Food and Chemical Toxicology 63 (2014) 84–90

Contents lists available at ScienceDirect

Food and Chemical Toxicology journal homepage: www.elsevier.com/locate/foodchemtox

Identification of cadmium-induced Agaricus blazei genes through suppression subtractive hybridization Liling Wang a,1, Haibo Li a,⇑,1, Hailong Wei a, Xueqian Wu a,b, Leqin Ke c a

Zhejiang Forestry Academy, Zhejiang Provincial Key Laboratory of Forest Food, Hangzhou 310023, China Zhejiang Academy of Medical Science, Hangzhou 310013, China c Lishui University, Lishui 323000, China b

a r t i c l e

i n f o

Article history: Received 29 May 2013 Accepted 22 October 2013 Available online 29 October 2013 Keywords: Edible mushroom Agaricus blazei Cadmium Gene expression Suppression subtractive hybridization

a b s t r a c t Cadmium (Cd) is one of the most serious environmental pollutants. Filamentous fungi are very promising organisms for controlling and reducing the amount of heavy metals released by human and industrial activities. However, the molecular mechanisms involved in Cd accumulation and tolerance of filamentous fungi are not fully understood. Agaricus blazei Murrill, an edible mushroom with medicinal properties, demonstrates high tolerance for heavy metals, especially Cd. To investigate the molecular mechanisms underlying the response of A. blazei after Cd exposure, we constructed a forward subtractive library that represents cadmium-induced genes in A. blazei under 4 ppm Cd stress for 14 days using suppression subtractive hybridization combined with mirror orientation selection. Differential screening allowed us to identify 39 upregulated genes, 26 of which are involved in metabolism, protein fate, cellular transport, transport facilitation and transport routes, cell rescue, defense and virulence, transcription, and the action of proteins with a binding function, and 13 are encoding hypothetical proteins with unknown functions. Induction of six A. blazei genes after Cd exposure was further confirmed by RT-qPCR. The cDNAs isolated in this study contribute to our understanding of genes involved in the biochemical pathways that participate in the response of filamentous fungi to Cd exposure. Crown Copyright Ó 2013 Published by Elsevier Ltd. All rights reserved.

1. Introduction The edible basidiomycete Agaricus blazei Murrill, popularly known as ‘Cogumelo do Sol’ in Brazil, ‘Himematsutake’ in Japan, or ‘Ji Song Rong’ in China, is native to Brazil, and has been widely cultivated in Japan and China for its medicinal uses for many years. The fungus is considered as one of the most valuable edible and culinary-medicinal biotechnological mushroom species and its high nutritional and medicinal value has been well documented (Firenzuoli et al., 2008). The polysaccharides phytocomplex of A. blazei is thought to be responsible for its immunostimulant and antitumor properties (Firenzuoli et al., 2008; Biedron et al., 2012). However, the accumulation of heavy metals (especially Cd) in A. blazei has received increasing attention in the past few decades because of its negative impact on food safety, and thus potential threat to consumer health. The harvested fruit bodies of A. blazei is able to accumulate high concentrations of Cd, ranging from 10 mg kg1 to 30 mg kg1 dry matter (Kalacˇ, 2010; Sun et al., 2012), which is much higher than many edible mushroom ⇑ Corresponding author. Address: Zhejiang Forestry Academy, Liuhe Road, 399, Hangzhou 310023, Zhejiang Province, China. Tel.: +86 571 87798035; fax: +86 571 87798206. E-mail address: [email protected] (H. Li). 1 Liling Wang and Haibo Li contributed equally to this work.

species including Agaricus bisporus, Lentinula edodes, Pleurotus ostreatus, Auricularia auricula, and so on. Therefore, some Chinese ecologist is now considered A. blazei as a potential Cd ‘‘hyperaccumulator’’, which could be used for the ecological heavy metal remediation of polluted soil. Recent studies on plant tolerance mechanisms suggest that glutathione (GSH) and its related metabolizing enzymes, proteins, and peptides play a pivotal role in heavy metal tolerance by controlling different plant physiological processes, including reactive oxygen species (ROS) and methylglyoxal (MG) detoxification, heavy metals uptake, translocation, chelation, and detoxification (Hossain et al., 2012). Although molecules related to heavy metals transport, chelation, and sequestration such as transporters and heavy metals chelators are good candidates for accumulation and tolerance, information regarding global gene expression remains very limited. Saccharomyces cerevisiae is a powerful model organism for studying the molecular mechanisms of heavy metal toxicity and tolerance in fungi. Although many findings in recent years have improved our understanding of the mechanisms by which S. cerevisiae and other yeasts cope with heavy metals, molecular insight into many aspects of metal biology remains unknown (Wysocki and Tamás, 2010). These unknown mechanisms include how these proteins that protect cells from heavy metal toxicity mediate tolerance, how heavy metals activate transcription factors and

0278-6915/$ - see front matter Crown Copyright Ó 2013 Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fct.2013.10.036

