Vol. 174, No. 14

JOURNAL OF BACTERIOLOGY, July 1992, p. 4777-4782

0021-9193/92/144777-06$02.00/0 Copyright © 1992, American Society for Microbiology

Identification of a Novel Promoter in the Replication Control Region of Plasmid R6K PRADIP MUKERJI,1t ALAN GREENER,1l AND MARCIN FILUTOWICZ2* Department of Bacteriology, E. B. Fred Hall, 1550 Linden Drive, University of Wisconsin-Madison, Madison, Wisconsin 53706,2 and Center for Molecular Genetics, University of California, San Diego, La Jolla, California 920931 Received 23 December 1991/Accepted 10 May 1992

A novel source of transcription has been detected in the replication region of plasmid R6K by using fusions involving the galK reporter gene. The -35 and -10 consensus RNA polymerase binding sites were identified in the region overlapping the binding sites for the R6K-encoded replication protein -w. Transcription from this promoter, designated P2, is repressed in vivo by w-protein levels that are inhibitory for replication. Promoter-down mutations in P2 induced in vitro by bisulfite mutagenesis result in a reduced copy number of a 13-replicon but not of a y-replicon. Implications of the role of P2 in R6K replication are discussed.

R6K is a 38-kbp self-transmissible Escherichia coli plasmid belonging to the incompatibility group X that is maintained in E. coli at a copy number of 15 to 20 per chromosome (14). Electron microscopic analysis of R6K replicative intermediates has shown that DNA forks begin at three distinct sites that have been designated the a-, y-, and ,3-origins (1, 11). About 90% of the in vivo initiations of replication occur at the a- and 13-origins, which are located approximately 2 kbp to either side of the -y-origin. Two plasmid components are required for the function of the R6K replication origin: seven 22-bp repeats aligned in tandem in the -y-origin (24) and an autoregulated 35-kDa protein, designated ir (13), whose structural gene (pir) resides between the -y- and 1-origins (Fig. 1A) (25). Binding of the ir protein to the -y-origin repeats and to the promoter-operator region of thepir gene (4, 5, 7, 8, 12) has been shown to be essential for activity of the fy- and 1-origins (16) and autoregulation of 'rr synthesis (4, 12), respectively. Attempts to obtain R6K-derived replicons dependent exclusively on one of the origins revealed that a 400-bp segment of R6K sequence (Fig. 1A) was capable of replicating with a copy number characteristic of the entire R6K plasmid when -rr protein was provided in trans (13). This segment is designated the R6K y-origin. A functional 1-replicon appears to require a 1,961-bp sequence extending from the HindIII site within the 1-replicon (R6K coordinate +1) to an HaeII site well beyond the pir gene (21) (Fig. 1A). Internal deletions or insertions of extraneous DNA fragments at various locations within this sequence inactivated the 1-replicon even when the product of the pir gene was provided in trans (5, 21). Further investigations have demonstrated the requirement for structural integrity over the entire 1,961 bp for a functional 1-replicon and the existence of an open reading frame, which encodes a 17-kDa protein, in the region immediately downstream of the pir gene (Fig. 1A). Subsequently, it has been demonstrated that the protein product of this open reading frame, termed Bis, is essential *

for a functional 1-replicon and that the expression of the bis gene is dependent upon a functional rr protein being synthesized in cis (18). The conclusion is based on the finding that defective 13-replicons with mutations in the bis gene are complemented in trans only by a fragment expressing both thepir and the bis genes. In addition, in-frame insertions into the pir gene that produce an inactive Ir protein block the expression of a Bis-1-galactosidase fusion protein downstream (18). Thus, it is possible that the requirement for structural integrity mentioned above reflects an inability of those constructs to produce Bis protein. Alternatively, or in addition, insertions and deletions in a 1-replicon may alter the properties of transcripts formed throughout the origin. To investigate this possibility, various promoter-probe vectors were used to detect the origin(s) of transcription in the replication region of R6K. Two promoter sequences have been localized upstream of the pir-bis operon (21, 23, 24). The putative -35 and -10 sequences for RNA polymerase binding (P1 in Fig. 1B) were discovered in an approximately 400-bp minimal -y-origin segment (24). The ability of E. coli RNA polymerase to bind to the segment between coordinates 45 and 89 was confirmed by the DNase I protection assay (2). Subsequent experiments that involved different segments of the y-origin cloned upstream of the chloramphenicol acetyltransferase reporter gene demonstrated the expression of chloramphenicol acetyltransferase when the R6K sequence containing this P1 consensus promoter sequence (coordinates 0 to 277) was present upstream (22). The second promoter (P3 in Fig. 1D) has been characterized in detail by DNase I, S1 nuclease protection, and in vitro transcription analysis, and it has been shown to be responsible for the transcription of the pir gene and subject to repression by I protein (4, 12). The ability of IT protein to interact with the operator of the pir gene appears to be the underlying mechanism for the autoregulation of ITr-protein synthesis. In this paper, we characterize another promoter, P2, located upstream of the coding segment of the pir-bis operon (Fig. 1C). The major features of this promoter include involvement in the maintenance of the copy number of the 1-replicon and susceptibility to repression by I

Corresponding author.

t Present address: Ross Laboratories, Columbus OH 43230. t Present address: Stratagene Cloning Systems, La Jolla, CA

protein.

