249

Virus Research, 24 (1992) 249-264 0 1992 Elsevier Science Publishers B.V. All rights reserved 016%1702/92/$05.00

VIRUS 00799

Identification of bent DNA and ARS fragments in the genome of Choristoneura fumiferana nuclear polyhedrosis virus Ho Yun Lee a, Basil Arif b, Peter Dobos a, and Peter Krell a a Department of Microbiology, University of Guelph, Guelph, Ont., Canada and b Forest Pest Management Institute, Sault Ste. Marie, Ont., Canada

(Received 16 January 1992; revision received 8 April 1992; accepted 8 April 1992)

Summary We identified four CfMNPV DNA fragments with autonomously replicating sequences (ARS) functional in Saccharomyces cerevisiae. A 0.9-kb fragment which, mapped to 54.5 to 55.3 map units within EcoRI HI of the CfMNPV genome, showed the strongest ARS activity of the four. Sequence analysis of this 0.9-kb DNA segment revealed an A + T-rich region separated from a G + C-rich region by 320 bp. Although no sequence matched exactly the ARS core-consensus sequence, 13 near-matches differing by only one or two nucleotides from the core-consensus sequence, were identified. Ten near-matches were clustered within a 105-bp A + T-rich region, and were arranged as inverted repeats. A section of bent DNA structure was predicted within this region. The bent DNA, which showed temperature-dependent retardation during polyacrylamide gel electrophoresis, was unique as its sequence was arranged as a symmetrical ‘tilde’ (N ) structure. The second (1.0 kb) and third (1.6 kb) MS-bearing fragments mapped within EcoRI-E and -B fragments which contain homologous repeat sequences. The fourth (1.5 kb) fragment had the weakest ARS activity and mapped to the EcoRI-D or -B regions of the genome. Baculovirus;

Bent DNA; Autonomously NPV; DNA replication

replicating

sequence

(M&S); Choris-

toneuru fumiferuna

Correspondence

to: P. Krell, Department of Microbiology, University of Guelph, Guelph, Ont., Canada NlG 2Wl. Fax: (1) (519) 837-1802.

250

Introduction

The baculovirus Choristoneura fumiferana multiple nucleocapsid nuclear polyhedrosis virus (CfMNPV) is a pathogen of the spruce budworm C. fimiferana. The CfMNPV genome is a 125 kilobase-pair (kb) double-stranded DNA (Arif et al., 1984) containing four homologous reiterated sequences (RSs) which are almost evenly interspersed along the covalently closed, circular DNA (Arif and Doerfler, 1984). We attempted to identify autonomously replicating sequences ( ARSs) of CfMNPV DNA which are functional in the yeast Saccharomyces cereuisiae and which may have a role in viral DNA replication. ARS-bearing plasmids have high transformation frequencies due to their autonomous replication in transformed yeast cells (Stinchcomb et al., 1979). DNAs isolated from several organisms contained ARS-bearing DNA segments (reviewed by Newlon, 1988). An ARS mimics chromosomal DNA replication with respect to the kinetics of replication, cell cycle control by cell-division cycle (CDC) gene products and the frequency of occurrence within a genome (Newlon, 1988). An ARS may therefore be considered as a putative DNA replicator in the natural environment or at least as an important c&acting element in DNA replication. Recent studies on the movement and direction of replication forks by two-dimensional gel electrophoresis showed that at least some of the ARSs of yeast chromosomal and episomal DNA functioned as origins of DNA replication in vivo (Brewer and Fangman, 1987; Huberman et al., 1987 and 1988). An ARS element is generally A + T-rich and is divided into three functional domains, A, B and C (Celniker et al., 1984). Of these three, domain A, or core, is necessary for ARS function and has a consensus sequence of 5’-(A/T)TTTAT(A /G)TTT(A/T)-3’ (Celniker et al., 1984). Most of the functional ARS elements identified to date contain one or more copies of this core-consensus or near-match sequence (Newlon, 1988). Bending of DNA molecules occurs when continuous dA.dT tracks of at least 3 contiguous dAs are repeated at an interval of 10.5 bp, equivalent to one turn of the DNA helix (Koo et al., 1986). The mobility of fragments with bent DNA is disproportionately retarded during polyacrylamide gel electrophoresis at low temperatures (Kawamoto et al., 1988; Ryder et al., 1986; Wilson, 1989). Bent DNA has been identified in transcriptional promoters (Kawamoto et al., 1988), ARSs (Diffley and Stillman, 1988; Eckdahl and Anderson, 1990; Snyder et al., 1986) and DNA replication origins (Deb et al., 1986; Koepsel and Khan, 1986; Ryder et al., 1986; Zahn and Blattner, 1985). Williams et al. (1988) found that bent DNA functioned as a replication enhancer and deletion of the bending locus impaired replication but this could be restored by substitution with a synthetic bent DNA. Localized melting of the double-stranded DNA is facilitated by DNA bending, and once one base pair is disrupted, DNA bends more easily to facilitate interaction between DNA and replication/ transcription factors (Ramstein and Lavery, 1988). In our studies we identified and isolated four ARSs from the CfMNPV genome. A 0.9-kb fragment, which showed the strongest ARS activity among the four was

251

characterized in more detail. Analysis of the nucleotide (nt) sequence and polyacrylamide gel electrophoresis at different temperatures showed that this fragment contained a long stretch of bent DNA and several repeats of a near core ARS consensus. Furthermore, this bent DNA has a distinct symmetry within the DNA sequence.

