Gene, 1i0 (1992) 181-187 © 1992 Elsevier Science Publishers B.V. All rights reserved. 0378-1119/92/$05.00

181

GENE 06266

Identification of c D N A s encoding two novel rat pancreatic serine proteases (Trypsin; elastase; PCR amplification; degenerated primer design; expression pattern; sequence homology; recombinant DNA)

Jie Kang, Ulrich Wiegand and Benno MUller-Hill Institut j~r Genetik der Universitiit zu K#ln. D-5000 Cologne 41 (F.R.G.) Received by Y. Sakaki: 7 August 1991 Revised/Accepted: 17 September/20 September 1991 Received at publishers: 5 November 1991

SUMMARY

Serine proteases (SPs) are a family of physiologically important and versatile enzymes. We designed degenerated oligodeoxyribonucleotide primers derived from the consensus amino acid aa sequences of the active site of mammalian SPs, to selectively amplify in a polymerase chain reaction (PCR) cDNA fragments coding for SPs. We used poly(A) + RNA from rat pancreas to obtain the eDNA. Two of the amplified cDNA fragments encode novel SPs. The full-length nucleotide sequence of both cDNAs was also obtained by PCR. The high degree of homology to trypsins and e!astases suggests that the cDNAs encode a trypsin-like and an elastase-like SP, respectively. Both mRNAs were also found to occur, to a lesser extent, in spleen, as was the case for the mRNAs of other rat pancreatic SPs.

INTRODUCTION

Serine proteases (SPs) are of widespread occurrence and diverse function. They are involved in many biological processes including proteolytic processing of proteir, s, digestion, blood coagulation, fertilization, immune response, development and repair (Neurath, 1986). They may also be implicated in the pathogenesis of diseases, e.g., Alzheimer's disease (Sinha et al., 1990; Esch et al., 1990). Identification of new SPs would extend our knowledge about these enzymes and processes. Here, we report the isolation of two cDNAs encoding novel rat pancreatic SPs by PCR. A

Correspondence to: Dr. B. Mtlller-Hill, lnstitut fur Genetik der Universitat zu K61n, Weyertal 121, D-5000 Cologne 41 (F.R.G.) Tel. (49-221) 470-2388; Fax (49-221 ) 470-5170. Abbreviations: aa, amino acid(s); AMV, avian myeloblastosis virus; eDNA, DNA complementary to RNA; kb, kilobase(s); nt, nucleotide(s); oligo, oligodeoxyribonucleotide; PAA, polyacrylamide; PCR, polymerase chain reaction; SP, serine protease; ss, single stranded; Taq, Thermus aquaticus.

similar approach has been used for SPs (Sakanari et al., 1989) and cysteine proteases of parasites (Eakin et al., 1990) and for other enzymes (Quivey et al., 1991).

RESULTS AND DISCUSSION

(a) Cloning of cDNAs encoding rat pancreatic SPs with PCR All mammalian SPs are related to each other. The aa flanking the His and Ser residues of the active site, which are indispensable for catalytic reaction, are particularly well conserved. All known enzymes display the aa sequences AAHC and DSGGP (Reich et al., 1975; Fletcher et al., 1987; Lundgren et al., 1984; Meier et al., 1990; Sakanari et al., 1989), except the blood-clotting factor, bovine protein C, which contains the sequence VAHC in the His loop (Long et al., 1984). From these two aa sequences, we deduced nt sequences and synthesized two mixtures of oligo primers (H- and S-primers, respectively, Fig. 1; Table I). To reduce the complexity of the oligo mixtures we took into account the known nt sequences of cloned SPs (Fletcher

182 M bp

i__

s'

DSGGP

AAHC i|

AAA n 3'

H- primer P1

T- primer P2----e,

---I)

C-primer

=

P3

~---P4

Fig. 1.

mRNA

core -fragment

S- primer

517/506396

--

lib

3'-fragment 5'-fragment Fig. 2.

