Journal of Neuroscience Research 28:217-228 (1991)

Identification of a &-Acting Positive Regulatory Element of the Glial Fibrillary Acidic Protein Gene J. Sarid Division of Neurosurgery, Department of Surgery, Brigham and Women’s Hospital, Harvard Medical School, Boston

Developmental regulation of astrocyte-specific expression of the glial fibrillary acidic protein (GFAP) gene reflects transition of immature glioblasts to mature astrocytes. Described here is the cloning and sequencing of the 5’-flanking region of the mouse GFAP gene. It contains a glial-specific positive cisacting regulatory element that directs preferential expression of a linked reporter gene when transfected into GFAP-positive glioblastoma cells. Sequence analysis of this region revealed the presence of a putative AP-1 binding site, implying a possible role for AP-1 factors in the astroglial-specific expression of the GFAP gene. Key words: GFAP gene, glioblasts, astrocytes INTRODUCTION Neuronal and glial precursor cells in the mammalian central nervous system (CNS) are derived from neuroepithelial cells of the neural tube and their diversification begins in an early stage of embryogenesis (reviewed by McKay, 1989). Cellular differentiation continues during late developmental stages as shown in studies of retina and optic nerve development (Turner and Cepko, 1987; Cepko, 1988; Raff, 1989). Studies of glial differentiation in the rat optic nerve (Raff, 1989) and blast cell differentiation in the rat forebrain septa1 region (Temple, 1989) have demonstrated that these processes are controlled both by intrinsic cellular programs as well as by growth factors secreted by neighboring cells. Cellular commitment and differentiation of the cell lineages in the nervous system, as in all developing tissues, depend ultimately on intricate programs establishing specific patterns of gene expression, which are modulated by networks of both positive and negative regulatory factors (for reviews, see Maniatis et al., 1987; Mitchell and Tjian, 1989; Jones, 1990). Many regulatory factors bind in a sequence specific manner to DNA cis-acting regulatory elements. Identification of cis- and trans-acting factors that regulate brain-specific genes is likely to pro0 1991 Wiley-Liss, Inc.

vide important information about cellular differentiation and maturation in the CNS and to contribute to the understanding of the molecular mechanisms involved in higher brain function. Astroglial cells constitute nearly 40% of the cell population in the CNS and are responsible for the structural, nutritional, developmental, and biochemical support of the neurons. They also play an important role in the CNS response to disease and injury (Fedoroff and Vernadakis, 1986; Kimbelberg and Norenberg, 1989). Glial fibrillary acidic protein (GFAP) represents a specific marker for astroglial cells in the mammalian CNS (Lewis and Cowan, 1985; Kitamura et al., 1987). It is the major component of the intermediate filaments of astrocytes that, together with microtubules and actin microfilaments, constitute the cellular cytoskeleton of these cells. GFAP is developmentally regulated (Levitt et al., 1983; Tardy et al., 1989), and its appearance reflects the transition of immature glioblasts, in which vimentin is the major component of intermediate filaments, to mature astrocytes (Dahl, 1981; Dahl et al., 1981). This study identifies cis-acting astroglial-specific regulatory sequences residing in the 5’-upstream region of the mouse GFAP gene. In particular, a 400 bp DNA fragment is identified in which a putative AP-1 binding site is present; this fragment directs preferential expression of a linked reporter gene when introduced into GFAP-positive glioblastoma cells.

MATERIALS AND METHODS Cell Lines and Tissue Culture All cell lines used were grown in DMEM (Hazelton Biologics, Inc., Lenexa, KS) with 10% fetal calf serum Received August 14, 1990; revised September 24, 1990; accepted October 2, 1990. Address reprint requests to Dr. Jacob Sarid, Division of Neurosurgery, Brigham and Women’s Hospital, 75 Francis Street, Boston, MA 021 15.

218

Sarid

and 1% penicillin and streptomycin. The cells were grown in 7% CO, at 37°C and passed approximately 1:10 every 5 days.

Isolation of 5’-Flanking Sequences of the Mouse GFAP Gene Molecular cloning was carried out with standard procedures (Maniatis et al., 1982). A single recombinant h Charon 4A bacteriophage clone was isolated by screening a HaeIII partially digested mouse embryo genomic library (gift of Dr. P. Leder) with a radioactively labeled 135 bp SalI-Sac1 DNA probe derived from the mouse GFAP cDNA clone pG1 (gift of Dr. N.J. Cowan; Lewis et al., 1984). Mapping by restriction enzyme analysis showed that the isolated phage clone contained a 18 kb DNA insert. A comparison of the initial restriction endonuclease digestion map of the clone to the reported sequence of the mouse GFAP gene (Balcarek and Cowan, 1985) suggested that it contains almost entirely 5’-upstream sequences, overlapping about 400 bp with the reported sequence, including the transcription start site. Construction of Plasmids All constructs were generated using standard molecular cloning techniques (Maniatis et al., 1982). Sequences were confirmed at subcloning sites. Addition of linkers to fragments was done after fragments, when needed, were made blunt-ended using a filling in with Klenow polymerase fragment. A 12 kb XhoI-SalI DNA fragment was isolated from the genomic insert of the h phage clone and was subcloned into the SalI site of the plasmid pGEM4 (Promega, Madison, WI), resulting in a plasmid named pGEM4-GFIXS. A 6 kb EcoRV-SalI, containing the 5’-flanking region of the mouse GFAP gene including its cap site, was inserted between the EcoRV and SalI site in the polylinker region of the plasmid pBCl2IPWSEAP; this vector contains the structural sequences of the human placental secreted alkaline phosphatase (SEAP) gene flanked on its 5’-end by a polylinker region that includes the sites BglII, EcoRV, SalI, and HindIII (in a 5’ to 3’ order) and on its 3‘-end by noncoding region derived from the genomic rat preproinsulin 11 gene, which provides a 3‘-intronic region and a polyadenylation site (Berger et al., 1988). The resulting plasmid is designated pGF-SEAP (Fig. 2). Plasmid pH-SEAP was constructed by inserting the 2.5 kb HindIII-Hind111fragment of pGF-SEAP into the HindIII site of the polylinker of pBC12/PL/SEAP. Plasmid pBSEAP was made by joining the BglII site in the polylinker region upstream of the GFAP-flanking sequence in the plasmid pGF-SEAP to the BglII site at position - I882 (Figs. 2 and 4). Construct pS-SEAP was made by joining the EcoRV site in the polylinker region upstream