Materials and Methods Yeast strain and medium S. cerevisiae strain YNN27 (MAT -(Y, n-p-289, ura3-52, ga12; Stinchcomb et al., 1980) was a gift from J.M. Vlak (Agricultural University, Wageningen, The Netherlands). Synthetic complete medium was prepared as described by Broach et al. (1979). For yeast transformation or for testing yeast phenotypes, the appropriate amino acid was omitted from the complete medium. Regeneration agar contained 1 M sorbitol and 3% bacto-agar in the appropriate synthetic medium. Bacterial strains, plasmids and construction of a CfMNPV genomic DNA library E. coli strains TBl and HBlOl and the growth media were originally described by Viera and Messing (1982) and Boyer and Roulland-Dussoix (1969), respectively. The yeast AK&selection vector YIp5 is a pBR322-based vector with an intact URA3 gene of S. cerevkiae (Stinchcomb et al. 1980). A CfMNPV genomic DNA library was constructed from random Sau3A digests of CfMNPV DNA by cloning into the BamHI site of YIp5 and subsequent transformation of E. coli TBl. The plasmid DNA extracted from this random genomic DNA library was used for yeast transformations. The plasmid YRpl2, which was used as an ARS positive control, consists of YIp5 and a 1.4-kb fragment containing the yeast ARSl and the adjacent TRpl gene (Scherer and Davies, 1979). The plasmid pUC19 used for DNA sequencing was described by Norrander et al. (1983). Transformation of S. cerevisiae and E. coli and plasmid DNA extraction from the transformants

DNA transformations of yeast and E. coli were as described by Hinnen et al. (1978) and Hanahan (1985), respectively. DNA extraction from yeast was as described by Nasmyth and Reed (1980) for yeast total DNA or by Potter et al. (1985) for plasmid-enriched total DNA. Plasmid DNA purification from E. coli was as described by Holmes and Quigley (1981). Restriction enzyme analysis and Southern blot hybridization

Plasmid DNA was analyzed by digestion with restriction endonucleases and agarose gel electrophoresis. ARS-bearing viral DNA was mapped to CfMNPV

252

DNA restriction enzyme fragments by Southern blot hybridization using nitrocellulose membranes (Schleicher and Schuell, Keene, NH USA) (Southern, 1975). Hybridization was at 42°C for 15-20 h in 50% formamide or at 37°C in 27% formamide for high or low stringency conditions, respectively. Probes were label led by a random synthetic hexanucleotide primer extension method (Feinberg and Vogelstein, 1983) using a kit from BRL. DNA sequencing

Four subfragments of a 0.9 kb ARS-containing Suu3A fragment of CfMNPV in YIp5 were subcloned into pUC19 for sequencing. Supercoiled double-stranded DNA was used as a template for sequencing (Chen and Seeburg, 1985) by a commercial random dideoxyribonucleotide chain termination method based on Sanger et al. (1977) as described by the manufacturer (Pharmacia). Polyacrylamide gel electrophoresis

To assay for DNA bending, cloned plasmid DNA was digested with EcoRI and Hind111 and electrophoresed in 10% polyacrylamide gels in 1X TBE buffer (89 mM Tris-borate, 2.5 mM EDTA, pH 8.3) at 10°C 35°C or 45°C. The migration mobilities of the 374-bp EcoRI-Hind111 DNA fragment were compared to those of a 1-kb DNA marker (GIBCO/BRLl.

Results Identification and analysis of CfMNPV ARS-containing plasmids

One hundred and fifty URA+ yeast transformants were obtained from two separate experiments using a library of recombinant YIp5 DNA containing CfMNPV random Sau3A DNA fragments. Total or plasmid-enriched DNA extracted from these yeast colonies was used to transform E. coli HBlOl to rescue and characterize the recombinant plasmids from each URA+ yeast clone. Through detailed analysis and subcloning of 14 different yeast clones selected from all original URA+ yeast transformants, we ultimately identified only 4 different ARS-bearing virus DNA sequences represented by DNA fragments of 0.9, 1.0, 1.5 and 1.6 kb and recovered at frequencies of 8, 3, 1, and 2 respectively (Table 1). All 4 recombinant DNAs when tested for their ability to transform YNN27, to confirm that the recombinant DNAs recovered originally from yeast and then amplified in bacteria still had ARS activities, gave rise to high transformation frequencies (Table 1). Among these ARSs, the 0.9-kb fragment showed the strongest ARS activity in terms of transformation efficiency and transformation frequency followed by the l.O- and the 1.6-kb fragments (Table 1). Transformation with the 1.5-kb fragment resulted in smaller yeast colonies which grew very slowly.

253

TABLE 1 Analysis of ARS-containing plasmids ARS-containing plasmids Original pYCfO.9 (5) c pYCfl.5 (1) pYCf3.5 (1) pYCf4.5 (2) pYC f8.0 (2) pYCf8.5 (3) YRpl2 YIP5

Insert sizes (kb)

Subclone

Original

pYCf 0.9 d pYCf0.9 pYCf 1.6 pYCf 1.o

0.9 1.5 3.5 4.5 8.0 8.5 1.4 0.0

Subfrgmt a

0.9 0.9 1.6 1.0

Transformation efficiency b 7,000 200 5,000 n.d. 300 e 320 e 10,000 0

a ARS activities in these subfragments (subfrgmt) were essentially the same as those in the original ARS-bearing fragments. b The transformation efficiency was calculated as the number of URAf colonies per pg of DNA. ’ pYCf0.9 is the recombinant plasmid (p) consisting of YIp5 vector sequence (Y) and a fragment of CfMNPV DNA (Cf) with a size of 0.9-kb (0.9) bearing ARS activity. All other recombinant plasmids were denoted on the same basis. The numbers in brackets indicate the frequency of independent yeast clones recovered containing the same ARS-bearing plasmids. d Subclone of the larger fragment on the same row and which maintained equivalent ARS activity related to the larger fragment. e These transformation efficiencies are those of the subcloned fragments. n.d. not done.