Fig. 1. Strategy for cloning cDNAs coding for SPs with PCR. The sequences of the primers are shown in Table I. The poly(A) ÷ RNAs of rat tissues were purchased from Genofit, Heidelberg. 0.5/~g poly(A) + RNA was transcribed into cDNA by AMV reverse transcriptase (Boehringer-Mannheim)using 1/tg oligo (dT)t2_ts or 10 pmol specific oligo primer (Maniatis et al., 1982). For the tailing reaction (Eschenfeidt et al., 1987), the cDNA was ethanolprecipitated twice. The ss eDNA molecules were tailed with dGTP using terminal transferase (New England Biolabs). The products were phenol-extracted and ethanol-precipitated. The PCR amplifications (Saiki et al., 1988) were performed in 100/~! final volumes containing ss eDNA derived from 10 ng poly(A) + RNA/10 mM Tris. HCI pH 8.3 (25 ° C)/50 mM KCI/1.5 mM MgCl2/0.01% (w/v) gelatine/0.2 mM of each dNTP (dATP, dCTP, dGTP, dTrP)/ 0.5/~M of each primer/2.5 units of Taq polymerase (Amersham). The samples were subjected to 50 cycles of amplification (denaturation at 94"C for I rain, annealing at 37°C for I min and extension at 700C for I rain). Fig. 2. Amplification products of 'core-fragments' of cDNAs coding for SPs from rat pancreas on a 1.5% agarose gel (for technical details see Fig. 1). M, DNA fragment length marker (kb ladder, BRL). The amplified DNA fragments were cloned into pUC 19 and sequenced by the chain-termination method (Sanger et al., 1977) using T7 polymerase (Pharmacia) on denaturated plasmid DNA templates (Chen and Seeburg, 1985).

et al., 1987; Lundgren et al., 1984; Meier et al., 1990). The ss eDNA was copied from poly(A) ÷ RNA of rat pancreas by elongation of annealed S-primer and amplified with primers H and S. The products were loaded onto an agarose gel and a band, corresponding to the size expected from the known SPs, was detected (Fig. 2). The DNA was eluted, cloned into pUC 19, and 104 clones were sequenced. eDNA segments ('core-fragments') of the following proteins were identified: trypsins I and II, cationic trypsin, chymotrypsin B, elastase II and two novel SPs. To obtain the complete nt sequences of the new SPs, we performed PCRs with specific primers (P1-P4), derived from the nt sequence of the cloned 'core-fragments' as follows. For the sequence of the 3' region, ss eDNA was synthesized by elongation of the T-primer and amplified with primers P 1 and T, followed by a further amplification with the nested primer P2 and primer T. For the sequence of the 5' region, the specific ss eDNA was synthesized by elongation of the P3 primer, tailed with dGTP, and amplified with primers C and P3. Amplification was then continued using primer C and the nested primer P4. Thus, the amplified '3' and 5' fragments' contained parts of the 'corefragment' as well as the missing 3' and 5' regions, respectively. They were purified, cloned into pUC19 and

sequenced. Fig. 1 depicts the strategy for eDNA cloning with PCR. The sequences of all oligo primers used are collected in Table I. (b) Characterization of the two new SPs Both the nt sequences and deduced aa sequences of the two full-length cDNAs are shown in Fig. 3, A and B. Neither sequence was found in the EMBL or GenBank database; however, they are homologous to rat pancreatic trypsins and elastases, respectively (Table II). Since there exist already trypsins I-IV (MacDonald etal., 1982; Fletcher et al., 1987; LOtcke et al., 1989) and elastases IIII (Swift et al., 1984; protease E, also called elastase III,Shirasu et al., 1988) the new proteases will be referred to as trypsin V and elastase IV. Trypsin V (Fig. 3A) consists of 246 aa. The deduced aa sequence contains all of the major features common to the trypsin-like SP subfamily (Fletcher et al., 1987; Lundgren et al., 1984; Meier et al., 1990; MacDonald et al., 1982a). It has a hydrophobic signal peptide of 15 aa followed by a polyanionic aa cluster Lmmediately preceding the activation cleavage site (Arge4/IleeS). In addition to the twelve Cys residues which form the six conserved disulfide bonds (Fletcher et al., 1987; Thomas et al., 1981), trypsin V con-

183

A a-~m +1 c~cattgcctggtacagacccaaggagcaaccatgaagatttgcattttcttta~ctcctaggaactgt~ctgctttccccactgaggataacgatgacagaatt~ttgggggctac H K ] C [ F F T L L G T V A A F P T E D N D D R I V G G y 1 10 20 29