of the GFAP-flanking sequence in the plasmid pGFSEAP to the SmaI site at position - 1460 (Figs. 2 and 4). Plasmid pK-SEAP was generated by deleting the region between the KpnI site at position - 1090 in pGF-SEAP and the BglII site in the polylinker sequence upstream of the GFAP sequence (Figs. 2 and 4) and inserting between these sites a KpnI-BamHI polylinker sequence derived from the vector pGEM7Zf (Promega). construct pP-SEAP was made by first subcloning the PstI-Hind111 fragment containing the GFAP promoter region, derived from pGF-SEAP, between the HindIII and PstI sites of the polylinker region of the vector pGEM4, resulting in a plasmid named pGEM4-PH. From pGEM4-PH a BamHI-Hind111 fragment was isolated and was inserted between the BglII and SalI sites in the polylinker region of pBC 12IPLISEAP. Construct pA-SEAP was generated by deleting the region between the ApaI site at position - 1 10 in the plasmid pGF-SEAP and the EcoRV site in the polylinker region upstream of the GFAP-flanking sequence (Figs. 2 and 4) and inserting between these sites an EcoRV-ApaI polylinker sequence, derived from the vector pGEM5Zf (Promega). Constructs with internal deletions were generated in the following way: 1) pGF-dBA-SEAP was generated by isolating the 4 kb EcoRV-EcoRI fragment (EcoRV residing approximately at position -6000 and EcoRI residing just upstream, according to restriction mapping analysis, of the BglII site at position - 1882) from the plasmid pGF-SEAP, ligating ApaI linkers (New England Biolabs, Beverly, MA) on the termini, and inserting it in the ApaI site of the plasmid pA-SEAP, thus ligating the EcoRV-EcoRI upstream sequence to the promoter region; 2) pH-dBA-SEAP was generated by inserting the approximately 0.5 kb BglII-BglII fragment derived from plasmid pGF-SEAP (between the BglII site just downstream, according to restriction mapping analysis, of the HindIII site at approximate position -2500 to the BglII site at position - 1882) into the BglII site of pA-SEAP; 3) pH-dKA-SEAP was generated by first subcloning the EcoRV-KpnI fragment of the plasmid pH-SEAP, which extends from the EcoRV site in the polylinker sequence upstream of the GFAP-flanking region to the KpnI site at -1090, between the SmaI and KpnI sites of the polylinker region of the vector pGEM/7Zf, creating a plasmid called pGEM7ZflRK; a BamHI-ApaI fragment that contains the insert was isolated from this plasmid and inserted between the BglII and ApaI sites of the pA-SEAP plasmid; 4) pH-dSA-SEAP was generated by isolating a BamHI-SmaI fragment from the plasmid pGEM7ZfIRK and inserting it between the BglII and EcoRV sites in the polylinker region of pA-SEAP, upstream of the GFAP promoter region; 5 ) pB-dKA-SEAP was generated by isolating a BglII-ApaI fragment from the plasmid pGEM7Zf/RK and inserting it between the BglII and

Cell-Specific Transcriptional Regulation of the GFAP Gene

ApaI sites of the PA-SEAP plasmid; 6) pB-dSA-SEAP and prevB-dSA-SEAP were generated by first inserting the BglII-SmaI fragment, between positions - 1882 and - 1460 of the GFAP-flanking sequence (Figs. 2 and 4), into the BglII-EcoRV polylinker region of PA-SEAP, creating a plasmid named p/BS/A-SEAP; a BglI1-ApaI fragment was isolated from this plasmid, ApaI linkers ligated on its termini, and the resulting fragment was put back, in both orientations, into the ApaI site of PASEAP: 7) PS-dKA-SEAP was generated by isolating a SmaI-ApaI fragment from the plasmid pGEM7Zf/RK and inserting it between the EcoRV and ApaI sites in the polylinker region of PA-SEAP: 8) pS-dSTA-SEAP and pST-dSA-SEAP (Fig. 2) were generated by first converting the plasmid pGEM7Zf/RK into a plasmid named pGEM7ZFIBS by joining the Hind111 site (in the polylinker region) to the BglII site (in the GFAP sequence) as well as joining the SmaI site (in the GFAP sequence) to the Xhol site (in the polylinker region at the other end of the insert). Thus an insert was retained extending only from the BglII site at position - 1882 to the SmaI site at position - 1460, resulting in a plasmid called pGEM7Zfl BS. A BamHI-StuI fragment, containing the region between positions - 1882 (the BglII site) and - 1520 (StuI site), was isolated from this plasmid and inserted between the BglII and EcoRV sites of the polylinker of PA-SEAP to give pS-dSTA-SEAP. A StuI-ApaI fragment, containing the region between position - 1660 (a second StuI site: see Fig. 4) and - 1460 (the SmaI site), was also isolated from pGEM7Zf/BS and inserted between the EcoRV and ApaI sites of the polylinker of PA-SEAP. The BamHI-StuI and Stul-ApaI fragments isolated from pGEN7Zf/BS are overlapping between POsitions - 1660 and - 1520, where the two StuI sites reside (Fig. 4). They were achieved through partial digestion with StuI, and the resulting sequences of the inserts in pS-dSTA-SEAP and pST-dSA-SEAP were confirmed by sequencing. pSV40-SEAP was generated by inserting a 202 bp Bgl1I-Hind111 fragment containing the SV40 promoter region, derived from the plasmid pCAT-promoter (Promega), between the BglII and Hind111 sites in the polylinker region of pBC 12/PL/SEAP upstream of the SEAP structural sequences. pBS-SV40-SEAP and prevBS-SV40-SEAP were generated by isolating the BglIISmaI fragment (containing the positive regulatory region) from pGEM7Zf/RK as a BglJI-BamHI fragment (using BamHI linkers) and inserting it in both orientations into the BglII site of pSV40-SEAP. pGF-gal was generated by inserting the 6 kb EcoRV-SalI GFAP-flanking region between the NaeI and SalI sites of the plasmid pjcg-Bgal (gift of Dr. E. Schmidt); this cloning placed the GFAP sequences upstream of the Escherichia coli LacZ structural sequences

219

that are flanked at the 3’-end by the human growth hormone intronic region and a polyadenylation site.

