Cell. Vol. 64, 91-97,
January
11, 1991, Copyright
0 1991 by Cell Press
Identification of an Autocrine Negative G rowth Factor: Mouse P-GalactosideBinding Protein Is a Cytostatic Factor and Cell G rowth Regulator Valerie Wells and Livio Mallucci Laboratory of Cellular and Molecular Biology Division of Microbiology United Medical and Dental School of Guy’s and St. Thomas’s Hospitals Medical School, Guy’s Campus London Bridge SE1 9RT England
Summary Murine P-galactoslde-binding protein, a proteln classified as a soluble &tin, is shown to be a cell growthmgulatory rnokcub and a qtostabc factor. The gmwthinhibitory effect Is not relatedto lectln properties, and competltlon assays Indicate that the protein binds to specific cell surface receptors wlth high affinity. It exerts control in G O and at 02, both as a regulator of cell replication and as a cytostatic factor. Introduction Proliferation of eukaryotic cells is stimulated by mitogens and growth-promoting factors. However, in cells committed to growth, transition through the cell cycle is determined by programmed pathways. Animal cells can constitutively produce factors that restrict growth, as is the case for interferons (IFNs) (Revel et al., 1982; Creasy et al., 1983; Wells and Mallucci, 1985) the role of which in cell cycle progression we have recently investigated (Mallucci et al., 1983; Wells and Mallucci, 1988). We found that in normal mouse embryo fibroblasts (MEFa), neutralization of endogenously produced IFNs (Wells and Mallucci, 1985) by specific antibodies results in the shortening of the cell cycle, and we have mapped the controlling effect to the second half of Gl (Wells and Mallucci, 1988). Unlike IFNs, other growth inhibitors produced by animal cells (Wang and Hsu, 1987) are little known. With the exception of a mammary gland-derived 13 kd polypeptide (Bohmer et al., 1987) and TGF-8 (Frocklick et al., 1983; Roberts et al., 1983) which can have either a stimulatory or an inhibitory effect (Roberts et al., 1985; Tucker et al., 1984; Massague, 1985) none has been characterized at the molecular level, and their mechanisms of action are not known. In previous studies (Wells and Mallucci, 1983) we have shown that normal MEFs release a protein factor that can reversibly inhibit cell proliferation. Our aim has thus been to determine the nature and the biological significance of this factor. We have identified the factor as murine P-galactoside-binding protein (mGBP), a protein classified as a soluble lectin (Barondes, 1984) and have found that the protein is a cell growth-regulatory molecule. mGBP controls exit from G O and 62 traverse into cell division, both as a regulatory molecule constitutively active during cell replication and as a cytostatic factor. Its mode of action
is not attributable to that of a lectin but is instead consistent with mechanisms involving ligand-receptor interaction. Results Characterization and Recombinant Expression Initial purification of growth-inhibitory activity was obtained by Sephadex fractionation of soluble proteins secreted by MEFs in serum-free medium (Wells and Mallucci, 1983). For further purification we used reverse-phase HPLC (Figure 1A). Growth-inhibitory activity was isolated in a peak containing a single component with an apparent M, of 15,000, the staining intensity of which varied with growthinhibitory activity (Figure lA, inset). The relationship of this component to cell growth inhibition was reassessed after migration on and elution from a nonreducing SDSpolyacrylamide gel (Figure 1B). We identified the protein as mGBP from the amino acid sequences of peptides separated by reverse-phase HPLC after tryptic digestion (Figure 2, top). Comparison of these sequences with those of corresponding proteins of rat (Clerch et al., 1988) human (Gitt and Barondes, 1988; Abbott and Feizi, 1989; Couraud et al., 1989) and chicken (Ohyama et al., 1988), gives homologies of 98%, 89%, and 500/o, respectively. Using synthetic probes based on the amino acid sequence MEAINYMAA, we isolated a 110 bp cDNA from a h-gtl0 library. We used this to screen a CDM8 plasmid library and obtain the first complete cDNA of mGBP (clone MW2, Figure 2), which consists of 495 nucleotides with an open reading frame of 405 bp encoding a protein of 134 amino acids and a translated M, of 14,735. Cloning of the mGBP gene, which consists of four exons, will be described elsewhere. We obtained the recombinant protein (r-mGBP) by transfecting COSl cells with cDNA clone MW2 (Figure 2) in a high expression plasmid, CDM8 (Seed, 1987). The protein was purified by immunoaffinity chromatography using the IgG fraction of a neutralizing monoclonal antibody (clone 82) raised to HPLC-isolated protein and by asialofetuin-Sepharose chromatography. Growth Inhibition by mGBP: Evidence for Affinity Binding We examined the effect of the natural and the recombinant proteins on cell replication. Since P-galactosidebinding proteins have been classified as dimeric lectins (Barondes, 1984) we also examined the effect of the tetramerit plant lectin concanavalin A (ConA) and that of its dimerit succinyl derivative. The linear dose response in logarithmically growing cells seen in Figure 3A shows 50% inhibition of cell replication at 200 rig/ml and growth arrest at 400 nglml. Direct observation showed that when replication had been arrested, cells developed larger cytoplasmic areas and larger nuclei than did the control population, and developed double nuclei in some cases (Figures 38 and 3C). These features are consistent with a
Cell 92
30
cnitnle
50
40
,
GO
6 0.4
m-
m0.3 10.
5 in cd s
2.’ 0.2
2.2.
ci 6
Iyc
m0.1 1%
r,,,,,,,,i,.,,,,,,,;,,,,,~,,,1,,...,,,,f Figure 1. Purification
of Growth-Inhibitory
L1
a0
60
40
,,I,,,,
07
.I
,a 17 I/c. ““rnta
10
m
10
.I ro
IO
a0
m
Activity from MEFs
(A) Reverse-phase HPLC of Sephadex G-75 fractions with growth-inhibitory activity from serum-free conditioned medium. Arrow indicates peak of activity. Inset: protein analysis of active HPLC fractions and related growth-inhibitory activity. (B) Growth-inhibitory activity and protein analysis (inset) of polyacrylamide gel eluates following migration of pooled active fractions from (A) in a single lane and sequential slicing. 20
30
3 mo .ii
10 a
20
6
10
42
E 10
% 0
0
0
f 234567
12345670910111213
1 2 3 4 5 8 7 6 9101112
S*F
FNAHGDANTiVCN
NMEA
V L N L G
I NY*MAADG 5’-CTTCGCTTCAGCTTCAATC
-19
+I
ATG M
+76
A
C
GGT CTG GTC GCC ACC AAC G
I.
V
TCG GAC GCC AAG AGC TTT S
+151
GCC TGT
AAT
0
A
GCC CAT
K
S.F
A
GIG V
CGA GAC GCC AAC
S
S
CTG AAC L
N
ACC ATT
CTC
AAT
I.
N
CTC AM I.
CTG CGA AAA I.
G
GTC TCT
K
MC
K
CCT P
GGG GAA TGT G
CAC ACC AAC 1)
S
I
E
AAC I
C
‘TC L
AAA
GTT
K
”
CTG TGC CTA I.
C
L
CGG GGA GAG GTG GCC R
CAC TTC H
F
ACC AAG CAA
CAT
GGC ACC TCG CGA ACC
GAG GTG TGC ATC
ACC
TTT
CGC CTC AAC
GAG GCC ATC
G
E
AAT
CCT
N
P
V
A
CGC TTC R
F
GAA CAC CCC CAA
NAHGDANTlYCNTKEDGTWGTEHRE
+226
CCT GCC TCC
CCT
TTC
CAG CCT
GGG AGC ATC
ACA
GAC CAG CCT
GAC CTG ACC ATC
AAL
ATG
GGA
pAFpF”PGSITEYC,TFDQADLTIK
+301
CTG CCA GAG GGA CAT
GAA TTC
AAG TTC
CCA AAC
ATG
AAC
TAC
GCG GCG GAT
LpDGHEFKFPNRLNnEAINYnAADG
+376
GAC TTC 0
AAG ATT
F
Figure 2. Sequences
K
I
AAG TGC GTG GCC TTT K
C
V
A
F
GAG TGAAGCCAGCCAGCCTGTACCCCTCAATAAAACGCAGCTGCCTCTGCTCCCCAT~ E
of mGBP Tryptic Peptides and cDNA
(Top) Sequence analysis of tryptic peptides from HPLC fractions from Figure 1. Asterisks: amino acids read as R, Y, and C in initial peptide sequencing. The sequence used for probe construction is underlined. (Bottom) Nucleotide sequence and deduced amino acid sequence of mGBP The 495 nucleotides enclose an open reading frame of 405 bp with the ATG start codon in a favorable initiation context (Kozak, 1986). Flanking the coding region are a 5’ untranslated sequence of 19 bp and a 3’ untranslated sequence of 71 bp containing a stop codon in position 406, a consensus polyadenylation signal 23 bp farther downstream, and a tail of 19 adenosines. Sequences of tryptic peptides are underlined.