I

I

87

act~tcaggagcattctgtcccctaccaggtgtcactgaatgctggatctcacata~tgggggctctct~tcactgaccaa~gg~ctgtctgc~ct~ttgctatcatccccaa T C Q E H S V P Y Q V S L N A G S H I C G G S L % T D Q H V L S A A H C y H p Q 3O 4O 5O 6O ~ 69

207

ctacagg~cgtct~gagaacataacatttatgaaattgagggtgc~agcaattcat~a~cagcca~a~attctt~tcctgacta~ataag~gactgt~ataa~acatc L Q v R L G E H N ] Y E I E G A E Q F I 0 A A K H I L H P D Y D K ff T V D N D ! 70 80 90 100 ~109

.~7

atgc~at~agttgaagtcaccagccaccct~actctaaagtatctac~tccctc~c~cagtactgtc~acagc~gtactgagtgcc~gtgtctggc~g~tgttc~aaa4a7 H L I 110

K L K S P A T L N S K V S T I 120

P L P Q Y C P T A G T E C.L 130 140

V S G W G V L K 149

tttg•ctttgagagtccttctgttcttcagtgtct••atgctcca•tcct•tctGattctgtttgtcacaa•gcctacccacgtcagatcactaacaacatgttct•tctcggcttcctg F G F E S P S V L Q C L D A P V L S D S V C H K A Y P R Q I T N N M F C L G F L 150 160 170 180 1~

567

•aag•t••aaag•actctt•cca•tatgactctg•t••ccctgt••tttgcaatg•a•aagtcca•g•tattgtttcct•g••tgat•gctgtgctttggaag•gaagcct•gtgtctac E G G K 0 S C Q Y D S G G P V V C N G E V Q G I V S H G D G C A L E G K p G V y 190 • ~ 210 220 229

~7

accaaggtctgcaactacctgaactggattcatcagaccattgct•aaaactaa•tgcctttatctcataaggagtcactctgtgat•acctttttctat•tct•aaatct•tatg•aaa T K V C N Y L N H l H Q T I A E N * 230 240 246

~7

I

I

r"

taa~aatatttttctttgctctaaaaaaaaaaaa 840

b-fore cagcagaccgtcgctgccaactaaaacgcctttatgtctttatacttt•atgtcaaatccaccttctttgtatgccccaagtcattctcacaagaaaaaccttttgttttatcacaaaaa Q Q T V A A N * 240

aaaaaaaaaa

837

847

B

+! cgattcctcaacacct~aaccatgtt~gaattac~tcctcgctgccatcctggcctgcgcctcttgctgc~ggaaccccgccttcccacctaacctgtcaac~a~tggtaggagga 99 H L G ] T V L A A I L A C A S C C G N P A F P P N L S T R V V G G ! 10 20 30

I

gaggatgctgtccccaacagctgggcttggcaggtctctctccagtacctcaaggacgacacatggaggcacacctgtgg•g•aa•tctcatcaccaccagccacgtcctcactgccgcc E D A V P N S H A W q V S L Q Y L K D D T H R H T C G G S L ] T T S H V L T AA 34 40 50 60 70

219

---4

cactgcatcaacaaagacttcacttaccgtgtgggcct~gggaagtataatctgac~tggaggatgcggaggctccg~tacact~agg~gacaccatcta~tccatgagaag~ga 339 H C I N K D F T Y R V G L G K Y N L T V E DA E A P C T L R H T P S T S HR S G 75 80 90 100 110 acc•actcttcct•tggaaccgacatcgctatcattaagttggctgagcctgt••aactgagcaacaccatccag•tggcct•catcccagaggaa•gttccct•ctgcctcaggactat T D S S C G T D ] A ] I K L A E P V E L S N T I Q V A C I P E E G S L L P Q D Y 114 120~ 130 140 150

459

ccc~ctatgtc~gggctggggtcgcctctggaccaat~tcccatcgc~aa~tgctccagcagggcctgcagcc~tc~t~agccatgccac~ctc~ggt~gact~gtggttc P C Y V T G H G R L H T N G P l A E V L Q Q G L Q P I v S H A T C S R L D H H F 154 160 170 180 19~