DNA-Mediated Gene Transfer Transient transfection of C6, 9L, Rat-2, and L cells was done using the calciurdphosphate coprecipitation method (Graham and van der Eb, 1973; Scholer and Gruss, 1984). Cells were prepared by plating 1 X lo6 cells in a 35 mm tissue culture dish 24 hr prior to use. Cells were washed once with serum-free DMEM. Medium was replaced with 2 ml of DMEM with 10% fetal calf serum containing 0.2 ml of the coprecipitation solution, which included l p g of supercoiled plasmid. Cells were incubated overnight in a 7% CO, incubator; the medium was then aspirated and replaced with 2 ml of fresh DMEM with 10% fetal calf serum. Stable transfection of C6 and 9L was performed similarly, with the exception that the pSV7neo plasmid, which confers G418 resistance, was added to the coprecipitation solution in a ratio of 20 pg pGF-SEAP (or PA-SEAP or pGF-gal) to 4 p g pSV7neo. Forty-eight hours after transfection, medium was replaced by fresh DMEM/10% serum containing 1 mg/ml G418 (Gibco Laboratories, Gaithersburg, MD). Medium was replaced every 3-4 days and G418-resistant colonies were pooled 3 weeks after transfection and expanded. SEAP Activity Assay Activity of secreted alkaline phosphatase in cell media was assayed by the increase of optical density at 405 nm after incubation with its substrate (Berger et al., 1988). Briefly, 300 pl of diethanolamine assay buffer (pH 9.8) containing 1.5 mg of p-nitrophenylphosphate (Sigma, St. Louis, MO) were mixed with 150 p1 of cell media (preheated at 65°C to inactivate endogenous alkaline phosphatase activity) and incubated at 37°C for 24 hr for transiently transfected cells and for 2 hr for stably transfected cells. SEAP activity was measured 7 days after transfection in transiently transfected cells (as described in the text and in Table I). Medium was not changed during that time. This relatively long period was chosen after initial time course analysis of pGF-SEAP transfected into various cell lines revealed a gradual increase in SEAP activity in the cell media. Between these time points, average raw A,, of pGF-SEAP (with a 24 hr incubation period; see below) in C6 cell increased from 0.350 (3 days after transfection), to 1.200 (at 5 days), to 2.070 (at 7 days). Similarly, in 9L cells, average A,, increased from 0.002 (3 days), to 0.012 (5 days), to 0.025 (7 days); for Rat-2 absorbance remained between 0.000 and 0.002 during that period. A similar pattern of increased SEAP expression with time was revealed after pCMV-SEAP transfection. A 24 hr incubation time period was chosen for transiently transfected

220

Sarid

cells after time course analysis of cells transfected (7 days previously) with pCMV-SEAP revealed an increase in product appearance with increased incubation time. A,, in C6 increased on average from 0.080 (at 2 hr), to 0.250 (at 6 hr), to 0.900 (at 24 hr). A similar pattern was revealed in 9L transfectants reaching 0.500 at 24 hr, and in Rat-2 cells A,”, at 6 hr was still 0.002-0.010 and reached an average of 0.040 at 24 hr. Reaction mixtures were then diluted 1:s in 0.1 M Tris (pH 7.5) and the A,, was determined. Any increase in absorbance results from hydrolysis of the substrate, which is proportional to SEAP activity. Optical density of cells transfected with pBC12/PL/SEAP was taken as a reference point (0.000). Transfection of each construct in each cell line was repeated four to 20 times. A,, measurement of each sample were read multiple times (especially for values between 0.000 and O.OlO), and average values of the multiple readings were used for relative activity calculations as compared to pCMV-SEAP activity (see below; Table I , Fig. 2).

RNA Preparation and Primer Extension Analysis Total RNA was prepared from C6 and 9L stably transfected cell pools, using guanidinium isothiocyanate as described (Chirgwin et al., 1979), with a CsCl sedimentation gradient modification (Glisin et al., 1974). RNA yield was determined by ultraviolet (UV) absorption at 260 nm. Two 17 base oligonucleotides were synthesized for primer extension: GAGAGCTGTAGCCTCAG, complimentary to nucleotides spanning amino acids 10-15 of the SEAP gene, and TGCAAGGCGATTAAGTT, complimentary to nucleotides spanning amino acids 22-27 of the E . coli LacZ gene. Primer extension was performed as described (Wu et al., 1985); the primer and template RNAs were preannealed for 3 hr at 45”C, followed by precipitation and extension for 1 hr at 37°C. Primer extension products were resolved on an 6% polyacrylamide/8 M urea gel.

DNA Sequence Analysis DNA sequence of the GFAP clone (Fig. 4) was determined using the “dideoxy” chain termination method as described (Sanger et al., 1977), with modifications essential for double-stranded sequencing as described (Chen and Seeburg, 1985). Synthetic oligonucleotides were used as sequencing primers. DNA sequence of both strands was determined and analyzed with computer programs from the University of Wisconsin Genetics Computer Group and from IntelliGenetics, Inc.

RESULTS AND DISCUSSION The Mouse GFAP Gene 5’-Flanking Region Directs Specific Expression in a GFAP-Positive Glioma Cell Line The 5’-flanking region of the mouse GFAP gene was isolated as a single recombinant A Charon 4A bacteriophage from a mouse embryo genomic library. The DNA insert was found to contain about 18 kb of DNA sequence and a comparison of its restriction enzyme map to the reported genomic sequence of the mouse GFAP gene (Balcarek and Cowan, 1985) showed that the clone mostly encompasses the 5 ’-upstream region of the gene while overlapping about 400 bp of the reported genomic sequence including the transcription initiation (cap) site. In an initial evaluation of the role of the putative 5 ’ regulatory sequence of the GFAP gene, a 6 kb EcoRVSalI segment of DNA, which includes the promoter elements and the cap site of the gene was inserted into the polylinker region of the pBC/ l2/SEAP plasmid (Berger et al., 1988), upstream of the structural sequences of a promoterless human secreted placental alkaline phosphatase (SEAP) reporter gene (see Materials and Methods). Using this construct, called pGF-SEAP (Fig. 2), SEAP expression directed by the GFAP regulatory region was measured after transfection into tissue culture cells (described below). Another construct, pA-SEAP, contains only the GFAP promoter region fused to the SEAP gene (see Fig. 2 and below). These constructs were initially transfected transiently into the following cell lines: the GFAP-positive C6 rat glioblastoma (Raju et a]., 1980); 9L rat gliosarcoma (Barker et al., 1973), which is a glial-derived GFAP-negative cell line (when tested with anti-GFAP mouse monoclonal antibodies; data not shown); Rat-2 fibroblasts; and L cells (mouse fibroblasts). Medium removed from the transfected cells was used for spectrophotometric detection of SEAP activity (see Materials and Methods). Results of the transfection assays (Table I) were normalized for transfection efficiency by using a reference plasmid, pCMV-SEAP, containing the SEAP gene under the control of the human cytomegalovirus (CMV) immediate early enhancer and promoter region; the CMV enhancer-promoter region has been shown to direct a high level of reporter gene expression in a vast array of cell lines of different tissue and species origin (Foecking and Hofstetter, 1986). The activity of this standard plasmid in each cell line was given an arbitrarily assigned value of 1 (the absolute A,, readings of pCMV-SEAP activity differed between cell lines and were, on the average, 0.900 for C6, 0.500 for 9L, 1.400 for L cells, and 0.040 for Rat-2; A405 readings of cells transfected with the promoterless pBC 12/PL/SEAP were taken as a reference point of 0.000). Results of the trans-