Homology among the ARS-bearing fragments

To determine if there was any sequence homology among the 4 AR&containing fragments (0.9, 1.0, 1.5 and 1.6 kb), each fragment was tested by reciprocal hybridization. Under high stringency conditions, no homology was detected (data not shown), but under lower stringency conditions weak hybridization was detected between the l.O- and 1.6-kb fragments (Fig. 1A and B, lanes pYCfl.6 and pYCfl.0). A minimum of 67% sequence homology would be detected under these hybridization conditions (Hawley et al., 1979). The three bands (denoted as V> common to each lane and which showed weaker positive signals were vector DNA bands hybridizing to labelled vector DNA which contaminated the probe. When vector DNA alone was used as a probe only these DNA bands but not the viral DNA inserts hybridized (data not shown). It is therefore possible that the same or similar ARS element resides in both the l.O- and 1.6-kb ARS-bearing DNA fragments, although they primarily mapped to different sites in the CfMNPV genome. No homology to other ARS fragments was detected for either the 0.9- or 1.5-kb ARS-bearing DNA fragments even under low stringency conditions (data not shown). Comparison of the physical conformation of MS-bearing plasmids isolated from S. cerevisiae and from bacterial cells by Southern blot hybridization suggested that they replicated in yeast cells as supercoiled molecules (Fig. lC>. Thus the

254

Fig. 1. Sequence homology among different ARS-bearing fragments and ARS plasmid DNA conformation in yeast. Plasmid DNAs digested with Sau3A were analyzed by Southern blot hybridization with 32P-labelled l.O-kb (panel A) or 1.6-kb (panel B) ARS-bearing Sau3A fragments. Lanes from left to right represent pYCf0.9, pYCfl.6, pYCfl.5, pYCf1.0 and YIPS. Bands designated V in lane S are for vector (YIp5) DNA sequences and bands 1.0 and 1.6 are bands with sizes of the corresponding fragments in kb. (Cl Characterization of CfMNPV ARS-bearing plasmids derived directly from transformed yeast cells or E. co/i. Plasmid enriched total DNA was isolated from S. cereuisiae transformed by either pYCf0.9 (lane 1) or YRpl2 (lane 3) and from E. coli transformed with pYCf0.9 (lane 2) or YRpl2 (lane 4) and analyzed by Southern blot hybridization with “*P-labelled pBR322 DNA as a probe. SC denotes supercoiled DNA.

plasmids recovered from yeast must have been capable of autonomous replication and the ARS-bearing fragments must have provided the necessary &acting elements for this. Mapping of the ARS-bearing fragments to the CfMNPV genome

To map the four ARS-containing Sau3A fragments to the virus genome, physical maps for all four were constructed (Fig. 2A) and the genomic CfMNPV DNA digested with several different restriction endonucleases was analyzed by Southern blot hybridization using each of the four 32P-labelled ARS-bearing fragments as probes. As summarized in Fig. 2B, the 0.9-kb viral DNA insert mapped to the EcoRI-HI region at 52.8 to 56.6 map units (m.u.> of the viral genome (Arif et al., 1984). The detailed physical map for pYCf0.9 (Fig. 2A) and the subsequent comparison to that of the cloned EcoRI-HI fragment enabled us to map the 0. 9-kb AR&bearing fragment to between 54.5 and 55.3 m.u. The l.Oand 1.6-kb ARS-containing fragments mapped to EcoRI E (45.7 to 51.0 m.u.> and BgZII C (80.6 to 90.1 m.u.) respectively (Fig. 2B). Interestingly both the l.O- and 1.6-kb fragments hybridized slightly to fragments corresponding to the four RSs; 1.4-8.8, 22.1-24.4, 45.7-51.0 and 82.1-90.1 m.u. Because these two fragments hybridized not only to each other but also to the RS regions, it is possible that at

255 A

0.9

kb

SA "

1.0

kb

s '

1.5

kb

S '

1.6

kb

S I

PY 1

H I

100 bp -

H 0 Sa I

PS I

s

S 1 A/S

S ,

H I

PS '

'

B $

Genome

' 0

' 10

,

I

I

I

30

40

50

60

J FHIKNDOEHIG I

A EcoRI RSs 0.9 kb 1.0 kb 1.5 kb 1.6 kb

I 20

I

.

*

*

I 70

i

I

I

80

90

100

LM C

LaM

B L

.

. ++

++

*

++ *

*

++ *

++

Fig. 2. Summary of the physical maps for AR&bearing fragments and relative map positions of these fragments. (A) Plasmid maps of the 4 ARS-bearing recombinant plasmids. A, AuaI; S, Sau3A; H, HindHI, Pv, P&I; Ps, &I; Sa, SalI. (B) Mapping of ARS-bearing fragments to the CfMNPV genomic DNA by Southern blot hybridization with each of the four 32P-labelled ARS-bearing DNA fragments. The + + indicates the relative map positions, on the CfMNPV genome, of fragments hybridizing to each of the ARS-bearing fragments and the * denotes partially homologous sequences. The EcoRI physical map of CfMNPV DNA and the relative positions of the RSs (homologous reiterated sequences) are from Arif et al. (1984) and Arif and Doerfler (1984).

least part of the RS sequence was responsible for the cross-hybridization. Perhaps also, the RS sequence retained in both may have been responsible for the ARS activities. The 1.5-kb fragment which was the weakest ARS of the four, hybridized to fragments which mapped to two widely separated regions of the CNNPV genome: EcoRI-D (36.6 to 44.4 mu.) and XbaI-E (91.4 through 100.0 to 1.4 m.u.) within the EcoRI-B region (Fig. 2B). Since this 1.5 kb fragment had the weakest ARS activity it was not analyzed further. Sequence analysis of the 0.9-kb ARS-containing fragment

Since the plasmid with the 0.9-kb fragment had the strongest ARS activity among the isolated ARS-bearing fragments from CfMNPV DNA and it had a superhelical conformation in transformed yeast, we determined its nucleotide sequence (Fig. 3A). The 928 bp sequence of this ARS-containing CfMNPV DNA fragment had a very high A + T (76%) region from nt 241 to 480 and a G + C-rich (79%) region from nt 801 to 900. None of the sequence within this fragment