579

I

I

atcaag~tccggaagacgatggtgt~cgctgggggtgatg~cgtcatctct~cctgtaac~gagattctggc~cccact~aactgccaagca~aa~a~gct~t~g~ggt~cac~c 699 I K V R K T H V C A G G D G V I S A C N G D S G G P L N C Q A E D G S H Q v H G 194 200 210 • 220 230 at~tgagcttcggttccagta~c~gctgcaacgtacacaagaaacc~gtagtcttcacccgagtgtctgcctacaat~ac~tcaacgagaaaatacaac~tgaagaggccgttcc 819 I V S F G S S S G C H V H K K P V V F T R V S A Y N D H I N E K I Q L * 234 240 250 260 2~ agaagtctcgctgcccgtctcccaagcagcaataaagcttgttccatgat~aaaaaaaaaaaaaaa

~6

Fig. 3. Nucleotide sequences of the cDNAs of trypsin V (forms a and b, panel A) and of elastase IV (panel B) and deduced aa sequences. The nt residues are numbered beginning with the first nt of the start AT(; codon. The bases hybridizing with the primers H and S are overlined. The polyadenylation signals in the 3'-noncoding region are underlined. The three aa residues of the catalytic triad are marked with ' # ' . The residue Asp 194 of trypsin V, which is responsible for the substrate specifity, is denoted by a blackened square. The arrows in panel A indicate the nt from which on the b-form differs from the a-form. Stop codons are marked by asterisks. The nt sequences have been submitted to the EMBL database under accession Nos. X59012 for trypsin V a-form; X59013 for trypsin V b-form; X59014 for elastase IV.

184 TABLE I Sequences of the oligo primers~ for cDNA cloning with PCR Hindlll

H-primer:

S-primer:

5'-ACAGGATAAAAGCTTCAGCAGCCCACTG T T T T EcoRl 5'-GACGAATTCACGGGCCACCAGAATC T C G G

G T T-primer: C-primer:

Hindlll 5'-GCCAAGCTTTTT'ITrTTTTTTT 5'-GCCAAGCTTCCCCCCCCCC

Pl: For trypsin V, nt 402(5')-422: For elastase IV, nt 434(5')-453:

5' -GACAGCTGGTACTGAGTGCCT 5'-AAGGTTCCCTGCTGCCTCAG

P2: For trypsin V, nt 509(5')-524: For elastase IV, nt 561(5')-581:

EcoRl 5' -ACAGAATTCTGTTTGTCACAAGGCC 5'-ACAGAATTCCAGGTTGGACTGGTGGTTCAT

P3: For trypsin V, nt 301-317(5'): For elastase IV, nt 303-317(5'):

5'-CAACAGTCCACTTATC 5'-GGTGTCCACCTCAGT

P4: For trypsin V, nt 238-255(5'): For elastase IV, nt 275-296(5'):

5'-ACAGAATTCAGCACCCTCAATTTCATA 5' -ACAGAATTCGGAGCCTCCGCATCCTCCACTG

EcoRl

The oligo primers were synthesized on a Model 380A DNA synthesizer (Applied Biosystcms).

tains a Cys4 in the predicted signal peptide. The invariable catalytic residues His 64, Asp ~°s and Set 2°° that form the active sites of the SPs (Neurath, 1984) are all present in the correct positions. The sequences flanking these residues are also identical to the conserved consensus sequences except for a Tyr replacing Gly 19s. A Tyr 19s has not been found in other SPs so far. The Asp w4 may participate in electrostatic interactions with Lys and Arg side chains and is also characteristic for trypsin-like SPs. Two mRNA variants of trypsin V were identified (Fig. 3A). The a-form is about sixfold more abundant than the b-form. They differ from each other in seven C-terminal codons and in the 3'-untranslated regions. The identity of the two sequences up to nt 719 suggests that the two variants could possibly have arisen from a single gene by alternative splicing. We cannot exclude that the variants are artificial products (so-called 'shuffle clones') which are generated due to PCR (Saiki et al., 1988; Erlich et al., 1991). The predicted polypeptides of both forms are more homologous to rat cationic trypsin than to trypsins I and II (Table II), but their overall net charges of -10 (a-form) and - 9 (b-form) are anionic as is the case for trypsins I and II. Elastase IV (Fig. 3B) consists of 268 aa. Homologous to elastases I and II (Swift et al., 1984; MacDonald et al.,

