ug of tRNA, and 50 RI of saturated ammonium sulfate. The DNA was precipitated and loaded onto a 6% polyacrylamide-8 M urea denaturing gel in Tris-boric acid-EDTA buffer and placed on XAR film for visualization. SW blotting. SW blots were performed as described by Singh et al. (39). A 50-,ug portion of nuclear extract or column fraction was diluted 1:1 with sample resuspension buffer (2% sodium dodecyl sulfate [SDS], 100 mM Tris [pH 7.5], 280 mM 2-mercaptoethanol, 20% glycerol, 0.002% pyronin Y), boiled for 5 min, and loaded onto an SDS-10% denaturing gel in a buffer of 50 mM Tris, 400 mM glycine, and 0.1% SDS. Electrophoresis was carried out at a constant current of 25 mA. The gel was incubated for 30 min in gel transfer buffer (25 mM Tris, 190 mM glycine, 20% methanol) and then transferred to nitrocellulose. The transfer of proteins was carried out on a Bio-Rad transfer cell apparatus at 0.5 A for 2 h in gel transfer buffer. Transfer of proteins was monitored by the use of prestained molecular weight standards (Sigma). The nitrocellulose filter was blocked for 1 h at room temperature in a solution containing 5% Carnation nonfat dry milk, TNED (50 mM Tris [pH 7.5], 50 mM NaCl, 0.1 mM EDTA), and 1 mM dithiothreitol for 2 to 5 min and then placed in a sealed plastic bag containing 20 ml of TNED and 106 cpm of probe (either a radiolabeled 40-bp silencer element or a radiolabeled 75-bp antisilencer element) per ml. The nitrocellulose filter was washed two times with TNED
zoo RI
pcV-1604 5
AP-1
-GAATTCATGCCAAGAGCACATATGGCAGCACFGACAACATATGAAAATTATATCCAA-3'
Avail 5' -AACAAGAGGGAACGAGGTCCTGCTTCTTTACCAGAACAAACACCTCCCTGAATTTCAGGG-5' 5' -GCAGAGCATTGTCGGAGTGAAGGATGGCAGTTCGACATGCGTGCCATAAAGGTTTTGTGG-3'
SPfr
Has III
5' -AGCATAAACAAACTGTGGGCCATTAAGAGAAGCAGATGGAGCCAAGTGCACCTTTGG A-31
JLluX
--P-2
S
'-;CTCTGTGACAGCTCCCGGTGTGCAGAGTGCAGCATCTTCCCTCGGGGAGCCGC-3' SP-1
5' -TTACT
GTGCTTTTTGCCTGTGTTCCTTTACTTATCATTGCCATCAGACTT-3'
5 -TAAAC ACCACGGCC
CACCGCCAGACAACCAAAAATCTCCTGCTAC-3' Rsa I
5' -TTCCTTAATAAATATACGGGCTCCGATGCTTCCCATAAGGTACAACACCCGAAGGCAATA-3' rAP-2
5' -GCCAACCCTACTGTGAGCCAACCATACTGGIGAACATCACCTCACTCCTTGTGA-3' OCT
5' -TATCTTGCAGATAfTGCATGTCAGTCACTTTTAGAGCAAGGAAGAAAATGGTGT-3' 5
-CACCAATC&GGTGTGTCAGAGTGGGATTGCTCCCTGGGCGAAcE3rGGGCTTTACG-3'
5' -CTCCTAAGGCAGAGATCTCACCACCTCCCTTACACCACTCTGCATTCTCGCTGAAAAGTG-3' SP-1
AP-2
S5| dGTGTGGGGG+GTTTTTCACTGCTGCTCAGGCTTTT:AAAGTTATGCCACTGCTA-3 t 5' -TTGGTGCCTCTGTCTCGCTGc~
llKind III GCATAGCGCAGTTGCAGTAGAAGCTT-3'
3E=1 se-l
pcV-767
FIG. 1. Nucleotide sequence of an 837-bp fragment from the 5'-flanking region of the chicken vimentin gene. This fragment was obtained from a chicken genomic Charon 4A bacteriophage (clone 1A) and cloned upstream of pcV-767 to produce pcV-1604. Shown is the nucleotide sequence of the 837-bp fragment as determined by the method of Sanger et al. (35), with slight modifications (see Materials and Methods). Common sequences were identified by sequence identity to other known consensus binding sites and are marked as follows: AP-1, SP-1, AP-2, and OCT. Restriction enzymes used to generate various 5'-end-StkCAT constructs as described in Materials and Methods are noted.
for a total of 20 min. The blot was allowed to dry at room temperature and placed on XAR film for visualization. Northern (RNA) analysis. Vimentin mRNA synthesis was analyzed during myogenesis in ovo (30) and in various tissue culture cell lines by Northern analysis (6). Total RNA was isolated by guanidine isothiocyanate extraction. Cells were homogenized with a Dounce homogenizer (10 strokes with a type B pestle) and, after the addition of a 2% Sarkosyl solution, passed through a 23-gauge needle to shear chromosomal DNA. The suspensions were loaded into Beckman Quick Seal tubes, and a 5.7 M CsCl-10 mM EDTA (pH 7.0) solution was layered below each suspension to form a CsCl cushion. Samples were pelleted in a Dupont 65.13 rotor for 16 to 20 h at 40,000 rpm at 25°C. Total RNA (3 ,ug) was then analyzed by using 6.6% formaldehyde-1% agarose gels (23), transferred to nitrocellulose (44), and hybridized with a nick-translated human vimentin cDNA probe (a kind gift from D. Bloch).