Role of mGBP in Cell Growth Regulation 93
with reports in the literature (Mackler, 1972; Ralph and Nakoinz, 1973; Trowbridge and Hilborn, 1974; McClain and Edelman, 1976; Wang et al., 1976) which demonstrate that inhibition of cell proliferation by ConA requires doses greater, by at least one or two orders of magnitude, than those shown above and that the dimeric succinyl ConA exerts no effect. This result also indicates that lectin cross-linking is not involved in the growth inhibition of mGBP In fact, sugar binding sites do not appear to be implicated in the cell-inhibitory action of mGBP, as preincubation with and exposure throughout to 100 mM competing sugars, a concentration at which solubility becomes a limiting factor, did not negate the growth-inhibitory effect. This conclusion was based on experiments in which cells were cultured for 46-72 hr and cell numbers were assessed, and on experiments in which quiescent cells were stimulated by serum and the S-G2 population was assessed. Under these conditions, cells treated with sugar alone progressed into growth while cells treated with mGBP, whether or not in the presence of sugar, did not. We therefore investigated whether and with which modalities mGBP would bind onto the cells using 1251-labeled and unlabeled protein for competition binding assays. These were carried out at 4% in the presence and in the absence of 100 mM competing sugar. Figure 4 shows that binding was not prevented by sugar and that, in both cases, binding of mGBP was blocked by a 200-fold excess of unlabeled protein, indicating that the binding was saturable. Data from Scatchard plots (Figure 4, inset) gave an estimated number of 6.6 x lo4 binding sites per cell and a & of 1.5 x lo-lo M. A similar number of binding sites could be estimated when the sugar was present, but binding was less efficient under these conditions (Kd 5.4 x 10-l” M).
Figure 3. Growth Inhibition and Morphological and to ConA and Succinyl ConA
Response
to mGf3P
(A) (Filled circles) Natural mGBP purified by HPLC. (Filled squares) r-mGBP purified by monoclonal immunoaffinity chromatography. (Open squares) ConA. (Triangles) Succinyl ConA. Growth-inhibitory activity was assessed in cells in logarithmic growth. Data plotted are based on several experiments. Standard errors ranged from *2.29/o to *4.9%. (B) Control cells at 40 hr after seeding. (C) Cells treated with mGBP (400 nglml) from 4 to 40 hr.
block prior to cell division (G2) following DNA replication and cell growth in preparation for mitosis. In contrast to mGBP, neither ConA nor succinyl ConA had any effect on cell replication. This is in agreement
Cell Cycle Analysis of Cytostatic Effect by mGBP To determine whether growth inhibition was related to growth state, as in the case of interferon (Lin et al., 1966; Wells and Mallucci, 1966) we used cells stationed in G O and cells rescued from G O by growth factor or serum stimulation, as shown in Figure 5. We found that cells treated in G O remained in G O (Figure 5c), at the time when control cells (Figure 5b) were traversing G2. A minimum exposure period of about 3 hr prior to serum stimulation was necessary, possibly for new events to take place. Neither ConA nor succinyl ConA had any effect (data not shown). At concentrations of 400-50 nglml cells had not yet divided by the time control cells had completed their cycle. Thus, like IFNs, though not necessarily via the same mechanisms of action, mGBP can inhibit cell proliferation by blocking cells in GO. Unlike interferon, mGBP had no effect on Gl traverse. When added early in Gl (Figure 5d), it did not alter time of entry or excursion into S phase (Figure 5d, 13 hr and 15 hr). On the other hand, it exerted an effect later in the cycle, affecting traverse from late S phase through G2 and holding cells in G2 (Figure 5d, 19 hr and 21 hr). At doses from 400 to 50 rig/ml cells had not divided by the time the control cells had repticated. At 10 ng cell division was delayed for several hours. The effect at G2 and the inhibition of cell replication also occurred when mGBP
Cdl 94
2000
1000
.
Competitor,
.
nM
Figure 4. Affinity Binding of r-mGBP to MEFs Affinity binding of r-mGBP in the absence (A) and in the presence (B) of 106 mM lactose; 0.625 ng of t*sl-r-mGBP was present per 2 x lo5 cells in each well. Points are means of triplicates. Insets represent Scatchard plots.
was added 6 hr before the expected time of the G2 peak (Figure 5e, 19 hr and 21 hr).
Physiological Role of mGBP Although addition of mGBP can arrest proliferation of MEFs by blocking cells in GO and in G2, the constitutively produced protein may be a regulatory molecule. To investigate this possibility, we used the IgG fraction of a neutralizing monoclonal antibody (clone 82) to mGBP and measured, by cell cycle analysis, the effects of neutralization of endogenously produced protein. In the experiments of Figure 6, cells were treated in GO (Figure 6) and prior to entry into G2 (Figure 6). Figure 6A shows that cells treated with the antibody during GO (c) were traversing S phase some 2 hr earlier than were control cells (b). This indicates that in MEFs constitutive GBP has a role in maintaining cells in the stationary state. On the other hand, treatment from the time of Gl initiation did not alter the time of entry into S phase (data not shown), indicating that mGBP exerts no control on Gi. Figure 6B shows that in cells exposed to the antibody be-
Figure 5. Effect of r-mGBP on Cell Cycle Progression of MEFs (a) Cell population in GO, prior to serum stimulation. (b) Cells stimulated by addition of 10% fetal calf serum. (c) Cells treated with r-mGBP (400 nglml) during GO from 4 hr prior to serum stimulation. (d) Cells treated from 3 hr after serum stimulation (early Gl). (e) Cells treated from 6 hr prior to G2 peak. Hours indicate time after stimulation. Histograms represent DNA distribution by FACS analysis.
fore entering G2 (c), there was an earlier shift from S to G2, with earlier development of the G2 peak than in controls (b), indicating that a control during this period was being exerted. These experiments, like those of Figure 5, were done in single or duplicate assays owing to the difficulty of maintaining precision while handling several cultures for FACS analysis simultaneously. Subsequent repetitions of the experiments gave identical results. No changes in cell cycle progression or in the rate of cell division were observed in cells treated with an IgG fraction from nonimmunized mice.
Role of mGBP in Cell Growth Regulation 95
7 1, t i at 1\
Discussion 8-Galactoside-binding proteins have been classified as soluble dimeric lectins, the functions of which are not known (Barondes, 1984). We find that mGBP inhibits the replication of MEFs through a cytostatic effect unrelated to its reported lectin properties. In fact, although the mGBP used in our studies has carbohydrate-binding activity, since it can be bound on and eluted by competing sugars from an asialofetuin-Sepharose column, conditions that block the sugar-binding sites of the molecule do not negate its growth-inhibitory effect nor prevent binding onto cells. Binding must therefore occur through molecular domains other than those that link saccharide determinants. This is indicated by the experiment in which mGBP is shown to bind to approximately 5-10 x lo4 saturable binding sites per cell, even in the presence of 100 mM lactose (see Figure 3), although binding in this case is less efficient. The high sugar concentration may also lead to a degree of adherence among the mGBP molecules reflected in the higher cpm values of the competition curve. That the site of binding is a physiological receptor for mGBP is suggested by the following. After labeling, the protein retained growth-inhibitory activity; by electrophoretie separation it migrated with an M, equivalent to that of the native protein; and concentrations that saturate the binding sites are close to those that have a growth-inhibitory effect. Interestingly, we found by means of PAGE and gel filtration analysis that mGBP separates under all conditions as a single component with an M, of 45,000,
B
Figure 6. Effect of Treatment with Neutralizing Monoclonal Antibody to mGBP (A) Treatment during GO. (a) Cell population in GO, prior to serum stimulation. (b) Cells stimulated by addition of 10% fetal calf serum. (c) Cells treated with antibody from 6 hr prior to serum stimulation. (S) Treatment prior to entry into G2. (a) Cell population in GO, prior to serum stimulation. (b) Cells stimulated by addition of 10% fetal calf serum. (c) Cells stimulated by addition of 10% fetal calf serum and treated with antibody from 6 hr prior to G2 peak. Hours indicate time after serum stimulation. Histograms represent DNA distribution by FACS analysis.