1982b), the signal peptide presumably comprises 16 Nterminal aa (MacDonald et al., 1982a). The following residues (Cys ~7 to Arg z9) represent the activation peptide (Swift et al., 1984; MacDonald et al., 1982b) which acts as a functional unit during enzyme activation (Freer et al., 1970; Bode, 1979). Apart from the eight Cys residues which form four conserved disulfide bridges, the predicted mature elastase IV has four Cys residues more than elastase I and two more than elastase II (Swift et al., 1984). His 74, Asp TM, and Ser 2~6 constitute the obligatory catalytic triad. (c) mRNA expression of trypsin V and elastase IV in various rat tissues In 104 eDNA clones analysed, the various proteases are represented with the following frequencies: trypsin I, 57; trypsin II, 3; cationic trypsin, 5; elastase I, 2; elastase II, 8; chymotrypsin B, 6; trypsin V, 6 and elastase IV, 6. Considering that 2% of pancreatic mRNA represent trypsin I RNA (MacDonald et al., 1982a), the mRNAs of trypsin V and elastase IV are expressed at a relatively high level equal to all members of the trypsin and elastase families except for trypsin I which is expressed in higher amounts. To analyse transcription of trypsin V and elastase IV, ss eDNA mixtures were synthesized from poly(A) + RNA of

185 TABLE II Comparison of the aa sequences of various serine proteases from rat and human (identity in %) Proteina Trypsin V, a-form (rat)

TrypVa (rat)

Trypl (rat)

Trypll (rat)

Cat.tryp (III, rat)

TryplV (rat)

Trypl (human)

Trypll (human)

100.0

Trypsin I (rat)

66. l

100.0

Trypsin II (rat)

66.5

89.8

100.0

Cationic trypsin (II1, rat)

7 I. l

74.8

77.2

100.0

Trypsin IV (rat)

71.0

67.5

68.7

77.2

100.0

Trypsin i (human)

63.8

76.4

78.5

76.4

66.3

100.0

Trypsin II (human)

64.6

76.4

78.0

75.2

66.7

89.0

lO0.O

Trypsin Ill (human)

63.8

74.4

75.6

74.4

67.0

85.0

86.6

Ela IV (rat)

Ela I (rat)

Ela I1 (rat)

Protein a

Elastase IV (rat)

Tryplll (human)

Ela III (human)

lO0.O

Leuk. Ela (human)

100.0

Elastase I (rat)

56.0

100.0

Elastase II (rat)

46.0

56.0

100.0

Elastase 1II (protease E, human)

51.0

54.2

56.9

100.0

Leukocyte elastase (human)

36.0

39.9

36.4

58.0

100.0

~' Tryp, trypsin; Cat. tryp., cationic trypsin; Eia, elastase; Leuk. ela, leukocyte elastase. The sequences are published in the following references: Trypsin l and II (rat), Craik et al. (1984), MacDonald et al. (1982a); Cationic trypsin (rat), Fletcher et al. (1987); Trypsin IV (rat), L0tcke et ai. (1989); Trypsin V, Fig. 3A; Trypsin I and II (human), Emi et .,d. (1986); Trypsin III (human), Tani et al. (1990); Elastase I and II (rat), Swift et al. (1984); Elastase Ill (protease E, human), Shirasu et al. (1988); Leukocyte elastase (human), Okano et al. (1990).

various rat tissues by elongation of oligo(dT)12_~s and subjected to P C R analysis using primers H and S as described in Fig. 1. The relative amounts of c D N A from different tissues were quantified by amplification with rat cytoplas-

mic ~-actin specific primers (Nudel et al., 1983; data not shown). The 32p-labeled internal primers [for trypsin V: Fig. 3A, nt 391-408(5'); for elastase IV: Fig. 3B, nt 391(5')-409] fixed the size of the fragments to be ampli-

186 W 10

.o=

3.

nt

ACKNOWLEDGEMENTS

@

o..°°

®

.t

We thank H. Gu and S. Oehler for discussions, J. Kun for excellent technical assistance, and B. Kisters-Woike for help with the computers. This work was supported by the Fritz Thyssen Stiftung and the Boehdnger Ingelheim Fends (to J.K.).