92037.

4777

4778

MUKERJI ET AL.

J. BACTERIOL.

A. I +1 277 H B Il-

-,---

-106 FRI I

I

804 942 B H

V/////////A pir r7777//77l

1111111

P1

P2

1871 1961 B HII

bis-

.T...

---

I

P3

pPM52

pAG169 pPM5 pAG172

B.

1-1

-35 -10 CTTTAAAACCTIAGAGGCTATTTAAGTrGCTGATTTA AATT1TATTGT I I ihf 40 90 A - P121

G- P119

C. -35

-10

AAACATGAGAGCTAGTACGT9AAACATGAGACCTAGTACGTACATCAACAG3TTGAACTGCTGATCTTCAGfA DnaA 20 277 ihf A T-P201 'A-P203

D. _

o

>

~ ~ -10 ~~~~~-35

~~~~ O

AAACATGAGTGGATAGTACGTTGCTAAAACATGAGATAAAAAlTGACTCTCATGlTAlTGGCGTTAAGATATACAGA,A 362

439

FIG. 1. (A) Part of replication region of plasmid R6K encompassing the y- and n-origins. The pir and bis genes (hatched and dotted areas, respectively), extents of individual replicons (double-headed arrows), 22-bp repeats that bind ir protein (seven vertical bars), and promoters P1, P2, and P3 (arrowheads) are indicated. Thin lines at the bottom of the figure represent the R6K sequences in various derivatives constructed in this study. Abbreviations for relevant restriction sites: B, BglII; H, HindIII; HII, HaeII. Coordinates shown are according to the system of Stalker et al. (24). (B) y-origin sequence from positions 40 to 90, with -35 and -10 sequences of P1 indicated by brackets. Positions of the P1-121 and P1-119 mutations and the respective base substitutions are indicated. The recognition sequence for IHF is underlined (3). (C) y-origin sequence from positions 203 to 277, with the consensus -35 and -10 sequences of P2 indicated by brackets. Positions of P2-201 and P2-203 and the respective base substitutions are indicated. Horizontal arrows represent the sixth and seventh repeats. The recognition sequences for IHF (3) and DnaA protein (27) are underlined with thin and thick lines, respectively. (D)pir-promoter-operator segment from positions 362 to 439, with the consensus -35 and -10 sequences of P3 indicated by brackets. Two families of repeats, the eighth 22-bp direct repeat and two 9-bp inverted repeats, are indicated by horizontal arrows.

MATERIALS AND METHODS Strains and plasmids. Bacterial strains and plasmids used in this study are described in Table 1. General methods. Total cell lysates of E. coli cells were prepared by the method of Filutowicz et al. (6). In vitro recombinant DNA techniques were performed by the method of Maniatis et al. (15). Restriction enzymes, E. coli RNA polymerase, T4 polynucleotide kinase, and T4 DNA ligase were obtained from New England BioLabs or Bethesda Research Laboratories, Inc., and used according to the manufacturer's specifications. Galactokinase assay. Plate assays for galactokinase activity were performed on MacConkey agar media (Difco) with galactose as the sole source of carbon. The enzymatic assays

were performed by the method of McKenney et al. (17) by using ["4C]galactose (Amersham, Inc.). In vitro site-specific mutagenesis. Sodium Pisulfite-induced mutagenesis was carried out on the -y-origin region by using gapped circular DNA molecules as described previously (16). The oligonucleotide-directed mutagenesis was carried out on the 277-bp HindIII-BglII fragment of the -y-origin, using the synthetic 18-mers CTGAT'lTATATGAATT'lT and CTGATTTATATAAATI'T. The 277-bp fragment was cloned into M13mp7, and the oligonucleotides were used in addition to the 17-mer universal primer (IBI, Inc.) to generate mutations at nucleotide 79 by the method of Zoller and Smith (28). Mutagenic oligonucleotides were labelled at the 5' end with [y-32P]ATP (Amersham, Inc.) and used as probes

NOVEL PROMOTER IN REPLICATION REGION OF PLASMID R6K

VOL. 174, 1992

4779

TABLE 1. Strains and plasmids E. coli strain or plasmid

Strains C2110 N100 C600 Plasmids pAG168 pAG168.1 pAG168.3 pAG169 pAG169.1 pAG169.3 pAG169.19 pAG169.21 pAG172

pKO4 pMM13 pMM13.1 pMM13.3 pMM3

pMM3-y167 pPM5 pPM52 pPR1

pPR1A14

Source or reference

Descrption

poLA his rha

13 17

galK2 recA3 thr leu thi lacY tonA supE44

13