indicating that in its native and functional state as a growth inhibitor mGBP is not a dimeric molecule. Larger molecular forms for GBP of various origins have been reported (de Waard et al., 1978; Childs and Feizi, 1979; Powell, 1980; Roff et al., 1983; Cerra et al., 1985), but there is no evidence that any of these molecules acquire a dimeric configuration by isologous association (Monod et al., 1985). Based on the example of IFNs, which inhibit cell proliferation with effects in G O and in Gl, the general properties of a cell growth inhibitor of physiological derivation would include cell stage specificity. Our results show that cells treated in G O remained in G O and that cells treated prior to G2 were affected in the G2 traverse and did not divide. A block in G2 could account for the larger cytoplasmic areas and larger nuclei that develop in the arrested cell population (see Figure 38). That a minimum exposure period of -3 hr prior to serum stimulation was required to keep G O cells from resuming growth adds interest to the picture of the ligand-receptor system that has emerged from our analysis, as it suggests transduction events. However, we have not been able to establish the minimum exposure time required to impede traverse through G2, owing to a dispersion of 2-3 hr in the population entering G2. In contrast to the effect of mGBP, blocking of cell proliferation by nonspecific inhibitors, such as that caused by lectin cross-linking, has no cell stage specificity, and it occurs at concentrations well above those required for effector molecules. In considering a physiological role for mGBP it should
Cell 96
be noted that mGBP is expressed constitutively. Hence, as in the case of IFNs, which are also expressed constitutively, the capacity of mGBP to operate as a physiological effector in the process of cell replication can be investigated by negating its presence. The evidence shown in Figure 6 indicates that mGBP has a role in the control of GO and in the control of G2. In the presence of a neutralizing monoclonal antibody to mGBP, exit from GO was anticipated and traverse through G2 was accelerated. Interestingly, GO and G2 are the two stages in which the molecule also operates as a cytostatic factor. This poses a similarity with IFNs, which act both as cytostatic factors and as growth modulators within the two defined periods of GO and Gl. We do not know whether there is a functional relationship between IFN and mGBP, but no particular assumption needs to be made at this stage. However, the fact that as growth inhibitors IFNs are more stable proteins than mGBP (unpublished data) might indicate a primary paracrine function in the first instance and an autocrine function in the second. Experimental Procedures CSIIS
Secondary cultures of embryonic fibroblasts from C57BL mice (MEFs) were grown to confluence in 25 cm2 flasks with Eaglh BHK medium and 10% newborn calf serum in an atmosphere of 5% CO?. Cultures were kept in 05% serum medium for 2 days and were induced to resume growth by the addition of fetal calf serum to a final concentration of 10%. For logarithmic growth, cells were seeded at a density of 2 x l@/cm* in 25 cm2 flasks in BHK medium with 5% fetal calf serum and 5% CO*. In order to obtain a high degree of reproducibility in cell growth kinetics, the flasks were sealed and incubation was carried out in a water bath at 3PC. Population distribution during cell cycle was assessed by FACS analysis. Details of these procedures were as described previously (Mallucci et al., 1983; Wells and Mallucci, 1985).
incubation was continued for 12 hr. Peptides were loaded directly onto a Cl8 reverse-phase HPLC column equilibrated in 0.08% trifluoroacetic acid. A gradient from 0% to to 60% acetonitrile was run over 75 min at 1 mllmin, and 0.5 ml fractions were collected. Sequence determination was carried out using an Applied Biosystems 470A gas-phase sequencer. PTH amino acid analysis was performed on-line using an Applied Biosystems 120A analyzer (Hunkapiller, 1985). Quantitative PTH amino acid recovery was measured with a Shimadzu CRBA recording integrator.
cDNA Cloning and Recombinant Expression cDNAs were isolated in two steps. First they were isolated from a lgtl0 library constructed using poly(A)+ RNA from tertiary C57BL MEFs screened with a combination of four synthetic oligonucleotide probes based on the amino acid sequence MEAINYMAA, which is part of one of the isolated peptides. A 110 bp cDNA from the phage library enclosing one of the oligonucleotide constructs was then used to screen a CDM8 (Seed, 1987) plasmid library made with size-fractionated cDNAs (400-1200 bp) prepared from mouse fibroblast poly(A)+ RNA. Xhol cDNA inserts were selected by size and analyzed by the Sanger dideoxynucleotide termination method. A full coding sequence cDNA (clone MW2) in plasmid CDM8 containing an Ml3 origin of replication, a CMV promoter, and a polyadenylation site was used for transfection (Seed, 1987). COSl cells were plated in GMEM medium with 10% fetal calf serum at 2 x 18 cells per 10 cm tissue culture dish 24 hr before transfection. Cells were transfected with 10 ng of plasmid DNA using DEAE-dextran and DMSO-facilitated uptake according to standard methods and were harvested at 48-72 hr. mGBP was purified by immunoaffinity chromatography using the IgG fraction of a neutralizing monoclonal antibody (clone 82) raised to HPLC-isolated protein and by asialofetuin-Sepharose chromatography.
Monoclonal Antlbodles mGBP purified by HPLC and eluted from a sliced gel was used to raise monoclonal antibodies. ELISA-positive clones from BALB/c-NS-1 myeloma hybrids were subcloned twice, and the IgG fractions were purified using rabbit anti-mouse IgG. The antibody from clone 82, found to negate the growth-inhibitory activity of mGBP at a molecular ratio of l:l, was used for neutralization experiments and immunoaffinity purification. An IgG fraction from nonimmune C57BL mice was used as a control.
mGBP Purlflcatlon and !hquenclng Growth-inhibitory activity was isolated in Sephadex G-75 fractions of serum-free conditioned medium from C57BL secondary MEFs, as described by Wells and Mallucci (1983). Approximately 250 pg protein was loaded onto a Cl8 reverse-phase HPLC column equilibrated with 0.08% trifluoroacetic acid. A gradient from 20% to 80% acetonitrile was run over 45 min at 1.5 mllmin, and 0.75 ml fractions were collected. Growth-inhibitory activity was tested in MEFs grown in Falcon multiwell microplates in duplicate cultures. Cells were fixed with methanol after 48 hr. and cells were counted in five random fields using an eyepiece graticule. Fractions with growth-inhibitory activity were analyzed by lo%-15% SDS-polyacrylamide gradient gel followed by Bio-Rad silver staining. Fractions were found to contain one component (M, 15,000) with a staining intensity that varied according to levels of growth-inhibitory activity. Approximately 200 nl of the pooled active fractions was freeze-dried and taken up in 50 nl sample buffer and run in a single lane of a 12% polyacrylamide slab gel containing 0.1% SDS. The lane was cut into 2 mm slices, and each slice was eluted into 300 nl of Eagle’s BHK medium and shaken overnight on a rotary shaker at 4OC. Approximately 200 pl of each recovered supernatant was spun for 15 min at 10,000x g at 4%. Fifty microliters was run on a 12% SDS-polyacrylamide slab gel to be stained with Bio-Rad silver stain. The remaining 150 nl was then made to contain 5% fetal bovineserum and 1% fatty acid-free bovine serum albumin and was assessed for growth-inhibitory activity in Falcon multiwell microplates. For partial amino acid sequence analysis the HPLC pool was reduced and alkylated (Bennett et al., 1980; Waterfield and Scrace, 1981) dialyzed against 10 mM ammonium bicarbonate, lyophilized, and resuspended in 10 mM ammonium bicarbonate. TPCK-treated trypsin was then added (1OO:l. protein:trypsin [w/w]). The mixture was incubated at Jpc for 12 hr. Another identical aliquot of trypsin was added, and the
Protein lodlnatlon and Binding Assays Immunoaffinity-purified mGBP was radioiodinated by mixing 1 pg with 500 PCi of carrier-free Na1s51 (Amersham) in 100 nl of 100 mM NaPi (pH 7) using preloaded lodo-bead iodination reagent (Pierce). After stopping the reaction, 300 pl of 100 mM NaPi with 0.1% BSA was added, and the iodinated protein was separated on a Bio-Rad DGlO column equilibrated with 0.1% BSA in 100 mM Nap,. Specific activity ranged from 4 x lo5 to 8 x lo5 cpmlng. Samples were checked by polyacrylamide gel electrophoresis and tested for biological activity before binding assays. These were carried out at 4OC in triplicate cultures in Falcon 24-well multiwell plates. Cells (2 x 105 per well) that had been prerefrigerated and washed three times with cold binding buffer (PBS with Ca2+ and Mg2+ plus 0.1% BSA) received 0.625 ng of 1251-labeled mGBP premixed with increasing concentrations of unlabeled mGBP Equilibrium binding was reached at 3 hr. After 4 hr the cells were washed three times with cold binding buffer and solubilized in 0.1 M NaOH, 2% Na2C0s, 1% SDS. When a competing sugar (100 mM lactose) was used, it was preincubated for 20 min at room temperature with the mGBP solutions.