256

A 5'GATCACTTGCAAATGGTCAGCGCTAAAAGCAACACTTTTATGTA Sau3A TTTAACAGCGAATTGATAGACAACGCCAATTTGCC~TTTGCACG~GTT~CGCCGACTATATT~G

60 120

CCAAATTGCATCGTGCTCACGTTTACTTGTTGCGATTTGACGTTTGAGCC~AT~CGA

180 82aa

CGTCTCAAAAAGAGTTGAAAACCGTGCAAGAAACAGTTCTTGATTTGTCGATAGAAACCG

240

ACGATTTTTTAAAMA

CAAAATTGAGAACACGCAGCTGGAAGAAGAGCGCTTGATAAAAD PVUII CAATGCGCGCCAATAAAATAAWTTGAACAGCCCCAAGAGTTGATGAAATTAAACACTA NFI 108+aa ACACTTTAAATTGTATAAATATATTAGTCGATTTAATTTTATTAAAAATAAACATGTAAA

300

TTGTTAAAATTAAAACAAACAATTTTATTTTAATATTTTATTACGTTTATGTATATAAAA

480

360 420

TTGCAATTGTTGTTAATTTGTACGTAGCGGTCATTTTCGGCGTTTTCCGGAGCCACACAC

540

CTGCACAGCAGGGCGCAAAAGGTTTTGGACGCGCGTTTAATAT ________

600

GCAAATAAATTAATAGACATACAATACG~~TTACAGCTTACTGTTACTATTGCG Hi"dIlI GCAGAGTGTTT~CGGCTCACGATTTTGTTGTTGCACACGCAGCAGCGCTTG~GCGCG 86+aa GCGAGCATTCTGCGCACACGACCAAATGCCGGCCGGCAAGCACACCGATTTTTCGT

660 720 780

TGGCGAAGCACACTTTG~TCGGACACGGCGGCGGCGGCGGCGGCGACGTCGGGTGGCG 116Ela CGCTGGGCTTTGCAGGCGTCGGCGCGTTTAACTCGTGGGGG~GCGCGGCGGCGGCA ________ AvaI AGTCCGACTTTACTATTTTAAACA-3' sau3.a

840 900 928

B 171

416

I 82

I 86+

aa Hind111

PVUII 453 s

928

672

I

aa AvaI

800

I 108+

aa

116

aa

Fig. 3. Nucleotide sequence (A) and potential ORFs of the 92%bp ARS-bearing fragment in pYCfO.9 (B). Detailed mapping showed that the AUII and PvuII recognition sites resided at 54.53 and 55.04 m.u., respectively of the CfMNPV genome. Potential ATG initiation codons on the sense strand and the complement (5’-CAT-3’) for the initiation codons on the antisense strand for 4 ORFs are underlined with arrowheads in the direction of translation. The double underlined sequence resembles the adenovirus NFI binding site. The location of a 12 bp direct repeat is shown by the dashed line with arrowhead. The locations of restriction endonuclease recognition sites for Sau3A, PouII and AuaI are also indicated. Potential ORFs for the sense and antisense strands are shown as open boxes over and below the physical map, respectively in panel B. The numbers above and below each box indicate the nucleotide numbers for both ends of each ORF and the potential number of amino acids (aa) for that ORF, respectively.

corresponded perfectly with the 11 nucleotide yeast core-consensus sequence. However, 13 sequences with near-matches (one or two base pair mismatch) to the yeast ARS core-consensus sequence were clustered within 667 bp of the 0. 9-kb fragment (nt 253 to 919) (Table 2). Of these, one from nt 449 to 459 (Table 2, i) differed from the yeast core-consensus sequence by only one nucleotide while the

251 TABLE 2 Summary of the near matches to ARS core-consensus fragment No.

Positions

253-263 376-386 391-401 403-413 408-418 425-435 432-442 441-451 449-459 465-415 470-480 614-624 909-919 Yeast core consensus sequence

a

sequence found in the 928 bp ARS-bearing

Orientation a

Sequence b

anti-sense anti-sense sense anti-sense anti-sense anti-sense anti-sense sense sense sense anti-sense anti-sense sense

5’-AaTTtTGTTTT-3’ 5 ‘-TaaTATATTTA-3 ’ 5’-ATTTAatTTTA-3’ 5’-gTTTATtTITA-3’ 5’-TTacATGTTTA-3’ 5’-TTTTAatTTTA-3’ 5’-TTgTtTGTTTT-3’ 5’-AaTTtTATTTT-3’ 5’-TTTaATATTTT-3’ 5’-gTTTATGTaTA-3’ 5’-TlTTATATacA-3’ 5’-l-l-gTATGTcTA-3’ 5 ‘-TTTacTATTTT-3 ’ 5’-;TTTAT$TT;-3’

a The orientation as shown in Fig. 3A is considered to be the sense strand. b Upper and lower case letters in the nucleotide sequence indicate conserved and non-conserved nucleotides respectively with respect to the corresponding nucleotides in the yeast core-consensus sequence.

other 12 differed by 2 nucleotides. Five of the near-match core-consensus sequences (Table 2, c, h-j and m) were in the sense strand (reading left to right) and the remaining eight were in the anti-sense strand. Most of these near matches (10 out of 13) were clustered within a 105bp stretch of the A + T-rich region from nt 376 to 480. The organization of some of the near-matches in this region is interesting because they were arranged somewhat symmetrically (Fig. 4A). Three regions suggesting a symmetrical arrangement of near-matches were observed, one including the pair b and c with an axis of symmetry at nt 388/389, a second the overlapping pair j and k with an axis of symmetry at nt 472/473, and the third a group including d, e, f and g on one strand and h, i and j on the opposite strand with an axis of symmetry at nt 442/443 (Fig. 4A). A possible hair-pin structure for this region was also detected as shown with the nucleotide sequence (Fig. 4B). There may be four potential open reading frames (ORFS) wholly or partially within the 928-bp region (Fig. 3B). Two potential ORFs were found on the sense strand, one of which started at nt 171 and ended at nt 416 (82 amino acids) with polyadenylation signals starting at either nt 407 or 604, while the other started at nt 672 and ran beyond the 3’-end coding for at least 85 amino acids. On the anti-sense strand, one complete ORF which potentially codes for a 116 amino acid protein, started at nt 800 and ended at nt 453. It is interesting that the stop codon for this ORF ended within the most near match core-consensus sequence and was flanked by two poly(A) signals (nt 444 to 449 and nt 457 to 462) (Fig. 4A, asterisks). Another ORF on the anti-sense strand started at nt 324 and ran beyond the 5’-end