Cell-Specific Transcriptional Regulation of the GFAP Gene

221

TABLE I. Relative Activity of 5’-Flanking Regions* Relative SEAP expression Construct pCMV-SEAP pSV40-SEAP PA-SEAP DGF-SEAP

Rat-2 1 0.001

0.01 0.03

Cell specificity ratio

L cells

9L

C6

C6iRat-2

C6/L cells

C6/9L

1 0.03 0.05 0.06

0.001 0.04 0.05

1 0.004 0.06 2.30

1 4 6 16.6

1 0.13 1.2 38.33

4 I .5 46

1

1

*Relative SEAP expression directed by the S’-flanking region of the mouse GFAP gene. In the pCMV-SEAP plasmid, the SEAP gene is under the control of the human cytomegalovirus (CMV) immediate early enhancer and promoter region. The plasmid pSV40-SEAP was constructed by fusing the BglII-Hind111 fragment of the plasmid pCAT promoter (Promega), which contains the early SV40 promoter without its enhancer, to the SEAP gene structural sequences. For each cell type, SEAP expression is expressed relative to that of the CMV enhancer-promoter region, which is defined as 1, and the reference point of 0.000 is defined by SEAP activity in pBCI2iPLiSEAP-transfected cells (see text). Cell specificity ratio represents the ratio of relative SEAP expression obtained in C6 cells to that in the control cell line.

fection assay were expressed as a ratio of the activity of the test plasmid to the standard pCMV-SEAP plasmid (Table I). An enhancerless SV40 promoter-driven SEAP fusion plasmid was used as a nonspecific promoter control (pSV4O-SEAP; Table I). Relative expression of this control construct was somewhat reduced in the C6 cells compared with L cells and increased by fourfold compared with Rat-2 and 9L cells. In contrast, the pGFSEAP construct displays a 76-fold higher relative expression in C6 cells compared with Rat-2 cells and 38-fold and 46-fold higher relative expressions in C6 cells compared with L cells and 9L cells, respectively (Table I). The ability of the GFAP 5’-flanking region to direct specific expression of a reporter gene was also studied in stable pools of C6 and 9L cells transfected with the following constructs: pGF-SEAP; PA-SEAP, in which SEAP expression is under the control of 110 bp of the GFAP 5’-flanking sequence, containing only the promoter region and the cap site (Fig. 2); and pGF-gal, in which the E . coli LacZ gene is under the control of 6 kb of the GFAP 5’-sequence. Constructs were cotransfected with the plasmid pSV7neo (Murphy et al., 1986), and G418-resistant colonies were pooled. Medium removed from an equal number (1 X lo7) of growing cells was used for the detection of SEAP activity in the spectrophotometric assay; pGF-gal-transfectants were stained using the X-gal histochemical assay for the detection of P-galactosidase activity (Dannenberg and Suga, 198 1). Thirtyfold higher SEAP activity was found in medium of C6/pGF-SEAP transfectants compared with C6/ PA-SEAP, 9L/pGF-SEAP and 9L/pA-SEAP pools, which showed approximately equal levels of SEAP activity (Table 11). X-gal histochemical assay showed a strong bright blue staining of C6/pGF-gal but no staining of 9L/pGF-gal (data not shown). These results demonstrate the ability of 6 kb of the GFAP 5’-flanking region to direct specific expression of a reporter gene in stablytransfected GFAP-positive C6 glioma cells. The ability of the 5’-flanking region of the GFAP gene to regulate expression of a reporter gene was also

TABLE 11. Activity of the GFAP S’-Regulatory Region in Stably Transfected Cell Lines* SEAP expression (O.D. units) Construct pGF-gal pGF-SEAP PA-SEAP

C6

9L

0.000 2.134 0.103

0.000 0.105 0.080

*C6 and 9L cells were stably transfected with the constructs presented here. Media removed from equal numbers of growing cells was used for the SEAP spectrophotometric assay. A,,,, O.D. readings of the assay were taken after 2 hr of incubation of cell media with the SEAP substrate in the reaction buffer as explained in Materials and Methods. Reference point 0.000 was defined as O.D. readings in untransfected C6 and 9L cells.

studied by primer extension assay on total RNA extracted from the stably transfected C6 and 9L pools. End-labeled oligonucleotide primers corresponding to the coding regions of SEAP or LacZ gave rise to a single band of a reverse transcript only in C6/pGF-SEAP and C6/pGF-gal transfectants, respectively. No bands were seen in other C6 or 9L transfectants (Fig. 1). These results show that the GFAP upstream sequence regulates glial-specific expression of the reporter gene at the transcriptional level, initiating the mRNA transcript at a single cap site.

GFAP cis-Acting Regulatory Activity Is Spread Over a Large 5‘ DNA Region but a 400 bp Upstream Segment Can Direct Preferential Expression in GFAP-Positive Astroglial Cells Deletion analysis of the 5’-flanking sequence of GFAP was used to map the 5’ and 3‘ borders of its cell-specific regulatory region. These deletions were made using specific restriction enzymes and resulted in the series of deletion constructs shown in Figure 2. All 5’-deletion points are flanked by the same vector sequences. Expression of the SEAP reporter gene in these constructs was measured by the SEAP spectrophotomet-

222

Sarid

Fig. 1. Primer extension analysis of stably transfected cells. A: Ten micrograms of total RNA extracted from stably transfected C6 and 9L cells was annealed to a labeled synthetic oligonucleotide complimentary to nucleotides spanning amino acids 22-27 of the E . coli LacZ gene, followed by 1 hr extension as described in Materials and Methods. Expression of pGF-gal in C6 cells yields a single -135 bp band. B: RNA

was annealed to a labeled synthetic oligonucleotide complimentary to nucleotides spanning amino acids 10-15 of SEAP. A single -60 bp band is present in lanes of C6 transfected with pGF-SEAP (run on both sides of the pBR3221MspI marker). See text, Figure 2, and “Materials and Methods” for description of various constructs.

ric assay after transient transfection into C6 and 9L cells. Again, results are expressed as a ratio of activity of the test plasmid t o the standard pCMV-SEAP plasmid, defined as 1 (Fig. 2). These results demonstrate that a region of 1882 bp upstream of the cap site (construct pB-SEAP) can direct cell-specific expression of the reporter gene in C6 cells in a level equal to that of the pCMV-SEAP standard. This activity is about 2.3-fold less than that of the full 6 kb construct, pGF-SEAP; however, the construct of pGF-dBA-SEAP, in which about 4 kb of sequence upstream of the BglII site (position - 1882) were fused to the 110-bp promoter region of GFAP, is incapable of increasing reporter gene expression in C6 cells above the level of the promoter. These results indicate that, although sequence upstream of the BglII site is necessary for full specific expression in C6 cells, it is incapable of functioning independently as a cis-acting positive regulatory region.