L. Wang et al. / Food and Chemical Toxicology 63 (2014) 84–90

signaling proteins, and how these proteins, in turn, activate their gene/protein targets. Therefore, further investigations to identify the key genes responsible for Cd accumulation and tolerance are necessary to understand the molecular mechanisms involved in Cd stress response in filamentous fungi. In addition, the key genes related to Cd tolerance are good candidates for altering the accumulation of Cd in A. blazei through genetic improvements, an important issue for food safety with regard to cadmium pollution. Our present study was to investigate the enhanced expressed genes of the fungus A. blazei induced by Cd exposure and focus on the identification of key genes responsible for the Cd stress responses. We achieved this goal using a method based on suppression subtractive hybridization (SSH) combined with mirror orientation selection (MOS). This technique enables us to identify specific rarely expressed cadmium-inducible genes (Diatchenko et al., 1996; Rebrikov et al., 2000). We also adopted cDNA array hybridization as a form of reverse northern blot analysis to eliminate false positive clones and to increase selection efficiency. Additionally, the induction of A. blazei genes after Cd exposure was further confirmed by real-time reverse transcription-polymerase chain reaction (RT-qPCR). 2. Materials and methods 2.1. Fungal material and Cd treatment A strain of A. blazei AB002 was obtained from The Sanming Mycological Institute, Fujian, China. The strain was routinely grown on potato dextrose agar (PDA) medium with 0.5% (w/v) tryptone and transferred to new culture medium every 3 months. Two treatments were established: A. blazei cultured in the presence Cd (tester sample) and fungus cultured in the absence of Cd (driver sample). CdCl2 was added to the culture solution to a final concentration of 4 ppm. After 14 d of treatment, the Cd-treated and untreated A. blazei mycelia were harvested, immediately frozen in liquid nitrogen, and stored at 80 °C until use. 2.2. RNA extraction and SSH/MOS Total RNA was extracted from A. blazei mycelia under both treatments (test and driver samples) using TRIzolÒ Reagent (Gibco, Germany) according to the manufacturer’s instructions. For each treatment, a mixture of RNA were isolated from at least three independent cultures. RQ1 RNase-free DNase (Promega, Madison, WI, USA) was used to remove DNA contamination in RNA samples. The mRNA was isolated using an Oligotex mRNA Mini Kit (Qiagen, Germany). SSH was performed using a PCR-Select cDNA Subtraction Kit (BD Biosciences Clontech, USA) according to the manufacturer’s instructions. Double-stranded cDNA was obtained from the mRNA of the A. blazei mycelia using a SMART PCR cDNA Synthesis Kit (BD Biosciences Clontech, USA) according to the manufacturer’s instructions. The cDNA from the tester and driver samples were digested with Rsa I. Each cDNA from the tester samples was then separated into two portions, and adapters 1 and 2R were each added to one of the two parts. In the first hybridization, the tester samples were hybridized with excess drivers in a ratio of tester: driver 1:30 at 68 °C for 8 h. In the second hybridization, 1 ll driver mixture (1 ll hybridization buffer, 1 ll driver, and 2 ll water) was hybridized with the first hybridization solution at 68 °C overnight. PCR amplification was then performed using PCR primer 1 (50 -CTAATACGACTCACTATAGGGC-30 ), followed by nested PCR primers 1 (50 -TCGAGCGGCCGCCCGGGCAGGT-30 ) and primer 2R (50 AGCGTGGTCGCGGCCGAGGT-30 ), to amplify the differentially expressed cDNA that correspond to the gene population of A. blazei differentially expressed during cadmium exposure. The MOS technique was used to eliminate false positive clones from SSH libraries following the methods of Rebrikov et al. (2000). The products of MOS were cloned into the pMD19-T Vector (Takara, Dalian, China), and then transformed into ultracompetent JM109 Escherichia coli cells using the ligation reaction according to Inoue et al. (1990). More than 1500 positive clones were randomly selected and transferred into 384-well plates, and incubated on a rotating shaker (2000 r/min) at 37 °C for 6 h. 2.3. Subtractive hybridization efficiency test To assess the subtraction efficiency of the suppressive subtractive hybridization procedure, a subtraction efficiency test was performed using a PCR-Select cDNA Subtraction Kit (BD Biosciences Clontech, USA) according to the manufacturer’s instructions. A housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was cloned from A. blazei by using the PCR primers according to

85

Kreuzinger et al. (1996). The primer sets were then used in this experiment to amplify GAPDH, which was chosen as a negative control for subtraction efficiency test. The nucleotide sequence of the GAPDH partial cDNA was deposited in GenBank under accession number KF650659. 2.4. cDNA array and reverse northern blot analysis The cDNA arrays and reverse northern blot analysis were performed according to Li et al. (2013). The A. blazei GAPDH gene was used as the internal standard. 2.5. Sequencing of the subtracted cDNA library and sequence annotations The positive clones obtained through reverse northern blot were sequenced using an automated DNA sequencer (ABI 377; Applied Biosystems, Foster City, CA, USA) at GeneCore BioTechnologies (Shanghai, China). Raw cDNA sequences were initially trimmed for vector, primer, and adapter by Chromas 2.30 (Technelysium, Tewantin, Queensland, Australia) or by visual inspection. Sequences shorter than 100 bases and ambiguous sequences were discarded. The trimmed cDNA sequences that represent the SSH/MOS library were then analyzed for homology using the Basic Local Alignment Search Tool (BLAST) X algorithm at the National Center for Biotechnology Information (NCBI) website (http://blast.ncbi.nlm.nih. gov/Blast.cgi). Only the deduced amino acid sequences from the subtraction library with E values 104 (7.7%). Up to 25 of the 36 EST sequences with E-values < 104 showed significant similarity to known genes and the other 11 to proteins with unknown function (hypothetical proteins). In addition, among the three translated amino acid sequences of the ESTs with E-value > 104, two matched hypothetical proteins and one matched a known gene. Functional analysis indicated that the 26 fungal genes upregulated in the presence of Cd may be involved in metabolism (Clone ID: Ab1–14), protein fate (Ab15–16), cellular transport, transport facilitation, and transport routes (Ab17–18), cell rescue, defense, and virulence (Ab19–24), transcription (Ab25), and proteins with a binding function or cofactor requirements (Ab26); the other 13 fungal genes code for proteins have unknown function (Ab27–39) (Table 1). To confirm the enhanced expression of these genes in response to Cd exposure, six A. blazei genes were selected and the transcript level of each gene was further investigated by RT-qPCR. Relative transcript levels of six genes were standardized to the constitutively expressed GAPDH gene and normalized to the control culture by using the 2DCT method. The standard curve demonstrated amplification efficiency between 90% and 115% for all six genes evaluated. An amplification efficiency of >90% is typically desired for optimal results. As shown in Fig. 3, all six enhanced expressed genes are upregulated in A. blazei in response to Cd exposure. A 15-fold increase in the transcription of the gene that codes for glutathione peroxidase (Ab2), 3-fold of the gene that codes phospholipase D/nuclease (Ab6), and 5-fold of the genes that code alcohol dehydrogenase (Ab3) and cysteine proteinase (Ab15)

were observed in A. blazei cultured with Cd (tester) compared with that without Cd (driver), which confirms the activation of these genes in response to Cd exposure (Fig. 3A and B). Specifically, a significant increase (approximately 100-fold) in the expression of endoplasmic reticulum receptors (Ab16) and cytochrome P450 enzymes (Ab19) were observed after Cd exposure (Fig. 3B).