Acknowledgments This work has benefited from helpful comments from Paul Nurse, Stefanello de Petri& and Peter Parker, to whom we are also grateful for discussions, suggestions, and critical reading of the manuscript. We warmly thank Geoffrey Scrace, Nick Totty, and Michael Waterfield for their kindness in helping with peptide sequence analysis and Rowena Boyle, Cath Catterall, and Tim Harris for help with cDNA cloning. This work is part of a Scientific and Technical Interchange Programme funded by the Commission of the European Communities.
Role of mGBP in Cell Growth Regulation 97
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact.
Ohyama, Y., Hirabayashi, J., Oda, Y., Ohno, S., Kawasaki, H., Suzuki, K., and Kasai, K. (1986). Nucleotide sequence of chick 14K Bgalactoside-binding lectin mRNA. Biochem. Biophys. Res. Commun. 134, 51-56.
Received July 5, 1990; revised September
Powell, J. T. (1980). Purification and properties of lung lectin. Biochem. J. 187, 123-129.
2, 1990.
References Abbott, W. M., and Feizi, T. (1989). Evidence that the 14kDa soluble 8-galactoside-binding lectin in man is coded by a single gene. Biothem. J. 259, 291-294. Barondes, S. H. (1984). Soluble lectins: a new class of extracellular proteins. Science 223, 1259-1284. Bennett, H. P J., Browne, C. A., and Solomon, S. (1980). The use of perfluorinated carboxylic acid in the reversed phase HPLC of peptides. J. Liquid Chromat. 3, 1353-1385. Bohmer, F. D., Kraft, R., Otto, A., Wernsteds, A., Muller, T., Rohde, K., Etzold, G., Lehmann, C. H.. and Grosse, R. (1987). Identification of hibitor from bovine mammary gland. J. Biol.
C., Hellman, U., Kurtz, W., Langen, t?, Heldin, a polypeptide growth inChem. 262, 1537-1543.
Cerra, R. F., Gilt, M. A., and Barondes, S. (1985). Three soluble rat f3-galactoside binding lectins. J. Biol. Chem. 260, 10474-10477. Childs, R. A., and Feizi, T. (1979). !.%Galactoside-binding muscle lectins of man and monkey show antigenic cross-reactions with those of bovine origin. Biochem. J. 783, 755-758. Clerch, L. B., Whitney, P, Hass, M., Brew, K., Miller, T., Werner, R., and Massaro, D. (1988). Sequence of a full-length cDNA for rat lung f3-galactoside-binding protein: primary and secondary structure of the lectin. Biochemistry 27, 692-899. Couraud, I? O., Casentini-Borocz, D., Bringman, T. S., Griffith, J., McGrogan, M., and Nedwin, G. E. (1989). Molecular cloning, characterisation and expression of a human 1CkDa lectin. J. Biol. Chem. 264, 1310-1316. Creasey, A. A., Epstein, D. A., Marsh, Y. V, Khan, Z., and Merigan, T. C. (1983). Growth regulation of melanoma cells by interferon and (2’-5’j oligo-adenylate synthetase. Mol. Cell. Eiol. 3, 780-786. de Waard, A., Hickman, S., and Kornfeld, S. (1876). Isolation and properties of 6-galactoside binding lectins of calf heart and lung. J. Biol. Chem. 251, 7581-7587 Frocklick, C. A., Dart, L. L., Meyers, C. A., Smith, D. M., and Sporn, M. B. (1983). Purification and initial characterization of a type 8 transforming growthfactor from human placenta. Proc. Natl. Acad. Sci. USA 80, 3676-3680. Gitt, M. A., and Barondes, S. H. (1986). Evidence that a human soluble f3-galactoside-binding lectin is encoded by a family of genes, Proc. Natl. Acad. Sci. USA 83, 7603-7607.
Ralph, i?, and Nakoinz, I. (1973). Inhibitory effects of lectins and lymphocyte mitogens on murine lymphomas and myelomas. J. Natl. Cancer Inst. 51, 883-890. Raz, A., Carmi, P, and Pazerini, G. (1986). Expression of two different endogenous galactoside-binding lectins sharing sequence homology. Cancer Res. 48, 845-849. Revel, M., Kimchi, A., Friedman, M., Wolf, D., Merlin, G.. Ponet, A., Rapoport, S., and Lapidot, Y. (1982). Cell regulatory functions of interferon induced enzymes: antimitogenic effect of (2’-5’) oligo A, growth related variations in (2’-5’) oligo A synthetase, and isolation of its mRNA. Texas Rep. Biol. Med. 41, 452-462. Roberts, A. B., Anzano, M. A., Meyers, C. A., Wideman, J., Blather, R., Pan, Y.-C. E., Stern, S., Lehrman, S. R., Smith, J. M., Lamb, L. C., and Sporn, M. B. (1983). Purification and properties of a type 6 transforming growth factor from bovine kidney. Biochemistry 22, 5692-5898. Roberts, A., Anzano, M., Wakefield, L. M., Roche, N. S., Stern, D. F., and Sporn, M. (1985). Type 5 transforming growth factor: a bifunctional regulator of cell growth. Proc. Natl. Acad. Sci. USA 82, 119-123. Roff, C., Rosevear, f? R., Wang, J. L.. and Barker, Ft. (1983). Identification of carbohydrate binding proteins from mouse and human fibroblasts. Biochem. J. 277, 625-629. Seed, B. (1987). An LFA-3 cDNA encodes a phospholipid-linked membrane protein homologous to its receptor CD2. Nature 329, 840-842. Trowbridge, I. S., and Hilborn, D. A. (1974). Effects of succinyl ConAon the growth of normal and transformed cells. Nature 250, 304-307 Tucker, R. F., Shipley, G. D., Moses, H. L., and Halley, R. W. (1984). Growth inhibitor from BSC-1 cells closely related to platelet type p transforming growth factor. Science 226, 705-707, Wang, J. L., and Hsu, Y. M. (1987). Negative regulators of cell growth. In Oncogenes and Growth Factors, R. A. Bradshaw and S. Prentis, eds. (Amsterdam: Elsevier), pp. 194-200. Wang, L. J.. Gunther, G. R., and Edelman, G. M. (1976). Chemical and biological properties of dimeric concanavalin A derivatives, In Concanavalin A as a Tool, H. Bittiger and H. P Schnebli, eds. (New York. J. Wiley and Sons), pp. 585-598. Waterfield. M. D., and Scrace, G. T. (1981). Peptide separations by liquid chromatography using size exclusion and reverse phase columns, In Biological/Biomedical Applications of Liquid Chromatography, Vol. 18, G. L. Hawk, ed. (New York: Dekker), pp. 135-137.
User
Waterfield, M. D., Scrace, G., and Totty, N. (1985). Separation of mixtures of proteins and peptides by high performance liquid chromatog raphy. In Practical Protein Biochemistry, A. Darbre and M. D. Waterfield, eds. (New York: J. Wiley and Sons), pp. 181-206.
Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-293.
Wells, V., and Mallucci, L. (1983). Properties of a cell growth inhibitor produced by mouse embryo fibroblasts. J. Cell. Physiol. 777, 148-154.
Hunkapiller, M. (1985). Applied Biosystems Bulletin, No. 14.
Protein Sequencer
Lin, S. L., Kikuchi, T., Pledger, W. J., and Tamm, I. (1988). Interferon inhibits the establishment of competence in GO/S-phase transition. Science 233, 356-359. Mackler, 8. F. (1972). Effect of concanavalin lines and normal peripheral lymphocytes. 935-941.
A on human lymphoid cell J. Natl. Cancer Inst. 49,
growth factors.
Trends Bio-
McClain. D. A., and Edelman, G. M. (1976). Analysis of the stimulation inhibition paradox exhibited by lymphocytes exposed to concanavalin A. J. Exp. Med. 144, 1494-1508. Monod, J., Wyman, J., and Changeux, J. P (1965). On the nature of transition: a plausible model. J. Mol. Biol. 12, 88-118.
SllOStSriC
Wells, V., and Mallucci, L. (1988). Cell cycle regulation by autocrine interferon and dissociation between autocrine interferon and 2’-5’oligoadenylate synthetase expression. J. Interferon Res. 8, 793-802. GenBank
Mallucci, L., Rasbridge, S., and Wells, V. (1983). Cell cycle study on the effectof interferon on synchronized mouse embryofibroblasts. J. Interferon Res. 3, 181-189. Massague, J. (1985). The transforming them. Sci. 70, 237-240.
Wells, V., and Mallucci, L. (1985). Expression of the 2-5A system during the cell cycle. Exp. Cell Res. 759, 27-36.