RESULTS Our goal in this study was to identify putative upstream elements which can overcome vimentin's silencer elements in the chicken vimentin gene. Ultimately, the identification of all cis-acting elements and their cognate trans-acting factors will be crucial for understanding the complex expression pattern of the vimentin gene. Analysis of the nucleotide sequence. As a first step in the analysis of distal DNA elements, the DNA sequence of an 837-bp upstream fragment (from -1604 to -767) was deter-
VOL. 12, 1992
mined (Fig. 1) and then analyzed for homologies to sequences of known enhancer elements present in GenBank. Of particular interest was a 7-of-8-bp match to the AP-1 consensus sequence. There are other putative AP-1 sequence identities within this 837-bp fragment, but their match is only 5 of 8 bp or less, and the significance, if any, of these elements is presently under investigation. Since the human vimentin gene contains two tandem AP-1 sites which have been demonstrated to be important for serum and phorbol ester induction, we were interested in the possible effects of this single AP-1 site on expression of the chicken vimentin gene. Restriction sites used to fuse various fragments 5' to the CAT reporter gene (p8CAT) are shown. Transient transfection of 5'-flanking chimeric constructs. To determine which elements were required for vimentin gene expression, various 5'-flanking chimeric constructs were generated and transiently transfected into mouse L cells (Fig. 2A). A proximal enhancer element was discovered in the first -321 nucleotides from the start site of transcription which yielded a 59-fold CAT activity over that of the promoterless p8CAT construct (11). As previously reported, this proximal enhancer element is tissue specific and yields high CAT activity only when transfected into cells of mesenchymal origin (36, 37). Construct pcV-608 yielded a CAT activity of only fourfold, a 93% drop from the activity obtained with the proximal enhancer element alone. The silencer element had been previously localized to a specific 40-bp sequence (11), three copies of which have been found within pcV-608, as determined by sequence homology and functional CAT assays (unpublished results). This 40-bp element was also found to bind a silencer protein of 95 kDa, as reported by Farrell et al. (11). When an additional 837-bp fragment is incorporated into pcV-767 to yield pcV-1604, CAT activity increased 32-fold. This represents a 51% increase over the activity for the silencer elements within pcV-608. Therefore, construct pcV-1604 contains an element(s) capable of overcoming the silencing elements located in pcV-608. In defining this upstream element, various restriction fragments from -1604 to -767 were fused to the 40-bp silencer element in the heterologous construct ptkCAT. Each construct was transiently transfected into mouse L cells (Fig. 2B). Construct ptkCAT yielded a CAT activity of 46-fold above that of the promoterless construct p8CAT. As previously reported, a single copy of the 40-bp silencer element (pStkCAT) decreased CAT activity 35% (11). Similarly, in this study, a 35% drop in CAT activity was observed when the 40-bp silencer was present. When the entire 837-bp fragment was fused to the silencer element (p837/pStkCAT), 5/16 of pStkCAT inhibition was relieved (Fig. 2B). Two restriction fragments, a 75-bp element (EcoRl-AvaII) and a HaeIII-HindIII fragment (-1404 to -767) from the 837-bp upstream region, were subcloned 5' to the negative element in pStkCAT. Both of these restriction fragments appeared to overcome the silencer effect of pStkCAT (Fig. 1 and 2B). When the 75-bp element was present in either a sense or antisense orientation, CAT activity was restored to 100% of ptkCAT activity, i.e., 45and 46-fold, respectively. The second restriction fragment, a HaeIII-HindIII fragment (Fig. 1), restored approximately 69% (11/16) of pStkCAT inhibition. Further restriction fragment constructs defined this second element as a 260-bp element within the HaeIII-HindIII fragment (data not shown). To assess whether both the 75- and 260-bp elements were true enhancers, the elements were further subcloned into the
VIMENTIN DEVELOPMENTAL GENE EXPRESSION
Construct
Mouse L cels
FOLD (pmollb-al)
p8CAT pcV-321 pcV-608 pcV-767 pcV-1604
..
..I
-34L_CM
2233
1
59'4)±25 4(9)± 2 4(9)± 2 32()± 2
..