Further removal of 420 bp from the BglII site, to the Smal site at position - 1460 (€6-SEAP), results in a decrease of SEAP expression by fourfold in C6 cells (Fig. 2; from relative activity of 1 to 0.25). Further deletion of 370 bp, to the KpnI site at position -1090 (pK-SEAP), results in a further decrease of SEAP expression by 2.5-fold (from relative activity of 0.25 to 0.1) to a level about 1.6-fold higher than that of the promoter region present in PA-SEAP (relative activity of 0.1 vs. 0.06). However, when the 370 bp SmaI-KpnI segment is fused to the 110 bp promoter region of pASEAP (resulting in pS-dKA-SEAP), the expression level is not increased above that of PA-SEAP and in fact is even decreased (suggesting that it rnay contain a negative regulatory sequence). In contrast, fusion of the 420 bp BgllI-SmaI segment to the promoter region results in an increase of four- to fivefold in the expression level in C6 cells (compare PA-SEAP with pl3-dSA-SEAP). Three

GFAP-SEAP deletion constructs 1 kb

L B

RV

H

Relative Activity B

RI

B

ST ST

SM

K

P

Acap

-6000

-2500

-1882

-1460

-1090

-310

pH-SEAP

pB-SEAP

pS-SEAP

pK-SEAP

pP-SEAP

I

I

I

I

I

I

I

I

I I

I

I

I I I I I I I

I I I

-6000 4

-2500

-2500

-2500

-1882

PA-SEAP

I I

pG F-dBA-S EAP

L

pH-dSA-SEAP

pB-dKP.-SEAP

-1 882

-1 882

-1882

-1 660

-1 460

prevB-dSA-SEAP

pS-dSTA-SEAP

PST-dSA-SEAP

pS-dKA-SEAP

0.05

1

0.05

1

0.05

S H

0.04

0.10

0.05

0.08

0.04

0.06

0.04 0.03

(-1882 - -110)

0.02

I

1

I

(-1882 - -110)

0.05 0.04

I

I

I

I

(-1090 - -110)

0.33 0.05

I

I

(-1460 - -110)

C.23 0.05

(-1090 - -110)

C;.ZZi

0.05

(-1460

-

-110)

C 23

0.07

(-1460

-

-110)

0.20 0.07

I

L

I

I

I

I

pB-dSA-SEAP

2.3

I I

pH-dBA-SEAP

pH-dKA-SEAP

9L

0.25

I -1 10

C6

I

I

I

I

I

1 I

I

1

-

I

I

I

L

Fig. 2. Effects of progressive 5' and internal deletions on the ability of the GFAP regulatory region to direct SEAP coding region expression. Solid areas represent GFAP 5' region sequences fused to SEAP structural sequences (see text). Numbers on the left represent the 5' ends of the fragments tested. Numbers in parentheses show internal sequences deleted. Activities of the various constructs were tested 7 days after transfection into C6 and 9L cells as described in Materials and Methods and are expressed relative to that of the standard plasmid pCMV-SEAP (see text), whose activity in each cell

(-1520 - -110)

C 05

(-1460 - -110)

0.02 002

(-1090 -

0.c2

110)

0.05

0.02

line is defined as 1. Transfections of each construct were repeated between four and 20 times, and activities indicated represent mean values with standard deviations ranging from 1.5% to 20%. The region between dashed lines indicates the location of the BglII-SmaI 420 bp sequence identified as a positive regulatory element. A fusion of this sequence to the 110 bp promoter region in both orientations is indicated by arrows. A,ApaI; B, BglII; H, HindIII; K, KpnI; P, PstI; RI, EcoRI; RV, EcoRV; S, SalI; SM, SmaI; ST, StuI.

224

Sarid

other plasmids in which the 420 bp BglII-SmaI region was included contain larger upstream segments fused to the promoter region: pH-dKA-SEAP, pH-dSA-SEAP, and pB-dKA-SEAP. These constructs are capable of directing SEAP expression in C6 cells at levels about equal to that of the BglII-SmaI region itself. Two overlapping fragments were derived from the 420 bp BglII-Smal segment, a 363 bp BglII-StuI and a 195 bp StuI-SmaI fragments. Each of these fragments was placed upstream of the GFAP promoter region, resulting in pS-dSTA-SEAP and pST-dSA-SEAP, respectively (Fig. 2). Both constructs failed to show an increase in the level of reporter gene expression above that of PA-SEAP, suggesting that the 420 bp segment cannot be divided into smaller functional cis-acting regulatory elements. Results described above indicate that, although other 5’-flanking sequences of the GFAP gene are necessary for full levels of astrogliai-specific gene expression, a 420 bp segment can act independently as a positive regulatory element when fused to the GFAP promoter and is able to direct preferential expression of a reporter gene in GFAP-positive glial cells. An increase in the level of expression in C6 cells is also achieved by fusing the 420 bp segment in the opposite orientation to the GFAP promoter (construct prevB-dSA-SEAP; Figs. 2 and 3A). This region is also capable of increasing the level of the reporter gene expression above that of the GFAP promoter in 9L and L cell, although to a lesser degree than in C6 cells (Fig. 3A), suggesting that both astroglial-specific and ubiquitous positive cis-acting sequences reside within the boundaries of the BglII-SmaI region. It can also activate reporter gene expression in C6 cells when fused to an enhancerless SV40 early region promoter, but only in the original orientation and not in the opposite one (Fig. 3B). Thus, although the 420 bp BglII-SmaI segment is indeed a positive cis-acting regulatory region, its activity is not always orientation independent, so it does not act as completely as other enhancer regions that act in a position- and orientationindependent fashion (reviewed by Maniatis et al., 1987; Jones et al., 1988).