277-bp HindIII-BgII fragment from the y-origin cloned upstream of the galK gene in pKO4 pAG168 carrying mutation P2-201 pAG168 carrying mutation P2-203 400-bp HaeII-BglII fragment encompassing the functional -y-origin cloned upstream of the galK gene in pKO4 pAG169 carrying mutation P2-201 pAG169 carrying mutation P2-203 pAG169 carrying mutation P1-119 pAG169 carrying mutation P1-121 124 bp of the y-origin cloned into the HindIII site of pKO4 pBR322 derivative containing a promoterless galK gene pBR322hybrid replicon derived from pPM31 (17) that contains a 1,961-bp sequence from R6K pMM13 containing mutation P2-201 pMM13 containing mutation P2-203 pBR322 derivative carrying a HaeII fragment encompassing the y-origin pMM3 carrying a site-specific mutation in the second repeat of the -y-origin pKO4 derivative containing the remaining 233-bp fragment of the y-origin pKO4 derivative containing the 1,594-bp BglII fragment RK2 derivative carrying a 1,594-bp BglII fragment encompassing the pir gene Bal 31-treated derivative of pPR1

to detect the mutated clones in plaque lift experiments. M13mp7 subclones of the wild-type (wt) and the mutated -y-origin were sequenced by the dideoxy chain termination method (20). Searches for the consensus promoter sequence and the appropriate oligonucleotides were performed with the Los Alamos program SEQFIT on a digital VAX com-

puter.

DNA hybridization assays. DNA hybridization analysis carried out as described previously (6) with the probes generated by nick translation (15) using [a- 2P]dCTP (Amersham, Inc.). Determination of plasmid copy number. Negatives of the gel photographs (Polaroid film type 55) were scanned with Hoefer Scientific Instruments densitometer GS300, using program GS370 data system (Apple MacIntosh version).

was

RESULTS Isolation of mutants in the putative promoter sequence in the -y-origin. Synthetic oligonucleotides were produced to carry out mutational analysis of the P1 promoter sequence. Since the T at coordinate 79 is the most conserved base in the consensus -10 sequence of E. coli promoters (10), it was expected that either of two synthetically made mutations (Fig. 1B), P1-119 (T--+G transversion) or P1-121 (T--+A transversion), would result in a substantial reduction of activity or would inactivate the promoter. Surprisingly, however, when the HindIII-BglII fragment containing either of the mutations was cloned upstream of the galK gene of the vector pKO4 (16) the galactokinase activity of strain N100 harboring these constructs (pAG169.19 and pAG169.21, respectively) was comparable to that of an isogenic control containing the wt HindIII-BglII fragment (Table 2). Genetic analysis reveals that the active promoter sequence lies to the right of an AT-rich region in the y-origin. The undetectable effect of either transversion introduced into the

This study This study This study This study This study This study This study This study This study 17 This study This study This study 16 This study This study 18 6 16

-10 sequence of P1 on the transcription starting within the -y-origin suggested that either the P1 promoter could function with one of the most conserved bases mutated or the transcription emanating from the 227-bp HindIII-BglII fragment originated from a site located elsewhere on the fragment. To assess the likelihood of these two alternatives, a computer analysis of the y-origin sequence (see Materials and Methods) was carried out. It revealed a second match with the consensus RNA polymerase binding site, termed P2, located in the region overlapping the sixth and the seventh repeats (Fig. 1C). Thus, it seemed possible that the transcription in this region starts from the other end of the repeat cluster. To physically separate P1 from P2, we took advantage of a HindIII site in the second repeat of a mutant from -y167 of TABLE 2. Galactokinase assays of the wt and mutant P1 and P2 sequences cloned into pKO4 Plasmid(s)

Promoter

Mutation in

sequence(s)

promoter

of R6K

pAG169 pAG172 pPM5 pPM52 pAG169.1 pAG169.3 pAG169.19 pAG169.21 pAG169 and pPR1 pAG169 and pPR114

P1 and P2 P1 P2 P3 + rr P1 and P2 P1 and P2 P1 and P2 P1 and P2 P1 and P2 P1 and P2

sequence" None (wt) None (wt) None (wt) None (wt) C--T (222, P2) G--A (225, P2) T-*G (80, P1) T--A (80, P1) None (wt) None (wt)

% Galactokinase

activityb 100 0 140

1,124 4 9 118 123