258

A 424

****** 269 -C5’-AATTGTATAAATATATTAG;CGATTTAATTTTATTAAAAATAAACATGTAAATTG+ ,‘-TTAACATATTTATATAATCAIGCTAAATTAAAATAATTTTTTATTTGTACATTT~CA ******-_d-_ep -+

-h-i_ - e --i TAAAATTAAAACAMdATTTTATTTTAATATTTTATTACGTTTA~GTiTATAAAi-3’ ATTTTAATTTTGTTTGTTAAAATAAAATTATAAAATAATGCAAATACA~ATATTTT-5’ ****** ~f--c-----g-L l *****

480

k--

442 A A’ C T AT AT AT C A AT AT AT AT T A-A

B

I

i

401 5’-f,TTAAAAATAAACATGTAAATTGTT

I

A-+

AT AT AT AT

480 ATTACGTTTATGTATATAAAA-3’

Fig. 4. Symmetrical organization of some of the near-matches to the ARS core-consensus sequence (Table 2, b-k). In panel A, the three groups of near-matches in a symmetrical organization include the pair b and c with an axis of symmetry at nt 388/389, the group d, e, f and g on one strand and h, i and j on the opposite strand with an axis of symmetry at nt 442/443, and the pair j and k with an axis of symmetry at nt 472/473. These three axes are indicated by arrowheads on both strands. The asterisks (*) mark potential poly(A) signals. In panel B, a potential secondary structure of the A+T-rich region of the 0.9-kb ARS-bearing fragment is shown.

of the sequence analyzed coding for at least 108 amino acids. The DNA segment from nt 417 to 452, which is the center of the cluster of the near-match core-consensus sequence, was not a part of any ORF.

The 0.9-kb ARS fragment contained many repeat sequences

Many imperfect direct and inverted repeat sequences were found throughout the 928-bp ARS-containing fragment, and many repeats were clustered within a 240-bp stretch of an A + T-rich region (nt 241 to 480) and a 200-bp stretch of a G + C-rich region (nt 701 to 900). One such example in the A + T-rich region is illustrated in Fig. 4B. Similarly, the non-nucleotide sequence, CGTCGGCGC found at 857 to 865 is also present as 6 inverted repeats (each at least 78% homologous to sequences shared by two or three other repeats) in the 55-bp region from nt 810 to nt 865. A 12 bp GCGCGTTTAACT sequence at nt 571 to 582 is also repeated at nt 862 to 873.

259

.

c

b

a

I

I .

I .

I

.

468 I

10°C Fig. 5. Analysis of the bent DNA sequence. Sequence analysis of the 0.9-kb CfMNPV DNA fragment (Fig. 3A) revealed a potential bent DNA sequence. Arrowheads in panel A indicate the positions of the 10.5 base periodicity of dA tracks (a, b and cl or complementary dT tracks (d and e). Only those adenine (or thymidine) nucleotides appearing at a 10.5 base periodicity are written as upper case A (or T). The asterisk between nucleotide 442 and 443 indicates the potential axis of inversion of bending direction. Panels B, C and D show polyacrylamide gel electrophoresis analysis in 10% polyacrylamide gels of the 374-bp DNA fragment (arrowhead) containing 16 bp of vector DNA and 358 bp of a Hind111 to EcoRI fragment including the bent DNA sequence (see text for details) at temperatures of lO”C, 35°C and 45”C, respectively as indicated below panels B, C and D. Lanes 1, 1-kb DNA marker (GIBCO/BRL); 2, 374-bp DNA fragment alone; 3, 1-kb DNA marker and 374-bp DNA fragment together. Lane S indicates the sizes of some of the smaller DNA fragments in the l-kb ladder. Arrowheads indicate the positions of the 396 bp band in panels B, C, and D.

A sequence similar to the NFI binding sites at the origin of adenovirus DNA replication were found at nt 297 to 313 within the CfMNPV ARS fragment (Fig. 3A). Testing for bent DNA by polyacrylamide gel electrophoresis

Because the nucleotide sequence around the axis of symmetry at nt 442 (from nt 404 to 468) suggested the existence of bent DNA (Fig. 5A), we wanted to establish this experimentally. One of the subcloned fragments of pYCf0.9 containing the DNA segment from PvuII to Hind111 of the 0.9-kb fragment (Fig. 3A) was digested with EcoRI and Hind111 to generate a 374-bp fragment containing 358 bp of potential bent DNA sequence (Fig. 5A) of the viral DNA (PvuII site at nt 276 to Hind111 site at nt 634) and 16 bp of vector DNA. This 374-bp fragment had an

260

electrophoretic mobility of 385 and 410 bp relative to the I-kb DNA marker (GIBCO/BRL) at 45°C and 35°C respectively (Fig. 5C and D>. However, when the temperature of electrophoresis was lowered to 10°C the fragment migration was even more retarded (equivalent to approximately 440 bp) (Fig. 5B). Such a retardation in mobility at lower temperatures of electrophoresis, as noted for this fragment, is a characteristic of a fragment with bent DNA (Anderson, 1986; Kawamoto et al., 1988).