4. Discussion Heavy metal toxicity may be caused by oxidative stress, impaired DNA repair, inhibition of enzyme function, and functional disruption of proteins that regulate cell proliferation, cell cycle progression, apoptosis and cell differentiation (Wysocki and Tamás, 2010). In the present study, we identified 39 upregulated genes from A. blazei following Cd exposure, which are distributed in different functional categories. This result suggests that Cd stress activates a complex series of molecular mechanisms, as shown by Minglin et al. (2005) for Brassica juncea and Zhang et al. (2011) for rice, where a number of upregulated genes were isolated under Cd stress. Fourteen metabolism-related genes in A. blazei were induced by Cd exposure, which are involved in antioxidative defense, glucose metabolism, the stabilization of DNA, the production of melanin and chitosan, lipid signaling, glutamate synthesis, and so on. In addition, some genes related to protein degradation, protein translocation, cellular transport, cellular detoxification, and the pre-mRNA splicing pathway were also activated under Cd stress. The altered expression of these enzymes emphasizes the multiple cellular and physiologic aspects inhibited or disrupted by Cd exposure. Heavy metal stress invariably induces oxidative stress and antioxidative defense systems, which are composed of free radical scavenging molecules such as ascorbic acid (AsA) and glutathione (GSH) and the enzymes involved in their biosynthesis and reduction (Hossain et al., 2012). A large number of recent studies in plants suggest that GSH by itself and its related metabolizing enzymes-notably glutathione S-transferase (GST), glutathione peroxidase (GPX), etc. proteins, and peptides play a pivotal role in heavy metal tolerance. GPX and GST, like all the other antioxidant enzymes, function to protect against Cd toxicity and provide a first line of defense against Cd before the induction of any metallothionein synthesis occurs (Sidhu et al., 1993; Basha and Rani, 2003; Spiazzi et al., 2013). GPX catalyzes GSH and produce oxidized glutathione (GSSG) and GST is responsible for tagging cyanidin-3glucoside with the tripeptide glutathione, allowing it to be recognized for transport into the vacuole and gene expression is highly induced by heavy metals such as Cd (Marrs and Walbot, 1997). In the present study, we observed that two genes that

Fig. 2. Differential screening of positive clones from the subtractive library by using reverse Northern blot experiments. Hybridizations were carried out using DIG-labelled cDNA probes obtained from driver and tester samples. (A) Driver samples representing fungus cultured in the absence of cadmium and (B) tester sample representing fungus cultured in the presence of cadmium.

Table 1 Identification of the possible proteins coded by the cDNAs of the suppression subtractive library of the fungus Agaricus blazei induced by cadmium. GenBank accession number of dbEST

GenBank accession number of closest homolog

Database match

e-Value

Metabolism Ab1 (626) Ab2 (495) Ab3 (522) Ab4 (550) Ab5 (554) Ab6 (486) Ab7 (654) Ab8 (549)

JZ494732 JZ494733 JZ494734 JZ494735 JZ494736 JZ494737 JZ494738 JZ494739

EKV46519.1 EIN09702.1 XP_002910599.1 EJF56591.1 EIW55749.1 EIN06494.1 XP_001878127.1 EIN14017.1

9e-110 4e-75 1e-64 1e-34 2e-45 1e-58 5e-67 3e-29

Ab9 (633) Ab10 (307) Ab11 (517) Ab12 (322) Ab13 (462) Ab14 (290)

JZ494740 JZ494741 JZ494742 JZ494743 JZ494744 JZ494745

2Y9W_A XP_001830578.1 YP_005006403.1 XP_001889833.1 XP_001838582.1 EIN10667.1

Phosphoglucomutase [Agaricus bisporus var. bisporus H97] Glutathione peroxidase [Punctularia strigosozonata HHB-11173 SS5] Alcohol dehydrogenase [Coprinopsis cinerea okayama7#130] Thiol methyltransferase 1 [Dichomitus squalens LYAD-421 SS1] Class I glutamine amidotransferase-like protein [Trametes versicolor FP-101664 SS1] Phospholipase D/nuclease [Punctularia strigosozonata HHB-11173 SS5] Carbohydrate esterase family 4 protein[Laccaria bicolor S238N-H82] Membrane-associated proteins in eicosanoid and glutathione metabolism [Punctularia strigosozonata HHB-11173 SS5] Chain A, Crystal Structure Of Ppo3, A Tyrosinase [Agaricus Bisporus] Aryl-alcohol dehydrogenase [Coprinopsis cinerea okayama7#130] NADPH: quinone reductase [Niastella koreensis GR20-10] Arginine methyltransferase [Laccaria bicolor S238N-H82] Glutathione S-transferase [Coprinopsis cinerea okayama7#130] S-adenosyl-L-methionine-dependent methyltransferase [Punctularia strigosozonata HHB-11173 SS5]

Protein fate Ab15 (542) Ab16 (681)

JZ494746 JZ494747

EJD07356.1 XP_001832525.1

Cysteine proteinase [Fomitiporia mediterranea MF3/22] Endoplasmic reticulum receptor Sec62 [Coprinopsis cinerea okayama7#130]

4e-28 6e-42

Cellular transport, transport facilitation and transport routes Ab17 (392) JZ494748 Ab18 (447) JZ494749

XP_001887267.1 XP_001830214.2

FUN34 transmembrane protein [Laccaria bicolor S238N-H82] RER1 [Coprinopsis cinerea okayama7#130]

5e-16 3e-29

Cell rescue, defense and virulence Ab19 (665) JZ494750 Ab20 (719) JZ494751 Ab21 (372) JZ494752 Ab22 (530) JZ494753 Ab23 (388) JZ494754 Ab24 (369) JZ494755