Construct
-7:E
p8CAT ptkCAT I_~~B pStkCAT p837 IStkCAT P75F IStkCAT
.161
Mouse L cells FOLD (pmollb-al) 1
p75 R IStkCAT
pHae-H3 RIStkCAT
C.
G =
Construct
46(8) ±16 30(14)±13 35() ±10 45(s) ±8 46(5s ±9 41(9 ±9 Mouse L cells FOLD (pmollb-gal)
3
p8CAT ptkCAT PP75FItkCAT
46(8) +16 42(6) + 7
E3{CAT
p75RItkCAT
39(6) + 9
P26ORItkCAT P75FI260 F ItkCAT
45(4) + 6 37(4) +11
31 g
1
FIG. 2. Transient transfections of various 5'-flanking chimeric constructs into mouse L cells. CAT activity is expressed as picomoles of ['4C]chloramphenicol acetylated per minute per microgram of protein per unit of P-galactosidase (b-gal) activity. Fold denotes the induction of CAT activity relative to the promoterless p8CAT vector ± standard deviation. The superscript represents the number of assays performed with each construct. The subscripts F and R denotes fragment placement in the sense (F) or antisense (R) orientation as found in the chicken vimentin gene. (A) Transfection of the various chicken vimentin 5'-flanking deletion constructs; (B) transfection of pStkCAT constructs including the silencer element plus various restriction fragments or the entire 837-bp element (see Fig. 1) fused 5' to the silencer element; (C) restriction fragments from Fig. 1 fused to the ptkCAT vector without the silencer element. The 260-bp element extends from the HaeIII site at -1404 to a Rsa site at -1144. HSV tk, herpes simplex virus thymidine kinase promoter.
ptkCAT vector in which the silencer element is absent. When a single copy of the 75-bp element was cloned 5' to the promoter in either a sense or antisense orientation, there was no increase in CAT activity (Fig. 2C). Similarly, multiple copies of the 75-bp element did not increase CAT activity above that of ptkCAT. In fact, increasing copies of the 75-bp element appeared to slightly repress CAT activity (data not shown). The 260-bp element also did not activate gene activity. Next, the 75- and 260-bp elements were subcloned together to assess whether they could function in concert.
2234
STOVER AND ZEHNER
MOL. CELL. BIOL.
A.
1 Competitor Molar Excess 0 Protein (ug)
A
(.X CL 0
2
3
4
5
6
7
8
-
- -
10 50 100 -
5
10 15
10
10 10
15
P
B
40~
U
~i~E
Be
Band A 20
J~[
1
p
pp
IC E
H
* puc 18 5--* 5bp element
kc... I.,
MOLECULAR AND CELLULAR BIOLOGY, May 1992, p. 2230-2240 0270-7306/92/052230-11$02.00/0
Identification of a cis-Acting DNA Antisilencer Element Which Modulates Vimentin Gene Expression DENISE M. STOVERt
AND
ZENDRA E. ZEHNER*
Department of Biochemistry and Molecular Biophysics and The Massey Cancer Center, Medical College of Virginia/Virginia Commonwealth University, Richmond, Virginia 23298 Received 19 September 1991/Accepted 10 February 1992
Vimentin is a tissue-specific, developmentally regulated member of the intermediate filament protein family
normally expressed in cells of mesenchymal origin. Transcription factors which recognize specific cis-acting elements of the chicken gene include Sp-1 and the 95-kDa silencer protein which binds to a 40-bp silencer element at -608 (F. X. Farrell, C. M. Sax, and Z. E. Zehner, Mol. Cell. Biol. 10:2349-2358, 1990). In this study, we have identified a region upstream of the silencer element which restores gene activity. This region has been further delineated into two functional subelements of 75 and 260 bp. In transient transfection assays, the 75-bp element overrides the silencer effect of pStkCAT by 100%, while the 260-bp element is about half as active. Neither element affects gene activity when the silencer element is absent. Therefore, these elements do not function as enhancers, but they may serve only to override the silencer element and therefore can be viewed as antisilencers. In addition, the 75-bp element binds a specific 140-kDa protein, as determined by gel mobility shift assays and Southwestern (DNA-protein) blots, the binding site of which has been delineated to a 10- to 17-bp element by DNase I protection experiments. During myogenesis, a direct correlation can be made between the binding efficiency of the 140-kDa protein, the silencer protein, and gene activity in vivo. Genes known to contain a functional silencer element also contain at least one antisilencer element, as determined by sequence identity. Therefore, we have identified an antisilencer element and protein important in the developmental regulation of vimentin gene expression which may be involved in the regulation of other genes.