Discussion

Among the four ARS-containing CfMNPV DNA fragments identified, the 0.9kb one was recovered at the highest frequency (8 out of 14), showed the strongest ARS activity and did not map to a region within the CfMNPV genome containing any repeat sequences. In contrast, the l.O- and 1.6-kb ARS-containing fragments mapped to RS-containing regions in the CfMNPV genome and had weaker ARS activities. The 1.5-kb ARS-containing DNA fragment was tentatively mapped to two widely separated regions which may indicate that, in the CfMNPV genome, there are additional homologous sequences which are yet to be identified. This 1.5kb fragment showed extremely unstable and weak ARS activity, suggesting that it does not contain all the necessary &s-acting sequences required for efficient ARS activity. Nevertheless all of these DNA fragments must contain the minimal &acting elements essential for DNA replication at least in yeast if not for CfMNPV in infected insect cells. Although the 0.9-kb DNA fragment might contain sequence(s) which are directly involved in autonomous replication at least in yeast and possibly in the CfMNPV-infected insect cells, the two ARS element(s) residing in RS-bearing fragments (l.O- and 1.6-kb fragments) might be transcriptional regulators like the homologous repeat (hr) sequences of AcMNPV (Guarino et al., 1986) and act incidently in cis perhaps like ACE (amplification control element) sequences (Osheim et al. 1988) to enhance DNA replication (DePamphilis, 1988). The multiple copies of near-matches to the ARS core-consensus sequence, clustered in the A + T-rich region is presumably responsible for the strong ARS activity of the 0.9-kb ARS. A similar sequence organization was shown to contribute to the increased stability of ARS activity in other systems (Palzkill and Newlon, 1988). The overall inverted-repeat relationship of the near-matches may also contribute to the strong ARS activity for the 0.9-kb fragment by conferring multiple potential protein binding sites. The fact that ten copies of near-matches to the core-consensus sequence are concentrated within a very short DNA stretch (105 bp, from nt 376 to 480) may be significant for ARS activity and may compensate for the lack of complete identity to the core-consensus sequence. This may be analogous to the observation for Epstein-Barr virus in which multiple elements of the dyad symmetry can substitute for the entire oriP with respect to plasmid replication (Wysokenski and Yates, 1989). The existence of the imperfect

261

palindromic sequence in this region may also be relevant to the strong ARS activity. The 8th nucleotide, T, of these near-matches was invariant among all 13 core-like sequences (Table 2) and is also well conserved in the ARSs of other organisms (Palzkill et al., 1986; Kipling and Kearsey, 1990). Bent DNAs are often found in the A + T-rich regions of ARSs (Anderson, 1986; Snyder et al., 1986; Williams et al., 1988) and binding sites for ARS binding factor 1 (ABF-1) (Buchman et al., 1988), as well as origins of DNA replication (Anderson, 1986; Deb et al., 1986; Linial and Shlomai, 1988; Caddle et al., 1990). This unusual DNA structure appears to function as an enhancer of DNA replication since it could facilitate local denaturation, a prerequisite for the initiation of both ‘DNA replication and transcription (Ramstein and Lavery, 1988). Furthermore, protein binding to the bent DNA can facilitate further bending to facilitate initiation of DNA replication (and RNA transcription) (Koepsel and Khan, 1986; Snyder et al., 1989). A unique feature of the bent DNA we identified was the symmetrical arrangement of the adenine tracks found within the 65-bp (nt 404 to 468) region: the nodes of the adenine tracts was over three helical turns of the bent DNA on the sense strand from nt 404 to 442 and was over two turns on the anti-sense strand from nt 444 to 468 with nt 442 as the axis of the symmetry. The bent DNA in this region could therefore be described as a tilde ( N ) structure with the axis of inversion (nt 442) being the centre of the tilde. This unique bent DNA is also potentially a very attractive structure relating to DNA conformation and has a strong potential for melting of the double strand prior to the initiation of DNA replication (and RNA transcription). The 17 nucleotide sequence, 5’-TTGGCAATGCGCGCCAA-3’, found from nt 297 to 313 is very similar to the 15 nucleotide adenovirus nuclear factor 1 (NFI) recognition sequence, 5’-TTGG(A/C)NNNNNGCCAA-2’ (Kelly et al., 1988). The NFI binding site, which is located in domain B of the origin of DNA replication in the adenovirus genome, functions as an enhancer of initiation of DNA replication. The potential combination of this sequence and the existence of bent DNA within a relatively short region could be significant in relation to the initiation of DNA replication for the CfMNPV genome. The high frequency of direct and inverted repeats within the 0.9-kb CfMNPV fragment might play a role in the regulation of ARS activity and initiation of DNA replication, since such structures often serve as protein binding sites. They are generally found within origins of DNA replication in prokaryotes such as E. coli and viruses such as SV40 and herpes simplex virus (Bramhill and Kornberg, 1988a, 1988b; Depamphilis and Wassarman, 1982; Weller et al., 1985; Zyskind et al., 1983). A computer search shows various degrees of homologies between the G + C-rich region (nt 700 to 927) of the 0.9-kb ARS-bearing fragment and certain regions of DNAs of other viruses, including herpes simplex virus (McGeoch et al., 1985; Bzik et al., 1986) and Epstein Barr virus (Baer et al., 1984) and of another baculovirus, Orgyia pseudotsugata MNPV (Chen et al., 1988). The significance of these similarities and their biological functions are yet to be determined.

262

ARS sequences have been identified from two DNA segments (EcoRI K and the overlapping region of EcoRI F and Hind111 I> of the genome of a distantly related baculovirus, AcMNPV (Hooft van Iddekinge et al., 1986). We also identified at least one ARS-bearing fragment from He&this zeu nuclear polyhedrosis virus (Lee and Krell, unpublished data). These observations indicate that ARS sequences may occur in other baculovirus genomes and would therefore have a common biological role. Clearly it would be interesting to determine if insect cells are, in the presence of helper viruses, able to support autonomous replication of any or all of the four ARS-bearing fragments which we reported here. Such a functional assay for replication in CfMNPV-infected cells would be needed to determine if the CfMNPV ARSs have the same role in CfMNPV-infected cells.