Accession
The accession M57470.
number
Number for the sequence
reported
in this paper is
January
11, 1991, Copyright
0 1991 by Cell Press
Identification of an Autocrine Negative G rowth Factor: Mouse P-GalactosideBinding Protein Is a Cytostatic Factor and Cell G rowth Regulator Valerie Wells and Livio Mallucci Laboratory of Cellular and Molecular Biology Division of Microbiology United Medical and Dental School of Guy’s and St. Thomas’s Hospitals Medical School, Guy’s Campus London Bridge SE1 9RT England
Summary Murine P-galactoslde-binding protein, a proteln classified as a soluble &tin, is shown to be a cell growthmgulatory rnokcub and a qtostabc factor. The gmwthinhibitory effect Is not relatedto lectln properties, and competltlon assays Indicate that the protein binds to specific cell surface receptors wlth high affinity. It exerts control in G O and at 02, both as a regulator of cell replication and as a cytostatic factor. Introduction Proliferation of eukaryotic cells is stimulated by mitogens and growth-promoting factors. However, in cells committed to growth, transition through the cell cycle is determined by programmed pathways. Animal cells can constitutively produce factors that restrict growth, as is the case for interferons (IFNs) (Revel et al., 1982; Creasy et al., 1983; Wells and Mallucci, 1985) the role of which in cell cycle progression we have recently investigated (Mallucci et al., 1983; Wells and Mallucci, 1988). We found that in normal mouse embryo fibroblasts (MEFa), neutralization of endogenously produced IFNs (Wells and Mallucci, 1985) by specific antibodies results in the shortening of the cell cycle, and we have mapped the controlling effect to the second half of Gl (Wells and Mallucci, 1988). Unlike IFNs, other growth inhibitors produced by animal cells (Wang and Hsu, 1987) are little known. With the exception of a mammary gland-derived 13 kd polypeptide (Bohmer et al., 1987) and TGF-8 (Frocklick et al., 1983; Roberts et al., 1983) which can have either a stimulatory or an inhibitory effect (Roberts et al., 1985; Tucker et al., 1984; Massague, 1985) none has been characterized at the molecular level, and their mechanisms of action are not known. In previous studies (Wells and Mallucci, 1983) we have shown that normal MEFs release a protein factor that can reversibly inhibit cell proliferation. Our aim has thus been to determine the nature and the biological significance of this factor. We have identified the factor as murine P-galactoside-binding protein (mGBP), a protein classified as a soluble lectin (Barondes, 1984) and have found that the protein is a cell growth-regulatory molecule. mGBP controls exit from G O and 62 traverse into cell division, both as a regulatory molecule constitutively active during cell replication and as a cytostatic factor. Its mode of action
is not attributable to that of a lectin but is instead consistent with mechanisms involving ligand-receptor interaction. Results Characterization and Recombinant Expression Initial purification of growth-inhibitory activity was obtained by Sephadex fractionation of soluble proteins secreted by MEFs in serum-free medium (Wells and Mallucci, 1983). For further purification we used reverse-phase HPLC (Figure 1A). Growth-inhibitory activity was isolated in a peak containing a single component with an apparent M, of 15,000, the staining intensity of which varied with growthinhibitory activity (Figure lA, inset). The relationship of this component to cell growth inhibition was reassessed after migration on and elution from a nonreducing SDSpolyacrylamide gel (Figure 1B). We identified the protein as mGBP from the amino acid sequences of peptides separated by reverse-phase HPLC after tryptic digestion (Figure 2, top). Comparison of these sequences with those of corresponding proteins of rat (Clerch et al., 1988) human (Gitt and Barondes, 1988; Abbott and Feizi, 1989; Couraud et al., 1989) and chicken (Ohyama et al., 1988), gives homologies of 98%, 89%, and 500/o, respectively. Using synthetic probes based on the amino acid sequence MEAINYMAA, we isolated a 110 bp cDNA from a h-gtl0 library. We used this to screen a CDM8 plasmid library and obtain the first complete cDNA of mGBP (clone MW2, Figure 2), which consists of 495 nucleotides with an open reading frame of 405 bp encoding a protein of 134 amino acids and a translated M, of 14,735. Cloning of the mGBP gene, which consists of four exons, will be described elsewhere. We obtained the recombinant protein (r-mGBP) by transfecting COSl cells with cDNA clone MW2 (Figure 2) in a high expression plasmid, CDM8 (Seed, 1987). The protein was purified by immunoaffinity chromatography using the IgG fraction of a neutralizing monoclonal antibody (clone 82) raised to HPLC-isolated protein and by asialofetuin-Sepharose chromatography. Growth Inhibition by mGBP: Evidence for Affinity Binding We examined the effect of the natural and the recombinant proteins on cell replication. Since P-galactosidebinding proteins have been classified as dimeric lectins (Barondes, 1984) we also examined the effect of the tetramerit plant lectin concanavalin A (ConA) and that of its dimerit succinyl derivative. The linear dose response in logarithmically growing cells seen in Figure 3A shows 50% inhibition of cell replication at 200 rig/ml and growth arrest at 400 nglml. Direct observation showed that when replication had been arrested, cells developed larger cytoplasmic areas and larger nuclei than did the control population, and developed double nuclei in some cases (Figures 38 and 3C). These features are consistent with a
Cell 92
30
cnitnle
50
40
,
GO
6 0.4
m-
m0.3 10.
5 in cd s
2.’ 0.2
2.2.
ci 6
Iyc
m0.1 1%
r,,,,,,,,i,.,,,,,,,;,,,,,~,,,1,,...,,,,f Figure 1. Purification
of Growth-Inhibitory
L1
a0
60
40
,,I,,,,
07
.I
,a 17 I/c. ““rnta
10
m
10
.I ro
IO
a0
m
Activity from MEFs
(A) Reverse-phase HPLC of Sephadex G-75 fractions with growth-inhibitory activity from serum-free conditioned medium. Arrow indicates peak of activity. Inset: protein analysis of active HPLC fractions and related growth-inhibitory activity. (B) Growth-inhibitory activity and protein analysis (inset) of polyacrylamide gel eluates following migration of pooled active fractions from (A) in a single lane and sequential slicing. 20
30
3 mo .ii
10 a
20
6
10
42
E 10
% 0
0
0
f 234567
12345670910111213
1 2 3 4 5 8 7 6 9101112
S*F
FNAHGDANTiVCN
NMEA
V L N L G
I NY*MAADG 5’-CTTCGCTTCAGCTTCAATC
-19
+I
ATG M
+76
A
C
GGT CTG GTC GCC ACC AAC G
I.
V
TCG GAC GCC AAG AGC TTT S
+151
GCC TGT
AAT
0
A
GCC CAT
K
S.F
A
GIG V
CGA GAC GCC AAC
S
S
CTG AAC L
N
ACC ATT
CTC
AAT
I.
N
CTC AM I.
CTG CGA AAA I.
G
GTC TCT
K
MC
K
CCT P
GGG GAA TGT G
CAC ACC AAC 1)
S
I
E
AAC I
C
‘TC L
AAA
GTT
K
”
CTG TGC CTA I.
C
L
CGG GGA GAG GTG GCC R
CAC TTC H
F
ACC AAG CAA
CAT
GGC ACC TCG CGA ACC
GAG GTG TGC ATC
ACC
TTT
CGC CTC AAC
GAG GCC ATC
G
E
AAT
CCT
N
P
V
A
CGC TTC R
F
GAA CAC CCC CAA
NAHGDANTlYCNTKEDGTWGTEHRE
+226
CCT GCC TCC
CCT
TTC
CAG CCT
GGG AGC ATC
ACA
GAC CAG CCT
GAC CTG ACC ATC
AAL
ATG
GGA
pAFpF”PGSITEYC,TFDQADLTIK
+301
CTG CCA GAG GGA CAT
GAA TTC
AAG TTC
CCA AAC
ATG
AAC
TAC
GCG GCG GAT
LpDGHEFKFPNRLNnEAINYnAADG
+376
GAC TTC 0
AAG ATT
F
Figure 2. Sequences
K
I
AAG TGC GTG GCC TTT K
C
V
A
F
GAG TGAAGCCAGCCAGCCTGTACCCCTCAATAAAACGCAGCTGCCTCTGCTCCCCAT~ E
of mGBP Tryptic Peptides and cDNA
(Top) Sequence analysis of tryptic peptides from HPLC fractions from Figure 1. Asterisks: amino acids read as R, Y, and C in initial peptide sequencing. The sequence used for probe construction is underlined. (Bottom) Nucleotide sequence and deduced amino acid sequence of mGBP The 495 nucleotides enclose an open reading frame of 405 bp with the ATG start codon in a favorable initiation context (Kozak, 1986). Flanking the coding region are a 5’ untranslated sequence of 19 bp and a 3’ untranslated sequence of 71 bp containing a stop codon in position 406, a consensus polyadenylation signal 23 bp farther downstream, and a tail of 19 adenosines. Sequences of tryptic peptides are underlined.