DNA Sequence Analysis The DNA sequence of 1976 bp, from the BglIl site at position - 1882 to position + 94, is shown in Figure 4; 9971 bp of the full genomic sequence of the mouse GFAP including 246 bp upstream of the cap site has been previously described (Balcarek and Cowan, 1985). These sequences, totaling 11.607 bp, have been searched for the location of a large number of consensus motifs that serve as binding sites for DNA-binding proteins. The CCAAT motif, which is found in many gene promoters and enhancers and interacts with CTF/NF1 and CP1 factors (see in review by Mitchell and Tjian, 1989),

was found at positions -405, in addition to the CAAT sequence, which was previously found at position -82. No BETA binding site, which binds a brain-specific transcriptional activator present both in neuronal and astroglial cells (Korner et al., 1989), has been found. A putative AP- 1 binding site TGACTCA, which interacts with protein members of the Jun family that bind to it either as homodimers or as heterodimers with the Fos protein (Halazonetis et al., 1988; Kouzarides and Ziff, 1988; Nakabeppu et al., 1988; Turner and Tjian, 1989), was found only once, at position - 1582. This location resides within the 420 bp BglII-SrnaI sequence (Fig. 4), which has been shown in the transfection assays to act as a cis-acting positive regulatory region in C6 cells. No cyclic adenosine monophosphate (CAMP)-responsive elements (T[G/T]ACGTCA; Bokar et al., 1988) have been found. The sequence CCCCAGG, which is homologous to the consensus sequence of the AP-2 binding site CC(G/C)C(A/G)GGC (Mitchel et al., 1987), is located in position - 1610, which also resides within the boundaries of the BglII-Smal region (Fig. 4). This AP-2-like motif may have a role in the inducibility of GFAP by cAMP (Raju et al., 1980), because the AP-2 site has been shown to confer cAMP inducibility (Imagawa et al., 1987); however, other CAMP-inducible elements may be located in the region upstream of the BglII site, which has not yet been sequenced, Positive and negative reguiatory cis-acting elements serve as binding sites for sequence-specific transcription factors that activate or repress mRNA transcription (Mitchell and Tjian, 1989). The same DNA sequence may function as either a positive or negative regulatory element depending on DNA-binding factors present in different cell types (Leonard0 et al., 1989; Kageyama and Pastan, 1989). Tissue-specific gene expression is a result of the activity of a regulatory network involving ubiquitous as well as tissue-specific transacting factors that bind to cis elements in a sequencespecific manner. This investigation describes an analysis of the regulatory elements involved in the astroglial-specific expression of the GFAP gene. Transfection of various deletion constructs carrying the GFAP 5’-flanking sequences fused to a reporter gene demonstrated that high expression levels are directed by the GFAP 5’-sequences in the GFAP-positive C6 glial cells, compared with low expression levels in control cell lines; deleting increasing portions of the GFAP .5’-region results in a gradual loss of reporter gene activity in C6 cells, whereas in the 9L control cells activity remains low. These results indicate that astroglial-specific GFAP expression is controlled primarily by cis-acting positive regulatory elements; a possible effect of negative elements in control cells is less apparent because deletion of such sequences would have allowed an increase of reporter gene expres-

225

Cell-Specific Transcriptional Regulation of the GFAP Gene Enhancement of GFAP promoter driving SEAP

A

Activity

rn

PA-SEAP

PBdSA-SEAP

(-1882 to -1460)

prevBdSA-SEAP

(-1460 to

-

i

C6

9L

L cells

1

1

1

4.2

1.7

2.8

3.3

-1882)

1.7

ND

E n h a n c e m e n t of SV40 promoter driving SEAP

6.

Activity

C6

l2zizm

pSV40-SEAP

pBS-SV40-SEAP

prevBS-SVGSEAP

(-1882 to -1460)

(-1460 to

-1882)

-

9L

L cells

1

1

1

5

1

1

1

1

1

Fig. 3. Enhancement of SEAP expression by the GFAP positive regulatory element. A: Enhancement of the GFAP promoter. Black rectangles represent the ApaI-SalI mouse GFAP promoter region (see Fig. 2 ) . Stippled rectangles represent the 420 bp BglII-SmaI segment (base positions indicated in parentheses) of the GFAP 5'-upstream region. Activities are ex-

pressed relative to that of the GFAP promoter region alone, which is defined as 1 in each cell line. B: Enhancement of the SV40 promoter, indicated by hatched rectangles. Activities are expressed relative to that of the SV40 early promoter region, which is defined as 1 in each cell line. Arrows indicate orientation of the BglII-SmaI fragment. ND, not determined.

sion in control cells. The gradual loss of reporter gene expression in C6 cells suggests also that the full level of GFAP expression in astroglial cells is controlled by a synergistic activity of a number of cis-acting positive regulatory elements that reside in the 5' region of the

gene. A 420 bp positive regulatory element, which contains a putative AP-1 binding site, has been identified; when this element is fused to the GFAP promoter or to the heterologous SV40 promoter, it directs preferential expression of a reporter gene in C6 cells. Deletion con-

B g l II -1882 A G A T C T C C C T C A C T A T G C C A T T A T T C A G G A T T G G G G A A G A G G G G

-1822

CTCTTCCCTTCCCTATGGTGGGACTCATTAGGAGAACCTCG

-1762

CTCAAACAAATACCATGTCGCTGGTATGGAGTATAGGCTGTTGCTATGACAGG~CTCAG StUI GGGTCTTAACTGGCTTGAGCGCTGGGAGGGGGCAAGCAGCAGCCAGGCCTTGTCTGT~~GCTG

-1702 -1642 -1582

I

AAGACCTGGCAGTGCTGAGCTGGTCAGCICCCCAGO;\CCTCCTTTTGTGCCCACGA~

I

~CTTGGCATAGACATATGGTCAGGGGTGGGCACGCAGCCTGCTTCCGCTGTGCTCC StUI Sma I - 1 5 2 2 AGGCCTCCTTCGATGCTTTCCGAGAAGTCTATTGAGCTATTGAGCTGGGAGCTTGTACTGCAC:CCGGG -1462

GCTGACATCCTGGCATCCTGGGACAAAAGCAGCAGCCCACGGGGTGCCTTGCCATATGCCTCA

- 1 4 0 2 CTGGCGGCAGAGAACAAGGCTCTATTCAGCGAGTACCCTGGA~TAGACACCAG~GCCCA - 1 3 4 2 AGCATGGGCAGAGGAAGGCAGGGGTTGGGGGGAGCAGAGCTGTCTGTGTTCCAG~GCCC -1282

AAGGACACAGATGGCTAAGGCGCCTGGGAGAGGGACCTGAGTGGAAGAGATAGATGGGCC

-1222

TGAAGTCTCAAGCAGCAACAGCCTCCTCCCCGCCATTGGTGAGGGTGGGGTTTGGTTTCC

-1162

CGGACCTACATATCCCTCAGAGGCCTGGTGTGTAGGAATTT~GGGGGT~TCTCCTG KpnI

-1102 AGAGAATGAGGGGTACCCAGGAAGACGGGGAGTTACAG~GPGACTCCAGCATGCAC - 1 0 4 2 AGCCAACTCATTCAAAACTACTCTGTCAGGGGCTGCCAGGGGCCAGGCTCGGGGTGGGGG -982