Vimentin is the type of IFP expressed in cells of mesenchymal origin. In addition, it is the only IFP which deviates from its tissue-specific and developmental pattern of expression (12) (for a review of IFPs, see reference 42). In this context, vimentin can be coexpressed with most IFPs and appears transiently in a variety of developing and differentiated tissues as well as in tissue culture (12). Evidence suggests that the expression pattern of vimentin is varied and complex (11). For example, during early erythropoiesis, both mammalian and avian erythrocytes contain vimentin filaments, but as differentiation proceeds, the mature avian erythrocyte continues to contain vimentin filaments while the mammalian erythrocyte does not (8, 15). Several tumor cells express vimentin even though their embryonic origin is not mesenchymal. For example, a non-hormone-inducible breast cancer cell line (MDA-MB-231) expresses vimentin, whereas a hormone-inducible breast cancer cell line (MCF-7) does not (5, 40). Overall, vimentin's complex expression pattern suggests an intricate regulatory circuit. Previously, vimentin expression has been demonstrated to be induced by serum, platelet-derived growth factor, and phorbol esters (16, 33). The differential expression pattern of the chicken vimentin gene was demonstrated to be dependent on multiple cis-acting elements and trans-acting factors (33, 36). In this case, basal expression has been attributed to a proximal promoter element (-161 to +1 bp) which is functional both in cells which express vimentin (mouse L cell) and in those which do not (MH1Cl) (36). Within this promoter element are five GC boxes (at least three of which are functional in binding Sp-1) (38), an inversely oriented CAAT box, and a poor TATA box. A proximal enhancer element (-321 to -161 bp) increases expression of a 5'-endchloramphenicol acetyltransferase (CAT) construct in mouse L cells, arguing for a tissue-specific enhancer element (36, 37). This same proximal enhancer element contributes
Mediation of tissue-specific, developmentally regulated expression necessitates a complex interplay between multiple cis-acting DNA elements and trans-acting factors. Vimentin, a member of the intermediate filament family, displays both of these patterns of expression, thereby providing an attractive model with which to study the interplay between cis-acting elements and their respective transacting factors. Determination of all regulatory elements, their mechanisms of action, and how they contribute to gene activity is necessary for an understanding of not only of the frequency of vimentin mRNA transcription in any given state, but also of its use as a prototype for other genes exhibiting similar expression patterns. The cellular cytoskeleton is comprised of three filamentous systems, the microtubules (25 nm in diameter), the microfilaments (6 nm), and the intermediate filaments (11 nm). Intermediate-filament proteins (IFPs) are major components of the cellular infrastructure which are thought to anchor both the nucleus and organelles and to maintain cellular compartmentalization as well as cellular morphology (16). IFPs are encoded by a large multigene family, members of which comprise parts of both the cytoskeleton and karyoskeleton. This large multigene family is divided into distinct sequence types: acidic keratins (type I), neutral-basic keratins (type II), desmin, vimentin, and glial fibrillary acidic protein (type III), neurofilaments (type IV), lamins (type V), and the recently described nestin (type VI) (22, 42). Unlike the constituent proteins of microtubules (tubulin) and microfilaments (actin), IFPs are unique in their cell type specificity (42). gene
* Corresponding author. t Present address: Institute of Cancer and Developmental Biology, Syntex Research, Palo Alto, CA 94304.
2230
VIMENTIN DEVELOPMENTAL GENE EXPRESSION
VOL. 12, 1992 to the decrease in vimentin expression during myogenesis in several muscle cell lines (11, 36). Recently, Farrell et al.
have delineated a negative element located 568 bp from the start site of transcription (11). This 40-bp element binds a 95-kDa protein, as determined by gel mobility shift assays (GMSAs), Southwestern (DNA-protein; SW) blots, and DNase I footprinting analysis (11). All vimentin genes studied to date (human, hamster, and chicken) have been shown to contain similar regulatory circuits consisting of a promoter and proximal enhancer elements (33). Both the human and chicken 5'-flanking sequences contain functional silencing elements, i.e., a potential negative element at -853 to -795 bp in the human
5'-flanking sequence and at -607 to -568 bp in the chicken vimentin gene (see Fig. 7). In the human vimentin gene, an element residing at -700 bp has been demonstrated to be responsible for both serum and phorbol ester inducibility. This 48-bp element contains an Sp-1 site flanked by two AP-1/Jun binding sites. The presence of a distal enhancer element in the human vimentin gene prompted an investigation for a yet unidentified distal enhancer element in the 5'-flanking region of the chicken vimentin gene. Previous work suggested that this element resided at least 767 nucleotides upstream of the initiation site for transcription. The notion of such a network of cis-acting elements is not novel, as positive and negative elements have been described for several other genes, including the alpha I protease inhibitor gene (28) and the chicken lysozyme gene (3). In this study, a distal element has been localized upstream of the transcriptional start site. This element is composed of two subelements, a 