EIM80683.1 EJD07780.1 EKV51603.1 EIW64117.1 EIN06110.1 EKV51603.1

Cytochrome Cytochrome Cytochrome Cytochrome Cytochrome Cytochrome

5e-34 5e-64 3e-51 9e-13 5e-06 7e-25

Transcription Ab25 (507)

JZ494756

P450 [Stereum hirsutum FP-91666 SS1] P450 [Fomitiporia mediterranea MF3/22] P450 C-22 desaturase [Agaricus bisporus var. bisporus H97] P450, partial [Trametes versicolor FP-101664 SS1] P450 [Punctularia strigosozonata HHB-11173 SS5] P450 C-22 desaturase [Agaricus bisporus var. bisporus H97]

2e-99 1e-27 4e-04 2e-18 8e-51 6e-26

XP_001837357.1

U4/U6 small nuclear ribonucleoprotein Prp31 [Coprinopsis cinerea okayama7#130]

3e-31

Protein with binding function or cofactor requirement Ab26 (431) JZ494757

EPQ52507.1

NADP-binding protein [Trametes versicolor FP-101664 SS1]

2e-14

Proteins of unknown function Ab27 (568) JZ494758 Ab28 (610) JZ494759 Ab29 (380) JZ494760 Ab30 (518) JZ494761 Ab31 (416) JZ494762 Ab32 (463) JZ494763 Ab33 (548) JZ494764 Ab34 (482) JZ494765 Ab35 (379) JZ494766 Ab36 (451) JZ494767 Ab37 (479) JZ494768 Ab38 (466) JZ494769 Ab39 (601) JZ494770

EJD48977.1 EKM79511.1 EKV47045.1 EKM77901.1 EKV42896.1 EKM82089.1 EKM83405.1 EKM76438.1 EIW56015.1 EKV44752.1 EKM84286.1 ZP_02211272.1 EKM81594.1

Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical Hypothetical

3e-13 8e-100 2e-25 3e-13 3e-49 2e-30 9e-71 7e-08 0.004 7e-46 7e-34 0.26 6e-50

protein protein protein protein protein protein protein protein protein protein protein protein protein

[Auricularia delicata TFB-10046 SS5] [Agaricus bisporus var. burnettii JB137-S8] [Agaricus bisporus var. bisporus H97] [Agaricus bisporus var. burnettii JB137-S8] [Agaricus bisporus var. bisporus H97] [Agaricus bisporus var. burnettii JB137-S8] [Agaricus bisporus var. burnettii JB137-S8] [Agaricus bisporus var. burnettii JB137-S8] [Trametes versicolor FP-101664 SS1] [Agaricus bisporus var. bisporus H97] [Agaricus bisporus var. burnettii JB137-S8] [Clostridium bartlettii DSM 16795] [Agaricus bisporus var. burnettii JB137-S8]

L. Wang et al. / Food and Chemical Toxicology 63 (2014) 84–90

Clone (size in bp)

87

88

L. Wang et al. / Food and Chemical Toxicology 63 (2014) 84–90

Table 2 Oligonucleotides used for gene expression evaluation and subtractive library validation of Agaricus blazei exposed to cadmium through RT-qPCR. Clone

Primers

Oligonucleotides 50 –30

Ab2

Ab2-1F Ab2-1R

TCAGTATAAAGGTCTCCAGGCTCT CTTAAGCCACTTGTAAACCTCGT

Ab3

Ab3-1F Ab3-1R

AAAACGACAGATACACGTCAGGT CGAATACTGATATCTTTGCCAACCAC

Ab6

Ab6-1F Ab6-1R

GACAGAATTATTCGTGCAGCTC ATGATAAAATCGGATGTAGTCCA

Ab15

Ab15-1F Ab15-1R

ATCTGCTCACTTTTCCATTCGAGA AAACCACGCAACATTTCTAGCAA

Ab16

Ab16-1F Ab16-1R

TCAACCATAGGAGCCAGAAGGTCA TGCCGTCATCCTCGTTATCGCTA

Ab19

Ab19-1F Ab19-1R

GGCCCAAACGTATAATCAGCTTG CACCGCTATCAGATACATGTCCA

GAPDH

Abgap-1F Abgap-1R

AAGGGGCGGAGATAATGACT TTGAAGTCGTCGCTGTGAAC

encode GPX (Ab2) and GST (Ab13) in A. blazei were induced by Cd exposure, as shown by Kovalchuk et al. (2005) in their transcriptome profiling of plant responses to Cd and Lead. In addition, GST/GPX overexpression enhanced the growth of transgenic tobacco seedlings during stress, which could be caused by oxidation of the glutathione pool (Roxas et al., 1997). These studies suggest that the increased expression of GPX and GST under Cd exposure cause the depletion of the antioxidant GSH, which was regarded as a general toxicity mechanism by metal chelation in plant and fungi. A gene that encodes a membrane-associated protein in eicosanoid and glutathione metabolism (MAPEG) (Ab8) was identified from the present SSH library. MAPEG is a widespread superfamily of membrane-associated proteins with highly divergent functions in eicosanoid and glutathione metabolism. Three members of the family are cytoprotective exhibiting glutathione S-transferase and peroxidase activities (Jakobsson et al., 1999). Therefore, we speculate that the increased expression of MAPEG in A. blazei may have antioxidant properties. NADPH: quinone reductase [or NADPH: quinone oxidoreductase (NQO)] is an important factor in the cellular antioxidant defense system and it represents a widely distributed FAD-dependent flavoprotein with multiple protective functions (Stoehr et al., 2012). The increased expression of the NQO gene (Ab11) in A. blazei upon Cd exposure is consistent with the results by Elbekai and El-Kadi (2008), which indicate that Cd induced NQO expression at the transcriptional level through a labile protein-mediated pathway. We presume that Cd exposure may trigger ROS accumulation in A. blazei, thus, genes such as GPX, GST, MAPEG, and NQO that are upregulated by Cd stress