Role of mGBP in Cell Growth Regulation 93
with reports in the literature (Mackler, 1972; Ralph and Nakoinz, 1973; Trowbridge and Hilborn, 1974; McClain and Edelman, 1976; Wang et al., 1976) which demonstrate that inhibition of cell proliferation by ConA requires doses greater, by at least one or two orders of magnitude, than those shown above and that the dimeric succinyl ConA exerts no effect. This result also indicates that lectin cross-linking is not involved in the growth inhibition of mGBP In fact, sugar binding sites do not appear to be implicated in the cell-inhibitory action of mGBP, as preincubation with and exposure throughout to 100 mM competing sugars, a concentration at which solubility becomes a limiting factor, did not negate the growth-inhibitory effect. This conclusion was based on experiments in which cells were cultured for 46-72 hr and cell numbers were assessed, and on experiments in which quiescent cells were stimulated by serum and the S-G2 population was assessed. Under these conditions, cells treated with sugar alone progressed into growth while cells treated with mGBP, whether or not in the presence of sugar, did not. We therefore investigated whether and with which modalities mGBP would bind onto the cells using 1251-labeled and unlabeled protein for competition binding assays. These were carried out at 4% in the presence and in the absence of 100 mM competing sugar. Figure 4 shows that binding was not prevented by sugar and that, in both cases, binding of mGBP was blocked by a 200-fold excess of unlabeled protein, indicating that the binding was saturable. Data from Scatchard plots (Figure 4, inset) gave an estimated number of 6.6 x lo4 binding sites per cell and a & of 1.5 x lo-lo M. A similar number of binding sites could be estimated when the sugar was present, but binding was less efficient under these conditions (Kd 5.4 x 10-l” M).
Figure 3. Growth Inhibition and Morphological and to ConA and Succinyl ConA
Response
to mGf3P
(A) (Filled circles) Natural mGBP purified by HPLC. (Filled squares) r-mGBP purified by monoclonal immunoaffinity chromatography. (Open squares) ConA. (Triangles) Succinyl ConA. Growth-inhibitory activity was assessed in cells in logarithmic growth. Data plotted are based on several experiments. Standard errors ranged from *2.29/o to *4.9%. (B) Control cells at 40 hr after seeding. (C) Cells treated with mGBP (400 nglml) from 4 to 40 hr.
block prior to cell division (G2) following DNA replication and cell growth in preparation for mitosis. In contrast to mGBP, neither ConA nor succinyl ConA had any effect on cell replication. This is in agreement
Cell Cycle Analysis of Cytostatic Effect by mGBP To determine whether growth inhibition was related to growth state, as in the case of interferon (Lin et al., 1966; Wells and Mallucci, 1966) we used cells stationed in G O and cells rescued from G O by growth factor or serum stimulation, as shown in Figure 5. We found that cells treated in G O remained in G O (Figure 5c), at the time when control cells (Figure 5b) were traversing G2. A minimum exposure period of about 3 hr prior to serum stimulation was necessary, possibly for new events to take place. Neither ConA nor succinyl ConA had any effect (data not shown). At concentrations of 400-50 nglml cells had not yet divided by the time control cells had completed their cycle. Thus, like IFNs, though not necessarily via the same mechanisms of action, mGBP can inhibit cell proliferation by blocking cells in GO. Unlike interferon, mGBP had no effect on Gl traverse. When added early in Gl (Figure 5d), it did not alter time of entry or excursion into S phase (Figure 5d, 13 hr and 15 hr). On the other hand, it exerted an effect later in the cycle, affecting traverse from late S phase through G2 and holding cells in G2 (Figure 5d, 19 hr and 21 hr). At doses from 400 to 50 rig/ml cells had not divided by the time the control cells had repticated. At 10 ng cell division was delayed for several hours. The effect at G2 and the inhibition of cell replication also occurred when mGBP
Cdl 94
2000
1000
.
Competitor,
.
nM
Figure 4. Affinity Binding of r-mGBP to MEFs Affinity binding of r-mGBP in the absence (A) and in the presence (B) of 106 mM lactose; 0.625 ng of t*sl-r-mGBP was present per 2 x lo5 cells in each well. Points are means of triplicates. Insets represent Scatchard plots.
was added 6 hr before the expected time of the G2 peak (Figure 5e, 19 hr and 21 hr).
Physiological Role of mGBP Although addition of mGBP can arrest proliferation of MEFs by blocking cells in GO and in G2, the constitutively produced protein may be a regulatory molecule. To investigate this possibility, we used the IgG fraction of a neutralizing monoclonal antibody (clone 82) to mGBP and measured, by cell cycle analysis, the effects of neutralization of endogenously produced protein. In the experiments of Figure 6, cells were treated in GO (Figure 6) and prior to entry into G2 (Figure 6). Figure 6A shows that cells treated with the antibody during GO (c) were traversing S phase some 2 hr earlier than were control cells (b). This indicates that in MEFs constitutive GBP has a role in maintaining cells in the stationary state. On the other hand, treatment from the time of Gl initiation did not alter the time of entry into S phase (data not shown), indicating that mGBP exerts no control on Gi. Figure 6B shows that in cells exposed to the antibody be-
Figure 5. Effect of r-mGBP on Cell Cycle Progression of MEFs (a) Cell population in GO, prior to serum stimulation. (b) Cells stimulated by addition of 10% fetal calf serum. (c) Cells treated with r-mGBP (400 nglml) during GO from 4 hr prior to serum stimulation. (d) Cells treated from 3 hr after serum stimulation (early Gl). (e) Cells treated from 6 hr prior to G2 peak. Hours indicate time after stimulation. Histograms represent DNA distribution by FACS analysis.
fore entering G2 (c), there was an earlier shift from S to G2, with earlier development of the G2 peak than in controls (b), indicating that a control during this period was being exerted. These experiments, like those of Figure 5, were done in single or duplicate assays owing to the difficulty of maintaining precision while handling several cultures for FACS analysis simultaneously. Subsequent repetitions of the experiments gave identical results. No changes in cell cycle progression or in the rate of cell division were observed in cells treated with an IgG fraction from nonimmunized mice.
Role of mGBP in Cell Growth Regulation 95
7 1, t i at 1\
Discussion 8-Galactoside-binding proteins have been classified as soluble dimeric lectins, the functions of which are not known (Barondes, 1984). We find that mGBP inhibits the replication of MEFs through a cytostatic effect unrelated to its reported lectin properties. In fact, although the mGBP used in our studies has carbohydrate-binding activity, since it can be bound on and eluted by competing sugars from an asialofetuin-Sepharose column, conditions that block the sugar-binding sites of the molecule do not negate its growth-inhibitory effect nor prevent binding onto cells. Binding must therefore occur through molecular domains other than those that link saccharide determinants. This is indicated by the experiment in which mGBP is shown to bind to approximately 5-10 x lo4 saturable binding sites per cell, even in the presence of 100 mM lactose (see Figure 3), although binding in this case is less efficient. The high sugar concentration may also lead to a degree of adherence among the mGBP molecules reflected in the higher cpm values of the competition curve. That the site of binding is a physiological receptor for mGBP is suggested by the following. After labeling, the protein retained growth-inhibitory activity; by electrophoretie separation it migrated with an M, equivalent to that of the native protein; and concentrations that saturate the binding sites are close to those that have a growth-inhibitory effect. Interestingly, we found by means of PAGE and gel filtration analysis that mGBP separates under all conditions as a single component with an M, of 45,000,
B
Figure 6. Effect of Treatment with Neutralizing Monoclonal Antibody to mGBP (A) Treatment during GO. (a) Cell population in GO, prior to serum stimulation. (b) Cells stimulated by addition of 10% fetal calf serum. (c) Cells treated with antibody from 6 hr prior to serum stimulation. (S) Treatment prior to entry into G2. (a) Cell population in GO, prior to serum stimulation. (b) Cells stimulated by addition of 10% fetal calf serum. (c) Cells stimulated by addition of 10% fetal calf serum and treated with antibody from 6 hr prior to G2 peak. Hours indicate time after serum stimulation. Histograms represent DNA distribution by FACS analysis.