75-bp and a 260-bp element. Both can overcome vimentin's silencer element. However, the 75-bp element exhibits stronger regulating activity than does the 260-bp element and is the focus of this report. Neither element enhances the transcription of the vimentin promoter or a heterologous thymidine kinase promoter element alone. When the 40-bp negative element is present, these elements serve to override the silencer effect and restore gene activity to presilencer levels. For this reason, they represent a new type of element which we will refer to as an antisilencer element. Moreover, increasing copies of the silencer element require a coordinate increase in the number of antisilencer elements in order to restore reporter gene activity. A specific protein responsible for the activity of the 75-bp element has been identified by GMSAs, SW analysis, and DNase I footprinting protection experiments. In addition, the interplay between the antisilencer and silencer proteins was investigated during myogenesis, when vimentin is differentially expressed. A direct correlation exists between the expression state of vimentin and the binding activities of these two proteins. MATERIALS AND METHODS Cell culture, DNA transfections, and CAT assays. Mouse L cells were grown in Dulbecco modified minimal essential medium supplemented with 10% fetal calf serum, L-glutamine, and antibiotics. Mouse L cells were seeded at 5 x 105 cells per 100-mm dish 24 h prior to transfection. Chimeric
plasmids (15 ,ug) were transfected by the calcium phosphate precipitation method, with slight modifications (14). Precipitates were allowed to absorb to the cells for 24 h and then subjected to a glycerol shock. Twenty-four hours later, cells were harvested and lysates were obtained by repeated freeze-thawing in 250 mM Tris (pH 7.8). Standardization among different transfections was achieved by cotransfect-
2231
ing 3 ,ug of pCMV-f-galactosidase to serve as an internal control (29). CAT assays were performed and analyzed by thin-layer chromatography as described by Gorman et al. (13). Experiments were quantitated by excising the radioactive product and substrate from silica plates and determining their 14C content by liquid scintillation counting (CAT activity). P-Galactosidase activity was assayed in all cultures as described by Nielsen et al. (29). CAT enzyme activity was expressed as picomoles of chloramphenicol acetylated per minute per microgram of protein per unit of 3-galactosidase activity. All values reported for mouse L cells are averages of at least four separate transfections. DNA sequencing. A chicken genomic bacteriophage Charon 4A (clone 1A) containing the vimentin gene plus 5'and 3'-flanking sequences was digested with EcoRI-HindIII to produce a 5' fragment of 837 bp which was subcloned into pUC18 (45). Both strands were sequenced by the method of Sanger et al. (35), with slight modifications, as well as by the method of Maxam and Gilbert (24). Double-stranded sequencing via the method of Sanger et al. (35) was performed by using U.S. Biochemical protocols. The universal primer, primer A (U.S. Biochemical), was used to sequence the noncoding strand, and the reverse primer, M13 reverse primer (Bethesda Research Laboratoties), was used to sequence the coding strand. Three other specific primers, 5'-GGGAGGTGGTGAGATCTCTG-3', 5'-ATGGGAAGCA TCGGAGCCCG-3', and 5'-GATGCTGCACTCTGCACAC CG-3', were synthesized to complete the sequence of the 837-bp piece of DNA. Sequencing gels consisted of 8% acrylamide and 8 M urea in Tris-boric acid-EDTA buffer. Homologies to known DNA sequences present in GenBank were analyzed by the Genetics Computer Group (Madison, Wis.) DNA sequence analysis program. Plasmid constructions. The expression vector p8CAT is a derivative of pEMBL8 (9) in which the Fl origin of replication has been removed and the bacterial CAT gene has been inserted. pcV-767 was cloned into the multicloning site of p8CAT as previously described (36) and includes 823 nucleotides from -767 to +74 (with the initiation start site at +1) of the chicken vimentin gene. The 837-bp 5'-flanking sequence was subcloned into pcV-767 to produce pcV-1604, which contains 1,678 nucleotides from the 5'-flanking region of the chicken vimentin gene. A series of restriction fragments from the 837-bp sequence were subcloned blunt into a unique HindIII site upstream of the silencer element fused to the heterologous herpes simplex virus thymidine kinase promoter in the expression vector ptkCAT (11, 26). Two restriction fragments, EcoRI-AvaII (75 bp) and HaeIII-RsaI (260 bp), were then subcloned blunt into a unique HindIII site of the vector ptkCAT minus the chicken vimentin silencer element. Multiple copies of the 75-bp element were subcloned into the analogous site in front of p2StkCAT and p4StkCAT. The orientation of each subclone was verified by DNA sequencing (35). Footprints and GMSAs were performed with the 837-bp fragment in pUC18. Preparation of nuclear extracts. Nuclear extracts were prepared from mouse L cells, HeLa cells, and various tissues of the chicken embryo (11) as previously described by Dignam et al. (10). HeLa cells were grown to a density of 5 x 105 cells per ml in Spinner flasks. Nuclear extracts were typically obtained from 3 liters of cells. Extracts were fractionated by ammonium sulfate precipitation. The protein of interest was found in the 30 to 70% ammonium sulfate fraction and was desalted on a G-75 column (Sigma Chemical Co.) equilibrated in buffer D (minus KCl). Fractipns were collected, and those containing protein were pooled as
2232
MOL. CELL. BIOL.