would be helpful in eliminating ROS in A. blazei mycelial cells and may aid in the protection of fungal cells from Cd toxicity. Phosphoglucomutase (PGM) catalyzes the interconversion of glucose-1-phosphate and glucose-6-phosphate and plays a pivotal role in the synthesis and breakdown of glycogen (Ray and Roscelli, 1964). PGM mRNA expression in Crassostrea gigas is mostly upregulated in the first stages of the response to pollutant stress (Tanguy et al., 2006). Our present study shows that the expression of a gene that encodes PGM (Ab1) was activated in A. blazei in response to Cd stress. A similar result was observed in Cd-treated Arabidopsis thaliana seedlings (Liu et al., 2012). The upregulation of the PGM gene by Cd and pollutant exposure suggests that Cd activates the biochemical pathways required for utilizing glucose as a carbon and energy source under abiotic stress. Class-I glutamine amidotransferase-like protein (GAT1), a key enzyme involved glutamate synthesis from glutamine, belongs to a superfamily for which A. thaliana has 30 potential members and some are of unknown function (Zhu and Kranz, 2012). GAT1 is activated in rice under high temperatures (El-Kereamy et al., 2012). The increased GAT1 expression (Ab5) upon Cd exposure suggests that the enhanced glutamine metabolism in A. blazei is involved in its Cd tolerance. Alcohol dehydrogenases (ADHs) and aryl-alcohol dehydrogenases (AADs) belong to the oxidoreductase family. ADH catalyzes the NAD(P)H-dependent reduction of a variety of endogenous and xenobiotic carbonyl compounds and plays an important role in many physiologic processes involved in steroids, vitamins, lipid peroxidation products, fatty acids, ethanol, and other metabolic processes (Reid and Fewson, 1994). However, very little is known about AAD and its involvement in the molecular tolerance of heavy metals. AAD may be involved in oxidative stress response and its expression in S. cerevisiae was induced by chromate exposure (Pereira et al., 2008). The change in ADH gene expression is the first response of plants to heavy metal pollution, as shown by Lu and Wang (1998), with ADH expression in wheat activated within 45 h. However, our present study shows that ADH (Ab3) and AAD (Ab10) in A. blazei were induced after 14 d of Cd exposure, which suggests that oxidoreductases, such as ADH and AAD, may be involved in heavy metal tolerance during the later stages. Methyltransferases are transferases that catalyze the transfer of methyl groups from a donor to methylate substrates (Bok and Keller, 2004). Well-known methyltransferases include histone and arginine methyltransferase, which participates in the regulation of gene expression in eukaryotes, in part through modification of the chromatin structure (Mowen, 2001). S-adenosyl-L-methionine-dependent methyltransferase (SAM-Mtase) may be involved in the stabilization of DNA, RNA, proteins, cellular signaling

Fig. 3. Gene expression of Agaricus blazei cultured in the presence of cadmium (Test) in relation to that of fungus cultured in the absence of cadmium (Driver). The X axis presents the target genes and the Y axis the level of gene expression correspondent to the expression of the target genes in relation to the calibrator, normalized by the GAPDH endogenous control. The evaluated genes possibly control (A) glutathione peroxidase (Ab2), phospholipase D/nuclease (Ab6), cysteine proteinase (Ab15); (B) alcohol dehydrogenase (Ab3), endoplasmic reticulum receptor (Ab16), cytochrome P450 (Ab19). Data are representative of results obtained at least in three independent experiments. Error bars represent SE (n > 3). The asterisk indicates that cadmium-treated fungi and control values are significantly different (P < 0.05).

L. Wang et al. / Food and Chemical Toxicology 63 (2014) 84–90

pathways, and protein synthesis (Clarke and Banfield, 2001). The increased expression of three methyltransferases including thiol methyltransferase 1 (Ab4), arginine methyltransferase (Ab12), and SAM-Mtase (Ab14) identified from A. blazei upon Cd exposure suggests the probable role of abnormal methylation in the toxicity of Cd, as shown by Takiguchi et al. (2003), where prolonged Cd exposure resulted in DNA hypermethylation and enhanced DNA methyltransferase activity. Tyrosinase is the rate-limiting enzyme for melanin production and it is required for pigmentation. Fungal melanins enhance cell survival under metal stress because they possess several metalbinding sites (Eisenman and Casadevall, 2012; Apte et al., 2013). Therefore, the increased tyrosinase expression (Ab9) in the Cdtreated A. blazei might be involved in the increase in melanin production for sequestering Cd ions in the cells. A gene (Ab7) similar to the carbohydrate esterase family 4 (CE4) protein of Laccaria bicolor and the chitin deacetylase of Flammulina velutipes was identified in the present SSH library. As a CE4 protein, chitin deacetylase catalyzes the N-deacetylation of chitin to form chitosan, a polymer of b-(1,4)-linked D-glucosamine residues, and it is involved in biological attack and defense systems (Tsigos et al., 2000; Zhao et al., 2010). Chitin deacetylase has been suggested to be a metalloenzyme and its catalytic ability is enhanced in the presence of Zn, Ca, and Co (Zhao et al., 2010). As a biopolymer, chitosan is a good adsorbent for removing various anionic and cationic dyes, as well as heavy metal ions (Wan Ngah et al., 2010). The induced chitin deacetylase gene expression under Cd stress suggests that A. blazei produces high amounts of chitosan to adsorb Cd to increase its tolerance to Cd stress. Phospholipases catalyze the initial step in phospholipid hydrolysis, and are therefore of utmost importance in lipid signaling. Phospholipase D (PLD) regulates various cellular processes in plants such as abscisic acid signaling, programmed cell death, biotic and abiotic stresses, and so on (Singh et al., 2012). Many findings have established the connection between stress signaling and ROS production, which is mediated by PLD, and suggested that PLD regulates ROS-mediated cell death positively and ultimately leads to cell protection (Zhang et al., 2003). Therefore, the increased PLD expression in A. blazei (Ab6) in response to Cd stress suggests that Cd induces the accumulation of ROS and that PLD functions with ROS to mediate programmed cell death and eventually enhance Cd tolerance. Cysteine proteinases participate in the degradation of storage proteins, the turnover of proteins in response to abiotic and biotic stresses and in programmed cell death accompanying hypersensitivity responses to pathogen attack, tracheary element differentiation, and organ senescence (Grudkowska and Zagdan´ska, 2004). The cysteine protease expression in A. blazei (Ab15) was upregulated by Cd stress, which is supported by similar studies on A. thaliana and Chlamydomonas sp. (Kovalchuk, 2005; Usui et al., 2007). These studies suggest that cysteine protease is activated in response to abiotic stress and is likely involved in the maintenance of abnormal or non-functional degrading proteins. Sec62, an endoplasmic reticulum (ER) receptor is part of the protein translocation apparatus in the membrane of the ER. Sec62 participates in the post-translational translocation of proteins into the ER (Greiner et al., 2011). Few studies have focused on the Sec62 gene under abiotic stress. However, our present study indicates that Cd activates Sec62 gene expression in A. blazei (Ab16), which in turn suggests that the increased translocation of proteins into the ER is involved in Cd tolerance. The Gpr1/Fun34/YaaH transmembrane protein (Ab17), as well as the retention in endoplasmic reticulum 1 (RER1) transmembrane protein (Ab18) were identified from the present Cd-treated A. blazei. The functions of the Fun34 family are unknown, although some studies have shown that several members are involved in