GTGGGGGGCAACGAGAAGCTGGATCAGGGAGAAATGGCCCCACTAGGCTGGATAAGAGGCC

- 9 2 2 ACAGAGGGGCTCAGGAATGPGCCTGCTGTCTTACCCTATTAGGATCTGCGTGCATACCT -862

TCTGCCGTGCACTCTAAACACACAGCCAGAGGCTCMGTTGACCCTGGAGTCACA~AGAG

-802

GGCTCCAACCTTAGCCCTCCACTCCTGAACTCCAGGAATGGATAGAGTTGG,4GAGA

- 1 4 2 TTCAGGGGAGAGGACTCTGTTGAGPTGGGGGTCACAGGAAACTGT~TATAGGT'~GATC -682

CCGGAGAAGGGAATAGGTTCTTCAAGTTCCTAGCATCTCACAGGCCCCCAGAGAA(~GACA

-622

GAGTTGGGGTGGTCCTGGCTTACAGGCTCTAAGACTGGAAGCTGATTACCCCAC(-GAGC

-562

TGTGCACTCTCTGTCTCTGTCTCTGTGTGTGCGCTCGTGCACACTTATCACAC~~TGTT

-502

CATGTGTGTGCACATACATGTGTTGAGACCAGAGGTCAACCTCAGGCACTGTTGC(~TTGG

-442

T T T T C T G A G A G A G C A T T T C T C T C T G G A T C T G G A A C T C G C C G

- 3 8 2 TCTGCTGATTTTCACTGCCCAGCACTGGAGTTTACAAGTATGCACTGTCAACCCAGGCCT PStI

-322

TTTGTATTCATTCTGCAGCTAGAACTTGGGTGGGTCTTCATGCTTGACAGGCAAGC:AATT

-262

TATGGACTAAGCTGTTCCCTCGGCCCTCTCTTACCCATTACCAGAAAGGGGTTCC~'TGAT

-202

CAATGCGAAGCCAGGCTGTGTTCCCAAG~GCCTTACTCTGGGTACAGTGACCCTCAGT

-142

GGGGTGAGAGGATTCTCCCCCTACTGGCTGGGGCCCAGCTCCACCCCCTCAGGCTP*TT~

ApaI

-82 A T G G G G G T G C T T C C A G G A A G T C A G G G G C A G A T T T A G T C C A G G C

r'

-22

M

E

R

R

R

I

T

S

CCTGACATCCCAGGAGCCAGCAGAGGCAGGGCAGGATGGAGCGGAGACGCATCACCTCTG A

R

R

S

Y

A

S

E

T

V

V

R

G

L

G

P

S

R

Q

+ 3 9 CGCGCCGCTCCTATGCCTCCGAGACGGTGGTCAGGGGCCTCGGTCCTAGTCGAC~

t

Fig. 4. Nucleotide sequence of the 5'-regulatory region of the mouse GFAP gene. The complete sequence of the mouse GFAP gene including 246 bp upstream of the cap site was determined previously; the cap site, denoted by a bent arrow, the TATA-like site ATA (underlined) 30 bp upstream of the cap site, and the CAAT site at position -82 (underlined) were previously identified (Balcarek and Cowan, 1985). A second CCAAT site was identified at position -405 (underlined). The BglII-SmaI positive regulatory element identified in the trans-

fection assays (see text and Figs. 2 and 3), extending from position - 1882 to - 1460, is boxed. This region contains an AP-1 binding site TGACTCA at position -1582 (boxed). A sequence homologous to the AP-2 binding site at position -1610 is also boxed. A vertical arrow denotes the position in which in the mouse GFAP sequence reported previously (Balcarek and Cowan, 1985) a T was inserted at position t-80, which has not been found during the sequencing conducted for the present study, as reported by Breriner et al. (1990).

Cell-Specific Transcriptional Regulation of the GFAP Gene

structs lacking this element or containing only a part of it show a much lower reporter gene activity. However, levels of reporter gene expression directed by this sequence are lower than those of the 6 kb 5’ region of the GFAP gene, and, although this element displays some of the features of an enhancer such as being orientationindependent with respect to the GFAP promoter as well as activating transcription from an SV40 promoter, it is not orientation independent with respect to this heterologous promoter (Fig. 3). These results demonstrate that the 420 bp element is indeed necessary but not sufficient for full glial-specific expression of GFAP and that its activity is not completely independent of other cis-acting sequences with which it may have a synergistic activity, including with sequences residing within the GFAP promoter region. The interactions of the AP-1 binding site with members of the Jun family have been shown to result in transcriptional activation for JunA binding. JunB fails to activate transcription and can repress JunA-mediated activation (Chiu et a]., 1989; Schutte et al., 1989), demonstrating again that the same DNA motif can serve as either a positive or a negative, regulatory element, depending on the factors with which it interacts. However, it is unlikely that the putative AP- 1 binding site identified in the 420 bp element has a negative role in nonastroglial cells, since deletion constructs lacking this region do not show a substantial increase in reporter gene activity in a control cell line. Moreover, when the 420 bp region is fused to the GFAP promoter, reporter gene activity increases in 9L and L cells (Fig. 3A), although at lower levels than in C6 cells. The possible regulatory role of the AP-1 site within the 420 bp region in C6 cells is likely to be a positive one because of the positive cisacting effect that this region is shown to have on both GFAP and SV40 promoters in these cells. However, the presence of the AP- 1 site in deletion constructs that contain only part of the 420 bp element fused to the GFAP promoter does not result in increased expression above that of the promoter alone, indicating that the AP-1 site may be necessary but not sufficient for the astroglialspecific positive regulatory activity of the 420 bp sequence. Clearly, the possible role of the AP-I motif in the regulatory function of the GFAP 5’-upstream sequences needs to be studied further by fine deletional and point mutation analysis in in vitro binding and transfection assays to assess the ability of such mutant constructs to bind trans-acting factors and to direct gene expression in glial and nonglial cells. Further studies directed toward the characterization of the GFAP cis- and transacting factors and their functions will add to our current understanding of the regulatory network that controls glial-specific gene expression and glial cell differentiation in the central nervous system.

227

ACKNOWLEDGMENTS I am thankful to Drs. Hunt Potter and Cynthia Morton for their help and critical reading of the manuscript. This work was supported by the Brigham Surgical Group and the Preuss Foundation for Brain Tumor Research.