STOVER AND ZEHNER
determined by UV absorbance at A280. Crude extracts not subjected to partial purification were adjusted to a final concentration of 0.1 M KCI. Further purification was performed as described below. Extracts were applied to a phosphocellulose column (3 by 5 cm; Whatman Inc.) equilibrated with buffer D minus KCl. The column was washed with 3 column bed volumes of buffer D minus KCl. Protein was eluted from the column with a step gradient of buffer D containing 0.1, 0.2, 0.3, 0.4, and 1.5 M KCl, respectively. Eluted fractions were precipitated with ammonium sulfate and desalted with Centricon 30 concentrators (Amicon) in buffer D. All extracts were stored at -70°C for up to 6 months. GMSAs. A radiolabeled fragment (1 to 2 ng) containing the region -1604 to -1529 of the 5'-flanking region of the chicken vimentin gene was incubated with 0 to 20 ,g of crude nuclear extract or column fractions plus 1 ,ug of poly(dI-dC) in a final buffer concentration of 25 mM Tris (pH 7.5), 6.25 mM MgCl2, 0.5 M EDTA, 50 mM KCl, 0.5 M dithiothreitol, and 10% glycerol in 25 RI. Reaction mixtures were incubated on ice for 15 min and then for 2 min at 22°C. Samples were loaded onto a 5% nondenaturing gel prepared in 0.25 x Tris-boric acid-EDTA. Electrophoresis was carried out for 90 min at 10 V/cm. Gels were dried and placed on XAR film overnight for visualization. Shifted bands were analyzed and quantitated with a densitometer (tungsten lamp, 555 nm). DNase I footprinting. The aforementioned radiolabeled DNA fragment (20 to 25 fmol) containing the 75-bp element was incubated in a 25-,ul solution containing crude nuclear extract or 0.3 M KCl column fractions in a final concentration of 25 mM Tris (pH 7.5), 6.25 mM MgCl2, 0.5 mM EDTA, 50 mM KC1, 0.5 M dithiothreitol, and 10% glycerol. These reaction mixtures were incubated on ice for 15 min and then for 2 min at 22°C. Following incubation, 50 ,u of a 5 mM CaCl2-10 mM MgCl2 solution was added, and the reaction was initiated with the addition of 2.5 [lI of freshly diluted DNase I (5 ,ug/ml; Sigma) for 1 min. Reactions were terminated by the addition of 645 RI of 100% ethanol, 3 ,ug of tRNA, and 50 RI of saturated ammonium sulfate. The DNA was precipitated and loaded onto a 6% polyacrylamide-8 M urea denaturing gel in Tris-boric acid-EDTA buffer and placed on XAR film for visualization. SW blotting. SW blots were performed as described by Singh et al. (39). A 50-,ug portion of nuclear extract or column fraction was diluted 1:1 with sample resuspension buffer (2% sodium dodecyl sulfate [SDS], 100 mM Tris [pH 7.5], 280 mM 2-mercaptoethanol, 20% glycerol, 0.002% pyronin Y), boiled for 5 min, and loaded onto an SDS-10% denaturing gel in a buffer of 50 mM Tris, 400 mM glycine, and 0.1% SDS. Electrophoresis was carried out at a constant current of 25 mA. The gel was incubated for 30 min in gel transfer buffer (25 mM Tris, 190 mM glycine, 20% methanol) and then transferred to nitrocellulose. The transfer of proteins was carried out on a Bio-Rad transfer cell apparatus at 0.5 A for 2 h in gel transfer buffer. Transfer of proteins was monitored by the use of prestained molecular weight standards (Sigma). The nitrocellulose filter was blocked for 1 h at room temperature in a solution containing 5% Carnation nonfat dry milk, TNED (50 mM Tris [pH 7.5], 50 mM NaCl, 0.1 mM EDTA), and 1 mM dithiothreitol for 2 to 5 min and then placed in a sealed plastic bag containing 20 ml of TNED and 106 cpm of probe (either a radiolabeled 40-bp silencer element or a radiolabeled 75-bp antisilencer element) per ml. The nitrocellulose filter was washed two times with TNED
zoo RI
pcV-1604 5
AP-1
-GAATTCATGCCAAGAGCACATATGGCAGCACFGACAACATATGAAAATTATATCCAA-3'
Avail 5' -AACAAGAGGGAACGAGGTCCTGCTTCTTTACCAGAACAAACACCTCCCTGAATTTCAGGG-5' 5' -GCAGAGCATTGTCGGAGTGAAGGATGGCAGTTCGACATGCGTGCCATAAAGGTTTTGTGG-3'
SPfr
Has III
5' -AGCATAAACAAACTGTGGGCCATTAAGAGAAGCAGATGGAGCCAAGTGCACCTTTGG A-31
JLluX
--P-2
S
'-;CTCTGTGACAGCTCCCGGTGTGCAGAGTGCAGCATCTTCCCTCGGGGAGCCGC-3' SP-1
5' -TTACT
GTGCTTTTTGCCTGTGTTCCTTTACTTATCATTGCCATCAGACTT-3'
5 -TAAAC ACCACGGCC
CACCGCCAGACAACCAAAAATCTCCTGCTAC-3' Rsa I
5' -TTCCTTAATAAATATACGGGCTCCGATGCTTCCCATAAGGTACAACACCCGAAGGCAATA-3' rAP-2
5' -GCCAACCCTACTGTGAGCCAACCATACTGGIGAACATCACCTCACTCCTTGTGA-3' OCT