89

ammonia secretion, acetate uptake, and in adaptation to acetic acid (Gentsch and Barth, 2005). AcpA, a member of this family in the hyphal fungus Aspergillus nidulans might also be involved in acetate adaptation, uptake, and/or catabolism (Robellet et al., 2008). RER1 proteins are involved in the retrieval of ER membrane proteins from the early Golgi compartment and in the retrieval of unassembled subunits of multimeric complexes. The C terminus of yeast Rer1p interacts with a coatomer complex (Sato et al., 2001, 2003). The signals should be recognized by this retrieval system. The increased expression of genes that encode Fun34 transmembrane protein and RER1 transmembrane protein in A. blazei suggest they were likely involved in heavy metal Cd cellular transport in the plasma membrane and in detoxification. The cytochrome P450 gene family participates in the production of diverse metabolites, as well as plays critical roles in adaptation to specific ecological and/or nutritional niches by modifying potentially harmful environmental chemicals (Park et al., 2008). In fungi, P450 enzymes have contributed to exploration of and to adaptation to diverse ecological niches such as the degradation of a vast array of environmental toxicants (Hlavica, 2012). Many studies have shown that Cd exposure causes the overexpression of cytochrome P450 genes (Smida et al., 2004; Cui et al., 2007; Zhang et al., 2011; Casanova et al., 2013). In the present study, we identified six different members of the cytochrome P450 family (Ab19–24) from A. blazei upon Cd exposure. Therefore, the increased cytochrome P450 expression may be involved in cellular detoxification processes, which suggests that the defense mechanism of the fungus is activated by Cd toxicity. Pre-mRNA splicing factor 31 (Prp31) is a component of the U4/U6 small nuclear ribonucleoprotein complex that is directly involved in the pre-mRNA splicing pathway (Weidenhammer et al., 1996). The increased Prp31 gene expression in A. blazei upon Cd exposure (Ab25) and in Nicotiana tabacum under salinity stress (Li et al., 2009) suggests that the pre-mRNA splicing pathway may be involved in abiotic stress. In conclusion, although our present study does not describe an exhaustive survey of all the possible Cd-induced changes in gene expression in A. blazei, we identified some novel Cd-responsive genes and possible pathways not previously recognized. A network of multiple mechanisms is finely organized for Cd accumulation and tolerance whether in plants or in fungi. These novel Cdresponsive genes identified in our study deserve in-depth functional analysis in the future, which will clarify their involvement in the tolerance mechanisms during Cd stress and enable their use in altering the metal-accumulation capacity of filamentous fungi.

5. Conflict of Interest The authors declare that there are no conflicts of interest.

Acknowledgments This work was supported by the Natural Science Foundation of Zhejiang Province, China (Grant No. Y3110048), the Project of Innovation Team Construction on Edible Mushroom of Zhejiang Province, China (Grant No. 2009R50029), the Joint Project on Forestry Science and Technology, Zhejiang Province and the Chinese Academy of Forestry (Grant No. 2011SY06), the Project of Science and Technology Programme of Zhejiang Science Technology Department, China (Grant No. 2011F20014), and the Project of Innovation Team Construction and Talents Cultivation on Forest food research of Zhejiang Province, China (Grant No. 2012bF20012).