indicating that in its native and functional state as a growth inhibitor mGBP is not a dimeric molecule. Larger molecular forms for GBP of various origins have been reported (de Waard et al., 1978; Childs and Feizi, 1979; Powell, 1980; Roff et al., 1983; Cerra et al., 1985), but there is no evidence that any of these molecules acquire a dimeric configuration by isologous association (Monod et al., 1985). Based on the example of IFNs, which inhibit cell proliferation with effects in G O and in Gl, the general properties of a cell growth inhibitor of physiological derivation would include cell stage specificity. Our results show that cells treated in G O remained in G O and that cells treated prior to G2 were affected in the G2 traverse and did not divide. A block in G2 could account for the larger cytoplasmic areas and larger nuclei that develop in the arrested cell population (see Figure 38). That a minimum exposure period of -3 hr prior to serum stimulation was required to keep G O cells from resuming growth adds interest to the picture of the ligand-receptor system that has emerged from our analysis, as it suggests transduction events. However, we have not been able to establish the minimum exposure time required to impede traverse through G2, owing to a dispersion of 2-3 hr in the population entering G2. In contrast to the effect of mGBP, blocking of cell proliferation by nonspecific inhibitors, such as that caused by lectin cross-linking, has no cell stage specificity, and it occurs at concentrations well above those required for effector molecules. In considering a physiological role for mGBP it should
Cell 96
be noted that mGBP is expressed constitutively. Hence, as in the case of IFNs, which are also expressed constitutively, the capacity of mGBP to operate as a physiological effector in the process of cell replication can be investigated by negating its presence. The evidence shown in Figure 6 indicates that mGBP has a role in the control of GO and in the control of G2. In the presence of a neutralizing monoclonal antibody to mGBP, exit from GO was anticipated and traverse through G2 was accelerated. Interestingly, GO and G2 are the two stages in which the molecule also operates as a cytostatic factor. This poses a similarity with IFNs, which act both as cytostatic factors and as growth modulators within the two defined periods of GO and Gl. We do not know whether there is a functional relationship between IFN and mGBP, but no particular assumption needs to be made at this stage. However, the fact that as growth inhibitors IFNs are more stable proteins than mGBP (unpublished data) might indicate a primary paracrine function in the first instance and an autocrine function in the second. Experimental Procedures CSIIS
Secondary cultures of embryonic fibroblasts from C57BL mice (MEFs) were grown to confluence in 25 cm2 flasks with Eaglh BHK medium and 10% newborn calf serum in an atmosphere of 5% CO?. Cultures were kept in 05% serum medium for 2 days and were induced to resume growth by the addition of fetal calf serum to a final concentration of 10%. For logarithmic growth, cells were seeded at a density of 2 x l@/cm* in 25 cm2 flasks in BHK medium with 5% fetal calf serum and 5% CO*. In order to obtain a high degree of reproducibility in cell growth kinetics, the flasks were sealed and incubation was carried out in a water bath at 3PC. Population distribution during cell cycle was assessed by FACS analysis. Details of these procedures were as described previously (Mallucci et al., 1983; Wells and Mallucci, 1985).
incubation was continued for 12 hr. Peptides were loaded directly onto a Cl8 reverse-phase HPLC column equilibrated in 0.08% trifluoroacetic acid. A gradient from 0% to to 60% acetonitrile was run over 75 min at 1 mllmin, and 0.5 ml fractions were collected. Sequence determination was carried out using an Applied Biosystems 470A gas-phase sequencer. PTH amino acid analysis was performed on-line using an Applied Biosystems 120A analyzer (Hunkapiller, 1985). Quantitative PTH amino acid recovery was measured with a Shimadzu CRBA recording integrator.
cDNA Cloning and Recombinant Expression cDNAs were isolated in two steps. First they were isolated from a lgtl0 library constructed using poly(A)+ RNA from tertiary C57BL MEFs screened with a combination of four synthetic oligonucleotide probes based on the amino acid sequence MEAINYMAA, which is part of one of the isolated peptides. A 110 bp cDNA from the phage library enclosing one of the oligonucleotide constructs was then used to screen a CDM8 (Seed, 1987) plasmid library made with size-fractionated cDNAs (400-1200 bp) prepared from mouse fibroblast poly(A)+ RNA. Xhol cDNA inserts were selected by size and analyzed by the Sanger dideoxynucleotide termination method. A full coding sequence cDNA (clone MW2) in plasmid CDM8 containing an Ml3 origin of replication, a CMV promoter, and a polyadenylation site was used for transfection (Seed, 1987). COSl cells were plated in GMEM medium with 10% fetal calf serum at 2 x 18 cells per 10 cm tissue culture dish 24 hr before transfection. Cells were transfected with 10 ng of plasmid DNA using DEAE-dextran and DMSO-facilitated uptake according to standard methods and were harvested at 48-72 hr. mGBP was purified by immunoaffinity chromatography using the IgG fraction of a neutralizing monoclonal antibody (clone 82) raised to HPLC-isolated protein and by asialofetuin-Sepharose chromatography.
Monoclonal Antlbodles mGBP purified by HPLC and eluted from a sliced gel was used to raise monoclonal antibodies. ELISA-positive clones from BALB/c-NS-1 myeloma hybrids were subcloned twice, and the IgG fractions were purified using rabbit anti-mouse IgG. The antibody from clone 82, found to negate the growth-inhibitory activity of mGBP at a molecular ratio of l:l, was used for neutralization experiments and immunoaffinity purification. An IgG fraction from nonimmune C57BL mice was used as a control.
mGBP Purlflcatlon and !hquenclng Growth-inhibitory activity was isolated in Sephadex G-75 fractions of serum-free conditioned medium from C57BL secondary MEFs, as described by Wells and Mallucci (1983). Approximately 250 pg protein was loaded onto a Cl8 reverse-phase HPLC column equilibrated with 0.08% trifluoroacetic acid. A gradient from 20% to 80% acetonitrile was run over 45 min at 1.5 mllmin, and 0.75 ml fractions were collected. Growth-inhibitory activity was tested in MEFs grown in Falcon multiwell microplates in duplicate cultures. Cells were fixed with methanol after 48 hr. and cells were counted in five random fields using an eyepiece graticule. Fractions with growth-inhibitory activity were analyzed by lo%-15% SDS-polyacrylamide gradient gel followed by Bio-Rad silver staining. Fractions were found to contain one component (M, 15,000) with a staining intensity that varied according to levels of growth-inhibitory activity. Approximately 200 nl of the pooled active fractions was freeze-dried and taken up in 50 nl sample buffer and run in a single lane of a 12% polyacrylamide slab gel containing 0.1% SDS. The lane was cut into 2 mm slices, and each slice was eluted into 300 nl of Eagle’s BHK medium and shaken overnight on a rotary shaker at 4OC. Approximately 200 pl of each recovered supernatant was spun for 15 min at 10,000x g at 4%. Fifty microliters was run on a 12% SDS-polyacrylamide slab gel to be stained with Bio-Rad silver stain. The remaining 150 nl was then made to contain 5% fetal bovineserum and 1% fatty acid-free bovine serum albumin and was assessed for growth-inhibitory activity in Falcon multiwell microplates. For partial amino acid sequence analysis the HPLC pool was reduced and alkylated (Bennett et al., 1980; Waterfield and Scrace, 1981) dialyzed against 10 mM ammonium bicarbonate, lyophilized, and resuspended in 10 mM ammonium bicarbonate. TPCK-treated trypsin was then added (1OO:l. protein:trypsin [w/w]). The mixture was incubated at Jpc for 12 hr. Another identical aliquot of trypsin was added, and the
Protein lodlnatlon and Binding Assays Immunoaffinity-purified mGBP was radioiodinated by mixing 1 pg with 500 PCi of carrier-free Na1s51 (Amersham) in 100 nl of 100 mM NaPi (pH 7) using preloaded lodo-bead iodination reagent (Pierce). After stopping the reaction, 300 pl of 100 mM NaPi with 0.1% BSA was added, and the iodinated protein was separated on a Bio-Rad DGlO column equilibrated with 0.1% BSA in 100 mM Nap,. Specific activity ranged from 4 x lo5 to 8 x lo5 cpmlng. Samples were checked by polyacrylamide gel electrophoresis and tested for biological activity before binding assays. These were carried out at 4OC in triplicate cultures in Falcon 24-well multiwell plates. Cells (2 x 105 per well) that had been prerefrigerated and washed three times with cold binding buffer (PBS with Ca2+ and Mg2+ plus 0.1% BSA) received 0.625 ng of 1251-labeled mGBP premixed with increasing concentrations of unlabeled mGBP Equilibrium binding was reached at 3 hr. After 4 hr the cells were washed three times with cold binding buffer and solubilized in 0.1 M NaOH, 2% Na2C0s, 1% SDS. When a competing sugar (100 mM lactose) was used, it was preincubated for 20 min at room temperature with the mGBP solutions.