Acknowledgements

Support for this work by the Natural Sciences and Engineering Research Council of Canada (Grants OGP0008395 and STR 0101482), and the Canadian Forestry Service (PRUF Grant OlK38-6-0016/01-SE) is gratefully acknowledged.

References Anderson, J.N. (1986) Detection, sequence patterns and function of unusual DNA structures. Nucleic Acids Res. 14, 8513-8533. Arif, B.M. and Doerfler, W. (1984) Identification of reiterated sequences in the Choristoneura fumiferana MNPV genome. EMBO J. 3, 525-529. Arif, B.M., Kuzio, J., Faulkner, P. and Doerfler, W. (1984) The genome of Choristoneura fumiferana nuclear polyhedrosis virus: molecular cloning and mapping of the EcoRI, BarnHI, SmaI, XbaI and BglII restriction sites. Virus Res. 1, 605-614. Baer, R., Bankier, A.T., Biggin, M.D., Deininger, P.L., Farell, P.J., Gibson, T.J., Hatfull, G., Hudson, G.S., Satchwell, S.C., Seguin, C., Tuffnell, P.S. and Barrell, B.G. (1984) DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310, 207-211. Boyer, H.W. and Roulland-Dussoix, D. (1969) A complementation analysis of the restriction and modification of DNA in Escherichiu coli. J. Mol. Biol. 41, 459-472. Bramhill, D. and Kornberg, A. (1988a) Duplex opening by dnaA protein at novel sequences in initiation of replication at the origin of the E. coli chromosome. Cell 52, 743-755. Bramhill, D. and Kornberg, A. (1988b) A model for initiation at origins of DNA replication. Cell 54, 915-918. Brewer, B.J. and Fangman, W.L. (1987) The localization of replication origins on ARS plasmids in 5. cereuisiae. Cell 51, 463-471. Broach, J.R., Strathern, J.N. and Hicksons, J.B. (1979) Transformation in yeast: development of a hybrid cloning vector and isolation of the can1 gene. Gene 8, 121-133. Buchman, A.R., Kimmerly, W., Rine, J. and Kornberg, R.D. (1988) Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cereuisiue. Mol. Cell. Biol. 8, 210-225. Bzik, D.J., Debroy, C., Fox, B.A., Pederson, N.E. and Person, S. (1986) The nucleotide sequence of the gB glycoprotein gene of HSV-2 and comparison with the corresponding gene of HSV-1. Virology 155, 322-333. Caddle, M.S., Lussier, R.H. and Heintz, N.H. (1990) Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon. J. Mol. Biol. 211, 19-33.

263 Celniker, SE., Sweder, K., Srienc, F., Baily, J.E. and Campbell, J.L. (1984) Deletion mutations affecting autonomously replicating sequence AR.9 1 of Succharomyces cereuisiae. Mol. Cell. Biol. 4, 245552466. Chen, D.D., Nesson, M.H., Rohrmann, G.F. and Beaudreau, G.S. (1988) The genome of the multicapsid baculovirus of Orgy& pseudotsuguta: restriction map and analysis of two sets of GC-rich repeated sequences. J. Gen. Virol. 69, 13751381. Chen, E.Y. and Seeburg, P.H. (1985) Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4, 165-168. Deb, S., DeLucia, A.L., Koff, A., Tsui, S. and Tegtmeyer, P. (1986) The adenine-thymine domain of the simian virus 40 core origin directs DNA bending and coordinately regulates DNA replication. Mol. Cell. Biol. 6, 4578-4584. DePamphilis, M.L. (1988) Transcriptional elements as components of eukaryotic origins of DNA replication. Cell 52, 635-638. DePamphilis, M.L. and Wassarman, P.M. (1982) Organization and replication of Papovavirus DNA, In A. Kaplan (Ed), Organization and Replication of Viral DNA, pp. 37-94. CRC Press, Boca Raton, FL. Diffley, J.X.F. and Stillman, B. (1988) Purification of a yeast protein that binds to origins of DNA replication and a transcriptional silencer. Proc. Natl. Acad. Sci. USA 85, 2120-2124. Eckdahl, T.T. and Anderson, J.N. (1990) Conserved DNA structures in origins of replication. Nucleic Acids Res. 18, 1609-1612. Feinberg, A.P. and Vogelstein, B. (19831 A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13. Guarino, L.A., Gonzalez, M.A. and Summers, M.D. (1986) Complete sequence and enhancer function of the homologous DNA regions of Autographa cafifonica nuclear polyhedrosis virus. J. Virol. 60, 224-229. Hanahan, D. (1985) Techniques for transformation of E. cob, In D.M. Glover (Ed), DNA cloning, Vol. 1. A Practical Approach, pp. 109-135. IRL Press, Oxford, UK. Hinnen, A., Hicks, J.B. and Fink, G.R. (1978) Transformation of yeast. Proc. Natl. Acad. Sci. USA 75, 1929-1933. Holmes, D.S. and Quigley, M. (19811 A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 114, 193-197. Hooft van Iddekinge, B.J.L, Meyer, D., Zabel, B. and Vlak, J.M. (1986) Detection of sequences in Autographa californica nuclear polyhedrosis virus DNA, that act as autonomously replicating sequences (ARS) in yeast. Arch. Viral. 88, 279-284. Howley, P.M., Israel, M.A., Law, M. and Martin, M.A. (1979) A rapid method for detecting and mapping homology between heterologous DNAs. J. Biol. Chem. 254, 4876-4883. Huberman, J.A., Spotila, L.D., Nawotka, K.A., Elassouli, SM. and Davies, L.R. (1987) The in vivo replication origin of the yeast 2 wrn plasmid. Cell 51, 473-481. Huberman, J.A., Zhu, J., Davies, L.R. and Newlon, C.S. (1988) Close association of a DNA replication origin and an ARS element on chromosome III of the yeast, Saccharomyces cereuisiae. Nucleic Acids Res. 16, 6373-6383. Kawamoto, T., Makino, K., Orita, S., Nakata, A. and Kabunaga, T. (1988) DNA bending and binding factors of the human beta-actin promoter. Nucleic Acids Res. 17, 523-537. Kelly, T.J., Weld, MS. and Li, J. (1988) Initiation of viral DNA replication. In H. Maramorosch and F.A. Murphy (Ed& Advances in Virus Research, Vol. 34, pp. 1-41. Academic Press, Toronto, Ont. Kipling, D. and Kearsey, S.E. (1990) Reversion of autonomously replicating sequence mutations in Saccharomyces cereuisiue: creation of a eukaryotic replication origin within prokaryotic vector DNA. Mol. Cell. Biol. 10, 265-272. Koepsel, R.R. and Khan, S.A. (1986) Static and initiator protein-enhanced bending of DNA at a replication origin. Science 233, 1316-1318. KOO,H.-S., Wu, H.-M. and Crother, D.M. (1986) DNA bending at adenine thymine tracts. Nature 320, 501-506. Linial, M. and Shlomai, J. (19881 Bent DNA structure associated with several origins of replication are recognized by a unique enzyme from trypanosomatids. Nucleic Acids Res. 16, 6477-6493. McGeoch, D.J., Dolan, A., Donald, S. and Rixon, F.J. (1985) Sequence determination and genetic