5' -TATCTTGCAGATAfTGCATGTCAGTCACTTTTAGAGCAAGGAAGAAAATGGTGT-3' 5
-CACCAATC&GGTGTGTCAGAGTGGGATTGCTCCCTGGGCGAAcE3rGGGCTTTACG-3'
5' -CTCCTAAGGCAGAGATCTCACCACCTCCCTTACACCACTCTGCATTCTCGCTGAAAAGTG-3' SP-1
AP-2
S5| dGTGTGGGGG+GTTTTTCACTGCTGCTCAGGCTTTT:AAAGTTATGCCACTGCTA-3 t 5' -TTGGTGCCTCTGTCTCGCTGc~
llKind III GCATAGCGCAGTTGCAGTAGAAGCTT-3'
3E=1 se-l
pcV-767
FIG. 1. Nucleotide sequence of an 837-bp fragment from the 5'-flanking region of the chicken vimentin gene. This fragment was obtained from a chicken genomic Charon 4A bacteriophage (clone 1A) and cloned upstream of pcV-767 to produce pcV-1604. Shown is the nucleotide sequence of the 837-bp fragment as determined by the method of Sanger et al. (35), with slight modifications (see Materials and Methods). Common sequences were identified by sequence identity to other known consensus binding sites and are marked as follows: AP-1, SP-1, AP-2, and OCT. Restriction enzymes used to generate various 5'-end-StkCAT constructs as described in Materials and Methods are noted.
for a total of 20 min. The blot was allowed to dry at room temperature and placed on XAR film for visualization. Northern (RNA) analysis. Vimentin mRNA synthesis was analyzed during myogenesis in ovo (30) and in various tissue culture cell lines by Northern analysis (6). Total RNA was isolated by guanidine isothiocyanate extraction. Cells were homogenized with a Dounce homogenizer (10 strokes with a type B pestle) and, after the addition of a 2% Sarkosyl solution, passed through a 23-gauge needle to shear chromosomal DNA. The suspensions were loaded into Beckman Quick Seal tubes, and a 5.7 M CsCl-10 mM EDTA (pH 7.0) solution was layered below each suspension to form a CsCl cushion. Samples were pelleted in a Dupont 65.13 rotor for 16 to 20 h at 40,000 rpm at 25°C. Total RNA (3 ,ug) was then analyzed by using 6.6% formaldehyde-1% agarose gels (23), transferred to nitrocellulose (44), and hybridized with a nick-translated human vimentin cDNA probe (a kind gift from D. Bloch).
RESULTS Our goal in this study was to identify putative upstream elements which can overcome vimentin's silencer elements in the chicken vimentin gene. Ultimately, the identification of all cis-acting elements and their cognate trans-acting factors will be crucial for understanding the complex expression pattern of the vimentin gene. Analysis of the nucleotide sequence. As a first step in the analysis of distal DNA elements, the DNA sequence of an 837-bp upstream fragment (from -1604 to -767) was deter-
VOL. 12, 1992
mined (Fig. 1) and then analyzed for homologies to sequences of known enhancer elements present in GenBank. Of particular interest was a 7-of-8-bp match to the AP-1 consensus sequence. There are other putative AP-1 sequence identities within this 837-bp fragment, but their match is only 5 of 8 bp or less, and the significance, if any, of these elements is presently under investigation. Since the human vimentin gene contains two tandem AP-1 sites which have been demonstrated to be important for serum and phorbol ester induction, we were interested in the possible effects of this single AP-1 site on expression of the chicken vimentin gene. Restriction sites used to fuse various fragments 5' to the CAT reporter gene (p8CAT) are shown. Transient transfection of 5'-flanking chimeric constructs. To determine which elements were required for vimentin gene expression, various 5'-flanking chimeric constructs were generated and transiently transfected into mouse L cells (Fig. 2A). A proximal enhancer element was discovered in the first -321 nucleotides from the start site of transcription which yielded a 59-fold CAT activity over that of the promoterless p8CAT construct (11). As previously reported, this proximal enhancer element is tissue specific and yields high CAT activity only when transfected into cells of mesenchymal origin (36, 37). Construct pcV-608 yielded a CAT activity of only fourfold, a 93% drop from the activity obtained with the proximal enhancer element alone. The silencer element had been previously localized to a specific 40-bp sequence (11), three copies of which have been found within pcV-608, as determined by sequence homology and functional CAT assays (unpublished results). This 40-bp element was also found to bind a silencer protein of 95 kDa, as reported