90

L. Wang et al. / Food and Chemical Toxicology 63 (2014) 84–90

References Apte, M., Girme, G., Bankar, A., Ravikumar, A., Zinjarde, S., 2013. 3, 4-Dihydroxy-Lphenylalanine-derived melanin from Yarrowia lipolytica mediates the synthesis of silver and gold nanostructures. J. Nanobiotechnol. 11 (1), 2. Basha, P.S., Rani, A.U., 2003. Cadmium-induced antioxidant defense mechanism in freshwater teleost Oreochromis mossambicus (Tilapia). Ecotoxicol. Environ. Saf. 56 (2), 218–221. Biedron, R., Tangen, J.M., Maresz, K., Hetland, G., 2012. Agaricus blazei Murill – immunomodulatory properties and health benefits. Funct Foods Health Dis 2 (11), 428–447. Bok, J.W., Keller, N.P., 2004. LaeA, a regulator of secondary metabolism in Aspergillus spp. Eukaryot. Cell. 3, 527–535. Casanova, F., Honda, R.T., Ferreira-Nozawa, M.S., Rocha Aride, P.H., Nozawa, S.R., 2013. Effects of copper and cadmium exposure on mRNA expression of catalase, glutamine synthetase, cytochrome p450 and heat shock protein 70 in tambaqui fish (Colossoma macropomum). Gene Express. Genet. Genom. 6, 1–8. Clarke, S., Banfield, K., 2001. S-adenosyl-L-methionine-dependent methyltransferases. In: Carmel, R., Jacobsen, D.W. (Eds.), Homocysteine in Health and Disease. Cambridge University Press, London, pp. 63–78. Cui, Y., McBride, S.J., Boyd, W.A., Alper, S., Freedman, J.H., 2007. Toxicogenomic analysis of Caenorhabditis elegans reveals novel genes and pathways involved in the resistance to cadmium toxicity. Genome Biol. 8, R122. Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., Siebert, P.D., 1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. USA 93 (12), 6025–6030. Eisenman, H.C., Casadevall, A., 2012. Synthesis and assembly of fungal melanin. Appl. Microbiol. Biotechnol. 93, 931–940. Elbekai, R.H., El-Kadi, A.O.S., 2008. Arsenite and cadmium, but not chromium, induce NAD(P)H: quinone oxidoreductase 1 through transcriptional mechanisms, in spite of post-transcriptional modifications. Toxicol. In Vitro 22, 1184–1190. El-kereamy, A., Bi, Y.M., Ranathunge, K., Beatty, P.H., Good, A.G., Rothstein, S.J., 2012. The rice R2R3–MYB transcription factor OsMYB55 is involved in the tolerance to high temperature and modulates amino acid metabolism. PLoS ONE 7 (12), e52030. http://dx.doi.org/10.1371/journal.pone.0052030. Firenzuoli, F., Gori, L., Lombardo, G., 2008. The medicinal mushroom Agaricus blazei Murrill: review of literature and pharmaco-toxicological problems. Evid. Based Complem. Altern. Med. 5 (1), 3–15. Gentsch, M., Barth, G., 2005. Carbon source dependent phosphorylation of the Gpr1 protein in the yeast Yarrowia lipolytica. FEMS Yeast Res. 5, 909–917. Greiner, M., Kreutzer, B., Jung, V., Grobholz, R., Hasenfus, A., Stöhr, R.F., Tornillo, L., Dudek, J., Stöckle, M., Unteregger, G., Kamradt, J., Wullich, B., Zimmermann, R., 2011. Silencing of the Sec62 gene inhibits migratory and invasive potential of various tumor cells. Int. J. Cancer 128, 2284–2295. Grudkowska, M., Zagdan´ska, B., 2004. Multifunctional role of plant cysteine proteinases. Acta Biochim. Pol. 51 (3), 609–624. Hlavica, P., 2012. Evaluation of structural features in fungal cytochromes P450 predicted to rule catalytic diversification. Biochim. Biophys. Acta 1834 (1), 205– 220. Hossain, M.A., Piyatida, P., Teixeira da Silva, J.A., Fujita, M., 2012. Molecular mechanism of heavy metal toxicity and tolerance in plants: central role of glutathione in detoxification of reactive oxygen species and methylglyoxal and in heavy metal chelation. J. Bot. http://dx.doi.org/10.1155/2012/872875. Inoue, H., Nojima, H., Okayama, H., 1990. High efficiency transformation of Escherichia coli with plasmids. Gene 96, 23–28. Jakobsson, P.J., Morgenstern, R., Mancini, J., Ford-Hutchinson, A., Persson, B., 1999. Common structural features of MAPEG-a widespread superfamily of membrane associated proteins with highly divergent functions in eicosanoid and glutathione metabolism. Protein Sci. 8 (3), 689–692. Kalacˇ, P., 2010. Trace element contents in European species of wild growing edible mushrooms: a review for the period 2000–2009. Food Chem. 122, 2–15. Kovalchuk, I., Titov, V., Hohn, B., Kovalchuk, O., 2005. Transcriptome profiling reveals similarities and differences in plant responses to cadmium and lead. Mutat. Res. 570 (2), 149–161. Kreuzinger, N., Podeu, R., Gruber, F., Göbl, F., Kubicek, C.P., 1996. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes. Appl. Environ. Microbiol. 62 (9), 3432–3438. Li, W.Z., Song, L.M., Li, Y.P., Lu, X.P., Luo, H.M., Dai, C.E., Fang, Y.Q., Dong, H.T., Li, D.B., 2009. Expressed sequence tag analysis and cDNA array establishment of Nicotiana tabacum: application to salinity stress. Chin. J. Agr. Biotechnol. 6 (1), 81–89. Li, H., Peng, H., Wang, L., Wei, H., Li, N., Jin, Q., 2013. Identification of fungal genes involved in the preinfection events between ectomycorrhizal association (Pisolithus tinctorius and Pinus massoniana). Mycol. Prog. http://dx.doi.org/ 10.1007/s11557-013-0899-1. Liu, W., Sun, L., Zhong, M., Zhou, Q., Gong, Z., Li, P., Tai, P., Li, X., 2012. Cadmiuminduced DNA damage and mutations in Arabidopsis plantlet shoots identified by DNA fingerprinting. Chemosphere 89, 1048–1055. Lu, Z., Wang, H., 1998. Effects of cadmium and lead on ADH gene expression. Acta Sci. Circum. 18 (5), 500–503.