Acknowledgments This work has benefited from helpful comments from Paul Nurse, Stefanello de Petri& and Peter Parker, to whom we are also grateful for discussions, suggestions, and critical reading of the manuscript. We warmly thank Geoffrey Scrace, Nick Totty, and Michael Waterfield for their kindness in helping with peptide sequence analysis and Rowena Boyle, Cath Catterall, and Tim Harris for help with cDNA cloning. This work is part of a Scientific and Technical Interchange Programme funded by the Commission of the European Communities.
Role of mGBP in Cell Growth Regulation 97
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact.
Ohyama, Y., Hirabayashi, J., Oda, Y., Ohno, S., Kawasaki, H., Suzuki, K., and Kasai, K. (1986). Nucleotide sequence of chick 14K Bgalactoside-binding lectin mRNA. Biochem. Biophys. Res. Commun. 134, 51-56.
Received July 5, 1990; revised September
Powell, J. T. (1980). Purification and properties of lung lectin. Biochem. J. 187, 123-129.
2, 1990.
References Abbott, W. M., and Feizi, T. (1989). Evidence that the 14kDa soluble 8-galactoside-binding lectin in man is coded by a single gene. Biothem. J. 259, 291-294. Barondes, S. H. (1984). Soluble lectins: a new class of extracellular proteins. Science 223, 1259-1284. Bennett, H. P J., Browne, C. A., and Solomon, S. (1980). The use of perfluorinated carboxylic acid in the reversed phase HPLC of peptides. J. Liquid Chromat. 3, 1353-1385. Bohmer, F. D., Kraft, R., Otto, A., Wernsteds, A., Muller, T., Rohde, K., Etzold, G., Lehmann, C. H.. and Grosse, R. (1987). Identification of hibitor from bovine mammary gland. J. Biol.
C., Hellman, U., Kurtz, W., Langen, t?, Heldin, a polypeptide growth inChem. 262, 1537-1543.
Cerra, R. F., Gilt, M. A., and Barondes, S. (1985). Three soluble rat f3-galactoside binding lectins. J. Biol. Chem. 260, 10474-10477. Childs, R. A., and Feizi, T. (1979). !.%Galactoside-binding muscle lectins of man and monkey show antigenic cross-reactions with those of bovine origin. Biochem. J. 783, 755-758. Clerch, L. B., Whitney, P, Hass, M., Brew, K., Miller, T., Werner, R., and Massaro, D. (1988). Sequence of a full-length cDNA for rat lung f3-galactoside-binding protein: primary and secondary structure of the lectin. Biochemistry 27, 692-899. Couraud, I? O., Casentini-Borocz, D., Bringman, T. S., Griffith, J., McGrogan, M., and Nedwin, G. E. (1989). Molecular cloning, characterisation and expression of a human 1CkDa lectin. J. Biol. Chem. 264, 1310-1316. Creasey, A. A., Epstein, D. A., Marsh, Y. V, Khan, Z., and Merigan, T. C. (1983). Growth regulation of melanoma cells by interferon and (2’-5’j oligo-adenylate synthetase. Mol. Cell. Eiol. 3, 780-786. de Waard, A., Hickman, S., and Kornfeld, S. (1876). Isolation and properties of 6-galactoside binding lectins of calf heart and lung. J. Biol. Chem. 251, 7581-7587 Frocklick, C. A., Dart, L. L., Meyers, C. A., Smith, D. M., and Sporn, M. B. (1983). Purification and initial characterization of a type 8 transforming growthfactor from human placenta. Proc. Natl. Acad. Sci. USA 80, 3676-3680. Gitt, M. A., and Barondes, S. H. (1986). Evidence that a human soluble f3-galactoside-binding lectin is encoded by a family of genes, Proc. Natl. Acad. Sci. USA 83, 7603-7607.
Ralph, i?, and Nakoinz, I. (1973). Inhibitory effects of lectins and lymphocyte mitogens on murine lymphomas and myelomas. J. Natl. Cancer Inst. 51, 883-890. Raz, A., Carmi, P, and Pazerini, G. (1986). Expression of two different endogenous galactoside-binding lectins sharing sequence homology. Cancer Res. 48, 845-849. Revel, M., Kimchi, A., Friedman, M., Wolf, D., Merlin, G.. Ponet, A., Rapoport, S., and Lapidot, Y. (1982). Cell regulatory functions of interferon induced enzymes: antimitogenic effect of (2’-5’) oligo A, growth related variations in (2’-5’) oligo A synthetase, and isolation of its mRNA. Texas Rep. Biol. Med. 41, 452-462. Roberts, A. B., Anzano, M. A., Meyers, C. A., Wideman, J., Blather, R., Pan, Y.-C. E., Stern, S., Lehrman, S. R., Smith, J. M., Lamb, L. C., and Sporn, M. B. (1983). Purification and properties of a type 6 transforming growth factor from bovine kidney. Biochemistry 22, 5692-5898. Roberts, A., Anzano, M., Wakefield, L. M., Roche, N. S., Stern, D. F., and Sporn, M. (1985). Type 5 transforming growth factor: a bifunctional regulator of cell growth. Proc. Natl. Acad. Sci. USA 82, 119-123. Roff, C., Rosevear, f? R., Wang, J. L.. and Barker, Ft. (1983). Identification of carbohydrate binding proteins from mouse and human fibroblasts. Biochem. J. 277, 625-629. Seed, B. (1987). An LFA-3 cDNA encodes a phospholipid-linked membrane protein homologous to its receptor CD2. Nature 329, 840-842. Trowbridge, I. S., and Hilborn, D. A. (1974). Effects of succinyl ConAon the growth of normal and transformed cells. Nature 250, 304-307 Tucker, R. F., Shipley, G. D., Moses, H. L., and Halley, R. W. (1984). Growth inhibitor from BSC-1 cells closely related to platelet type p transforming growth factor. Science 226, 705-707, Wang, J. L., and Hsu, Y. M. (1987). Negative regulators of cell growth. In Oncogenes and Growth Factors, R. A. Bradshaw and S. Prentis, eds. (Amsterdam: Elsevier), pp. 194-200. Wang, L. J.. Gunther, G. R., and Edelman, G. M. (1976). Chemical and biological properties of dimeric concanavalin A derivatives, In Concanavalin A as a Tool, H. Bittiger and H. P Schnebli, eds. (New York. J. Wiley and Sons), pp. 585-598. Waterfield. M. D., and Scrace, G. T. (1981). Peptide separations by liquid chromatography using size exclusion and reverse phase columns, In Biological/Biomedical Applications of Liquid Chromatography, Vol. 18, G. L. Hawk, ed. (New York: Dekker), pp. 135-137.
User
Waterfield, M. D., Scrace, G., and Totty, N. (1985). Separation of mixtures of proteins and peptides by high performance liquid chromatog raphy. In Practical Protein Biochemistry, A. Darbre and M. D. Waterfield, eds. (New York: J. Wiley and Sons), pp. 181-206.
Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-293.
Wells, V., and Mallucci, L. (1983). Properties of a cell growth inhibitor produced by mouse embryo fibroblasts. J. Cell. Physiol. 777, 148-154.
Hunkapiller, M. (1985). Applied Biosystems Bulletin, No. 14.
Protein Sequencer
Lin, S. L., Kikuchi, T., Pledger, W. J., and Tamm, I. (1988). Interferon inhibits the establishment of competence in GO/S-phase transition. Science 233, 356-359. Mackler, 8. F. (1972). Effect of concanavalin lines and normal peripheral lymphocytes. 935-941.
A on human lymphoid cell J. Natl. Cancer Inst. 49,
growth factors.
Trends Bio-
McClain. D. A., and Edelman, G. M. (1976). Analysis of the stimulation inhibition paradox exhibited by lymphocytes exposed to concanavalin A. J. Exp. Med. 144, 1494-1508. Monod, J., Wyman, J., and Changeux, J. P (1965). On the nature of transition: a plausible model. J. Mol. Biol. 12, 88-118.
SllOStSriC
Wells, V., and Mallucci, L. (1988). Cell cycle regulation by autocrine interferon and dissociation between autocrine interferon and 2’-5’oligoadenylate synthetase expression. J. Interferon Res. 8, 793-802. GenBank
Mallucci, L., Rasbridge, S., and Wells, V. (1983). Cell cycle study on the effectof interferon on synchronized mouse embryofibroblasts. J. Interferon Res. 3, 181-189. Massague, J. (1985). The transforming them. Sci. 70, 237-240.
Wells, V., and Mallucci, L. (1985). Expression of the 2-5A system during the cell cycle. Exp. Cell Res. 759, 27-36.
Accession
The accession M57470.
number
Number for the sequence
reported
in this paper is