REFERENCES Balcarek JM, Cowan NJ (1985): Structure of the mouse glial fibrillary acidic protein gene: implications for the evolution of the intermediate filament multigene family. Nucleic Acids Res 13: 552775543, Barker M, Hoshimo T, Gurcay 0, Wilson CB, Nielsen SL, Downie R, Eliason J (1973): Development of an animal brain tumor model and its response to therapy with 1,3-Bis(2-Chloroethyl)1-nitrosurea. Cancer Res 33:976-986. Berger J, Joachim H, Hauber R, Geiger R , Cullen BR (1988): Secreted placental alkaline phosphatase: A powerful new quantitative indicator of gene expression in eukaryotic cells. Gene 66:l-10. Bokar JA, Roesler WJ, Vandenbark GR, Kaetzel DM, Hanson RW, Nilson JH (I 988): Characterization of the CAMP responsive elements from the genes for the alpha-subunit of glycoprotein hormones and phosphenolpyruvate carboxykinase (GTP). J Biol Chem 263: 19740-19747. Brenner M, Lampel K, Nakati Y , Mill J, Banner C, Mearow K , Dohadwala M, Lipsky R, Freese E (1990): Characterization of human cDNA and genomic clones for glial fibrillary acidic protein. Mol Brain Res 7:277-286. Cepko C (1988): Retrovirus vectors and their applications in neurobiology. Neuron 1:345-353. Chen EY, Seeburg PH (1985): Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4:165-170. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ (1979): Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-5299. Chiu R, Angel P, Karin M (1989): Jun-B differs in its biological properties from, and is a negative regulator of c-Jun. Cell 59: 970-986. Dahl D (1981): The vimentin-GFA protein transition in rat neuroglia cytoskeleton occurs at the time of myelination. J Neurosci Res 6:74 1-748. Dahl D, Rueger DC, Bigmani A, Weber K, Osborn M (1981): Vimentin, the 57,000 molecular weight protein of fibroblast filaments is the major cytoskeletal component in immature glia. Eur J Cell Biol 24:191-196. Dannenberg AM, Suga M (1981): In Adams DO,Edelson 0, Koren MS (eds): “Methods for Studying Mononuclear Phagocytes.” New York: Academic press, pp 375-396. Fedoroff S, Vernadakis A (eds) (1986): “Astrocytes.” New York: Academic Press. Foecking MK, Hofstetter H (1986): Powerful and versatile enhancerpromoter unit for mammalian expression vectors. Gene 45: 101-105. Glisin V, Crkvenjakov R, Byus C (1974): Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry I3:2633-2637. Graham FL, van der Eb AJ (1973): A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52:456467. Halazonetis TD, Georopopoulos K, Greenberg ME, Leder P (1988): c-Jun dimerizes with itself and with c-Fos, forming complexes of different DNA binding affinities. Cell 55:9 17-924.

228

Sarid

lmagawa M, Chiu R, Karin M (1987): Transcription factor AP-2 mediates induction by two different signal-transduction pathways: Protein kinase C and CAMP. Cell 5 1 :25 1-260. Jones N (1990): Transcriptional regulation by dimerization: two sides to an incestuous relationship. Cell 61:9-1 I . Jones NC, Rigby PWJ, Ziff EB (1988): Trans-acting protein factors and the regulation of eukaryotic transcription: Lessons from studies on DNA tumor viruses. Genes Dev 2:267-28 1. Kageyama R, Pastan I (1989): Molecular cloning and characterization of a human DNA binding factor that represses transcription. Cell 59915-825. Kimbelberg HK, Norenberg MD (1989): Astrocytes. Sci Am, April, 260:66-76. Kitamura T, Nakanishi K, Watanabe S , Endo Y, Fujita S (1987): GFA-protein gene expression on the astroglia in cow and rat brains. Brain Res 423:189-195. Korner M, Rattner A, Mauxion F, Sen R, Citri Y (1989): A brainspecific transcription activator. Neuron 3563-572. Kouzarides T, Ziff E (1988): The role of the leucine zipper in the fos-jun interaction. Nature 336:646-651. Leonard0 MJ, Staudt L, Robbins P, Kuang A, Mulligan RC, Baltimore D (1989): Repression of the IgH enhancer in teratocarcinoma cells associated with a novel octamer factor. Science 243:544-546. Levitt P, Cooper ML, Rakic P (1983): Early divergence and changing proportions of neuronal and glial precursor cells in the primate cerebral ventricular zone. Dev Biol 96:472-484. Lewis SA, Balcarek JM, Krek V, Shelanski M, Cowan NJ (1984): Structure of a cDNA clone encoding mouse glial fibrillary acidic protein: Structural conservation of intermediate filaments. Proc Natl Acad Sci USA 81:2743-2746. Lewis SA, Cowan NJ (1985): Temporal expression of mouse glial fibrillary acidic protein gene mRNA studied by a rapid in situ hybridization procedure. J Neurochem 45:913-919. Maniatis T, Fritsch EF, Sambrook J (1982): “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Maniatis T, Goodbourn S , Fischer JA (1987): Regulation of inducible and tissue-specific gene expression. Science 236: 1237-1 245. McKay RDG (1989): The origins of cellular diversity in the mammalian central nervous system. Cell 58:815-821.

Mitchell PJ, Tjian R (1989): Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 24.5: 371-378. Mitchell PJ, Wang C, Tjian R (1987): Positive and negative regulation of transcription in vitro: enhancer-binding protein AP-2 is inhibited by SV40 T antigen. Cell 502347-861. Murphy W, Sarid J , Taub R, Vasicek T, Battey J, Lenoir G, Leder P (1986): A translocated human c-niyc oncogene is altered in a conserved coding sequence. Proc Natl Acad Sci USA 83:29392943. Nakabeppu Y , Ryder K, Nathans D (1988): DNA binding activities of three murine Jun proteins: Stimulation by Fos. Cell 55:907915. Raff MC (1989): Glial cell diversification in the rat optic nerve. Science 243:1450-1455. Raju TR, Bignami A, Dahl D (1980): Glial fibrillary acidic protein in monolayer cultures of C6 glioma cells: effects of aging and dibutyril cyclic AMP. Brain Res 200:225-230. Sanger F, Nicklen S, Coulson AR (1977): DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463 -5467, Scholer HR, Gruss P (1984): Specific interaction between enhancercontaining molecules and cellular components. Cell 36:403411. Schutte J , Viallet J, Nau M, Segal S , Fedorko J, Minna J (1989): Jun-B inhibits and c-Fos stimulates the transforming and transactivating activities of c-Jun. Cell 59:987-997. Tardy M, Fages C, Riol H, LePrince G , Rataboul P, Charriere-Bertrand C, Nunez J (1989): Developmental expression of the glial fibrillary acidic protein mRNA in the central nervous system and in cultured astrocytes. J Neurochem 52: 162-167. Temple S (1989): Division and differentiation of isolated CNS blast cells in microculture. Nature 340:471-473. Turner DL, Cepko CL (1987): A common progenitor for neurons and glia persists in rat retina late in development. Nature 328: I3 1136. Turner R, Tjian R (1989): Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers. Science 243: 1689-1694. Wu B, Hunt C, Morimoto R (1985): Structure and expression of the human gene encoding major heat shock protein HSP70. Mol Cell Biol 5:330-341.