by Farrell et al. (11). When an additional 837-bp fragment is incorporated into pcV-767 to yield pcV-1604, CAT activity increased 32-fold. This represents a 51% increase over the activity for the silencer elements within pcV-608. Therefore, construct pcV-1604 contains an element(s) capable of overcoming the silencing elements located in pcV-608. In defining this upstream element, various restriction fragments from -1604 to -767 were fused to the 40-bp silencer element in the heterologous construct ptkCAT. Each construct was transiently transfected into mouse L cells (Fig. 2B). Construct ptkCAT yielded a CAT activity of 46-fold above that of the promoterless construct p8CAT. As previously reported, a single copy of the 40-bp silencer element (pStkCAT) decreased CAT activity 35% (11). Similarly, in this study, a 35% drop in CAT activity was observed when the 40-bp silencer was present. When the entire 837-bp fragment was fused to the silencer element (p837/pStkCAT), 5/16 of pStkCAT inhibition was relieved (Fig. 2B). Two restriction fragments, a 75-bp element (EcoRl-AvaII) and a HaeIII-HindIII fragment (-1404 to -767) from the 837-bp upstream region, were subcloned 5' to the negative element in pStkCAT. Both of these restriction fragments appeared to overcome the silencer effect of pStkCAT (Fig. 1 and 2B). When the 75-bp element was present in either a sense or antisense orientation, CAT activity was restored to 100% of ptkCAT activity, i.e., 45and 46-fold, respectively. The second restriction fragment, a HaeIII-HindIII fragment (Fig. 1), restored approximately 69% (11/16) of pStkCAT inhibition. Further restriction fragment constructs defined this second element as a 260-bp element within the HaeIII-HindIII fragment (data not shown). To assess whether both the 75- and 260-bp elements were true enhancers, the elements were further subcloned into the
VIMENTIN DEVELOPMENTAL GENE EXPRESSION
Construct
Mouse L cels
FOLD (pmollb-al)
p8CAT pcV-321 pcV-608 pcV-767 pcV-1604
..
..I
-34L_CM
2233
1
59'4)±25 4(9)± 2 4(9)± 2 32()± 2
..
Construct
-7:E
p8CAT ptkCAT I_~~B pStkCAT p837 IStkCAT P75F IStkCAT
.161
Mouse L cells FOLD (pmollb-al) 1
p75 R IStkCAT
pHae-H3 RIStkCAT
C.
G =
Construct
46(8) ±16 30(14)±13 35() ±10 45(s) ±8 46(5s ±9 41(9 ±9 Mouse L cells FOLD (pmollb-gal)
3
p8CAT ptkCAT PP75FItkCAT
46(8) +16 42(6) + 7
E3{CAT
p75RItkCAT
39(6) + 9
P26ORItkCAT P75FI260 F ItkCAT
45(4) + 6 37(4) +11
31 g
1
FIG. 2. Transient transfections of various 5'-flanking chimeric constructs into mouse L cells. CAT activity is expressed as picomoles of ['4C]chloramphenicol acetylated per minute per microgram of protein per unit of P-galactosidase (b-gal) activity. Fold denotes the induction of CAT activity relative to the promoterless p8CAT vector ± standard deviation. The superscript represents the number of assays performed with each construct. The subscripts F and R denotes fragment placement in the sense (F) or antisense (R) orientation as found in the chicken vimentin gene. (A) Transfection of the various chicken vimentin 5'-flanking deletion constructs; (B) transfection of pStkCAT constructs including the silencer element plus various restriction fragments or the entire 837-bp element (see Fig. 1) fused 5' to the silencer element; (C) restriction fragments from Fig. 1 fused to the ptkCAT vector without the silencer element. The 260-bp element extends from the HaeIII site at -1404 to a Rsa site at -1144. HSV tk, herpes simplex virus thymidine kinase promoter.
ptkCAT vector in which the silencer element is absent. When a single copy of the 75-bp element was cloned 5' to the promoter in either a sense or antisense orientation, there was no increase in CAT activity (Fig. 2C). Similarly, multiple copies of the 75-bp element did not increase CAT activity above that of ptkCAT. In fact, increasing copies of the 75-bp element appeared to slightly repress CAT activity (data not shown). The 260-bp element also did not activate gene activity. Next, the 75- and 260-bp elements were subcloned together to assess whether they could function in concert.
2234
STOVER AND ZEHNER
MOL. CELL. BIOL.
A.
1 Competitor Molar Excess 0 Protein (ug)
A
(.X CL 0
2
3
4
5
6
7
8
-
- -
10 50 100 -
5
10 15
10
10 10
15
P
B
40~
U
~i~E
Be
Band A 20
J~[
1
p
pp
IC E
H
* puc 18 5--* 5bp element
kc... I.,