264 content of the short unique region in the genome of herpes simplex virus type 1. J. Mol. Biol. 181, 1-13. Nasmyth, K.A. and Reed, S.I. (1980) Isolation of genes by complementation in yeast: molecular cloning of a cell-cycle gene. Proc. Natl. Acad. Sci. USA. 77, 2119-2123. Newlon, C.S. (1988) Yeast chromosome replication and segregation. Microbial. Rev. 52, 568-601. Norrander, .I., Kempe, T. and Messing, J. (1983) Construction of improved Ml3 vector using oligodeoxynucleotide-directed mutagenesis. Gene 26, 101-106. Osheim, Y.N., Miller, O.L. Jr. and Beyer, A.L. (1988) Visualization of Drosophilu melanoguster chorion genes undergoing amplification, Mol. Cell. Biol. 8, 2811-2821. Palzkill, T.G., Oliver, S.G. and Newlon, C.S. (1986) DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence. Nucleic Acids Res. 14, 6247-6264. Palzkill, T.G. and Newlon, C.S. (1988) A yeast replication origin consists of multiple copies of a small conserved sequence. Cell 53, 441-450. Potter, A.A., Nasim, A., Zitomer, R.S. and Hollenberg, C.P. (1985) Gene cloning in Saccharomyces cerevisiue. In J.R. Dillon, A. Nasim and E.R. Nestmann (eds.), Recombinant DNA methodology, pp. 127-146. Wiley, Toronto. Ramstein, J. and Lavery, R. (1988) Energetic coupling between DNA bending and base pair opening. Proc. Natl. Acad. Sci. USA 85, 7231-7235. Ryder, K., Silver, S., DeLucia, A.L., Fanning, E. and Tegtmeyer, P. (1986) An altered DNA conformation in origin region 1 is a determinant for the binding of SV40 large T antigen. Cell 44, 719-725. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. Scherer, S., and Davies, R.W. (1979) Replacement of chromosome segments with altered DNA sequences constructed in vitro. Proc. Natl. Acad. Sci. USA 76, 4951-4955. Snyder, M., Buchman, A.R. and Davis, R.W. (1986) Bent DNA at a yeast autonomously replicating sequence. Nature 324, 87-89. Snyder, U.K., Thompson, J.F. and Landy, A. (1989) Phasing of protein-induced DNA bends in a recombination complex. Nature 341, 255-257. Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517. Stinchcomb, D.T., Struhl, H. and Davies, R.W. (1979) Isolation and characterization of a yeast chromosomal replicator. Nature 282, 39-43. Stinchcomb, D.T., Thomas, M., Kelly, J., Selker, E. and Davies, R. W. (1980) Eukaryotic DNA segments capable of autonomous replication in yeast. Proc. Natl. Acad. Sci. USA 77, 4559-4563. Viera, J. and Messing, J. (1982) The pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19, 259-268. Weller, S.K., Spadaro, A., Schaffer, J.E., Murray, A.W., Maxam, A.M. and Schaffer, P.A. (1985) Cloning, sequencing, and functional analysis of oriL, a herpes simplex virus type 1 origin of DNA synthesis. Mol. Cell. Biol. 5, 930-942. Williams, J.S., Eckdahl, T.T. and Anderson, J.N. (1988) Bent DNA functions as a replication enhancer in Saccharomyces cerevisiae. Mol. Cell. Biol. 8, 2763-2769. Wilson, V.G. (1989) Dual loci of DNA bending in the bovine papillomavirus upstream regulatory region. Virus Res. 13, 1-14. Wysokenski, D.A. and Yates, J.L. (1989) Multiple EBNAl-binding sites are required to form an EBNAI-dependent enhancer and to activate a minimal replicative origin within oriP of Epstein-Barr virus. J. Virol. 63, 2657-2666. Zahn, K. and Blattner, F.R. (1985) Sequence-induced DNA curvature at the bacteriophage lambda origin of replication. Nature 317, 451-453. N.E. and Smith, D.W. (1983) Chromosomal Zyskind, J.W., Cleary, J.M., Brusilow, W.S., Harding, replication origin from the marine bacterium Wbrio harveyi functions in Escherichia co/i: oriC consensus sequence. Proc. Natl. Acad. Sci. USA 80, 1164-1168.