Marrs, K.A., Walbot, V., 1997. Expression and RNA splicing of the maize glutathione S-transferase bronze2 gene is regulated by cadmium and other stresses. Plant Physiol. 113, 93–102. Minglin, L., Yuxiu, Z., Tuanyao, C., 2005. Identification of genes up-regulated in response to Cd exposure in Brassica juncea L. Gene. 363, 151–158. Mowen, K.A., 2001. Arginine methylation of STAT1 modulates IFN alpha/betainduced transcription. Cell 104, 731–741. Park, J., Lee, S., Choi, J., Ahn, K., Park, B., Park, J., Kang, S., Lee, Y.H., 2008. Fungal cytochrome P450 database. BMC Genom. 9, 402. http://dx.doi.org/10.1186/ 1471-2164-9-402. Pereira, Y., Lagniel, G., Godat, E., Baudouin-Cornu, P., Junot, C., Labarre, J., 2008. Chromate causes sulfur starvation in yeast. Toxicol. Sci. 106 (2), 400–412. Ray Jr., W.J., Roscelli, G.A., 1964. A kinetic study of the phosphoglucomutase pathway. J. Biol. Chem. 239, 1228–1236. Rebrikov, D.V., Britanova, O.V., Gurskaya, N.G., Lukyanov, K.A., Tarabykin, V.S., Lukyanov, S.A., 2000. Mirror orientation selection (MOS): a method for eliminating false positive clones from libraries generated by suppression subtractive hybridization. Nucleic Acids Res. 28, E90. Reid, M.F., Fewson, C.A., 1994. Molecular characterization of microbial alcohol dehydrogenases. Crit. Rev. Microbiol. 20, 13–56. Robellet, X., Flipphi, M., Pégot, S., Maccabe, A.P., Vélot, C., 2008. AcpA, a member of the GPR1/FUN34/YaaH membrane protein family, is essential for acetate permease activity in the hyphal fungus Aspergillus nidulans. Biochem. J. 412, 485–493. Roxas, V.P., Smith, R.K., Allen, E.R., Allen, R.D., 1997. Overexpression of glutathione S-transferase/glutathione peroxidase enhances the growth of transgenic tobacco seedlings during stress. Nat. Biotechnol. 15, 988–991. Sato, K., Sato, M., Nakano, A., 2001. Rer1p, a retrieval receptor for endoplasmic reticulum membrane proteins, is dynamically localized to the golgi apparatus by coatomer. J. Cell Biol. 152 (5), 935–944. Sato, K., Sato, M., Nakano, A., 2003. Rer1p, a retrieval receptor for ER membrane proteins, recognizes transmembrane domains in multiple modes. Mol. Biol. Cell 14, 3605–3616. Sidhu, M., Sharma, M., Bhatia, M., Awasthi, Y.C., Nath, R., 1993. Effect of chronic cadmium exposure on glutathione S-transferase and glutathione peroxidase activities in Rhesus monkey: the role of selenium. Toxicology. 83, 203–213. Singh, A., Pandey, A., Pandey, G.K., 2012. Phospholipase D in stress activated lipid signaling in plants. Plant Stress. 6, 10–17. Smida, A., Valderrama, X.P., Agostini, M.C., Furlan, M.A., Chedrese, J., 2004. Cadmium stimulates transcription of the cytochrome p450 side chain cleavage gene in genetically modified stable porcine granulosa cells. Biol. Reprod. 70 (1), 25–31. Spiazzi, C.C., Manfredini, V., Barcellos da Silva, F.E., Flores, E.M., Izaguirry, A.P., Vargas, L.M., Soares, M.B., Santos, F.W., 2013. C-Oryzanol protects against acute cadmium-induced oxidative damage in mice testes. Food Chem. Toxicol. 55, 526–532. Stoehr, C.G., Nolte, E., Wach, S., Wieland, W.F., Hofstaedter, F., Hartmann, A., Stoehr, R., 2012. NAD(P)H: quinone oxidoreductase 1 (NQO1) P187S polymorphism and prostate cancer risk in caucasians. Int. J. Mol. Sci. 13 (9), 10959–10969. Sun, L., Liu, G., Yang, M., Zhuang, Y., 2012. Bioaccessibility of cadmium in fresh and cooked Agaricus blazei Murill assessed by in vitro biomimetic digestion system. Food Chem. Toxicol. 50, 1729–1733. Takiguchi, M., Achanzar, W.E., Qu, W., Li, G., Waalkes, M.P., 2003. Effects of cadmium on DNA-(Cytosine-5) methyltransferase activity and DNA methylation status during cadmium-induced cellular transformation. Exp. Cell Res. 286 (2), 355–365. Tanguy, A., Boutet, I., Boudry, P., Degremont, L., Laroche, J., Moraga, D., 2006. Molecular identification and expression of the phosphoglucomutase (PGM) gene from the Pacific oyster Crassostrea gigas. Gene 382, 20–27. Tsigos, I., Martinou, A., Kafetzopoulos, D., Bouriotis, V., 2000. Chitin deacetylases: new, versatile tools in biotechnology. Trends Biotechnol. 18, 305–312. Usui, M., Tanaka, S., Miyasaka, H., Suzuki, Y., Shioi, Y., 2007. Characterization of cysteine protease induced by oxidative stress in cells of Chlamydomonas sp. strain W80. Physiol. Plant. 131, 519–526. Wan Ngah, W.S., Teong, L.C., Hanafiah, M.A.K.M., 2010. Adsorption of dyes and heavy metal ions by chitosan composites: a review. Carbohydr. Polym. 83, 1446–1456. Weidenhammer, E.M., Singh, M., Ruiz-Noriega, M., Woolford Jr., J.L., 1996. The PRP31 gene encodes a novel protein required for pre-mRNA splicing in Saccharomyces cerevisiae. Nucleic Acids Res. 24 (6), 1164–1170. Wysocki, R., Tamás, M.J., 2010. How Saccharomyces cerevisiae copes with toxic metals and metalloids. FEMS Microbiol. Rev. 34 (6), 925–951. Zhang, W., Wang, C., Qin, C., Wood, T., Olafsdottir, G., Welti, R., Wang, X., 2003. The oleate-stimulated phospholipase D, PLDd, and phosphatidic acid decrease H2O2induced cell death in Arabidopsis. Plant Cell 15, 2285–2295. Zhang, M., Liu, X., Yuan, L., Wu, K., Duan, J., Wang, X., Yang, L., 2011. Transcriptional profiling in cadmium-treated rice seedling roots using suppressive subtractive hybridization. Plant Physiol. Biochem. 50, 79–86. Zhao, Y., Park, R.D., Muzzarelli, R.A.A., 2010. Chitin deacetylases: properties and applications. Mar. Drugs 8, 24–46. Zhu, H., Kranz, R.G., 2012. A nitrogen-regulated glutamine amidotransferase (GAT1_2.1) represses shoot branching in Arabidopsis. Plant Physiol. 160, 1770–1780.