m 396

--

m

344

--

298

--

m m

220

--

201

--

154

--

134

--

REFERENCES

m W

"

a i

i

i

®

396

--

344

--

298

--

220

--

201

--

154

--

134

--

wn,.,

O

II

I

I

Fig. 4. Analysis of mRNA expression in various rat tissues (Kang and MQller-Hill, 1990). (Panel a)Expression of trypsin V mRNA. (Panel b) Expression ofelastase IV mRNA. The arrowheads indicate the bands with the expected size. M, DNA fragment-lengthmarker. PCR was performed in 30-/~1volume using primers H and S (Table I). After addition of I pmoi 3'P-labeled internal primer, the samples were further amplified for five cycles. Of the reaction mixture 10 lel was resolved on a denaturating 6% PAA gel containing 8 M urea.

fled. To avoid amplification of fragments of other known homologous proteases, the primers were constructed in such a way that they mismatched with all nt sequences of known proteases at the 3' end. Fig. 4 shows that both mRNAs axe expressed mainly in pancreas and, to a lesser extent, in spleen. It remains to be seen how efficiently these mRNAs axe translated.

Bell, G.I., Quinto, C., Quiroga, M., Valenzuela, P., Craik, C.S. and Rutter, W.J.: Isolation and sequence of a rat chymotrypsin B gene. J. Biol. Chem. 259 (1984) 14265-14270. Bode, W.: The transition of bovine trypsinogen to a trypsin-likestate upon strong ligand binding, II. The binding of the pancreatic trypsin inhibitor and of isoleucine-valineand of sequentially related peptides to trypsinogen and to p-guenidino-benzoate.trypsinogen. J. Mol. Biol. 127 (1979) 357-374. Chen, EJ. and Secbarg, P H.: Supercoii sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4 (1985) 165-170. Craik, C.S., Choo, Q.L., Swift, G.H,, Quinto, C., MacDonald, RJ. and Rutter, W.J.: Structure of two related rat pancreatic trypsin genes. J. Biol. Chem. 259 (1984) 14255-14264. Eakin, A., Bouvier, J., Sakanari, J.A., Craik, C.S. and McKerrow, J.H.: Amplification and sequencing of genomic DNA fragments encoding cysteine proteases from protozoan parasites. Mol. Biochem. Parasitel. 39 (1990) 1-8. Emi, M., Nakamura, Y., Ogawa, M., Yamamoto, T., Nishide, T., Mori, T. and Matsubara, K.: Cloning, characterization and nucleotide sequences of two cDNAs encoding human pancreatic trypsinogens. Gene 41 (1986) 305-310. Erlich, H.A., Gelfand, D. and Sninsky, JJ.: Recent advances in the polymerase chain reaction. Science 252 (1991) 1643-1651. Esch, F.S., Keim, P.S., Beattie, E.C., Blacher, R.W., Culwell, A.R., OItersdorf, T., McClure,D. and Ward, P.L.: Cleavageof amyloid beta peptide during constitutive processing of its precursor. Science 248 (1990) 1122-1124, Eschenfeldt, W.H., Puskas, R.S. and Berger, S.L.: Honlopolymeric tailing. Methods Enzymol. 152 (1987) 33?-342. Fletcher, T.S., Alhadeff,M., Craik, C.S. and Largman, C.: Isolation and characterization of a cDNA encoding rat cationic trypsinogen. Biochemistry 26 (1987) 3081-3086. Freer, S.T., Kraut, J., Robertus, J.D., Wright, H.T. and Xuong, Ng.H.: Chymotrypsinogen:2.5-Angstrom crystal structure, comparison with alpha-chymotrypsin, and implications for zymogen activation. Biochemistry 9 (1970) 1997-2009. Kang, J. and Mailer-Hill, B.: Differential splicing of Alzheimer's disease amyloid A4 precursor RNA in rat tissues: preA4(695)mRNA is predominantly produced in rat and human brain. Biocbem.Biophys. Res. Commun. 166 0990) 1192-1200. Long, G.L., Belagaje, R.M. and MacGillivray, R,T.A.: Cloning and sequencing of liver cDNA coding for bovine protein C. Prec. Natl. Acad. Sci. USA 81 (1984) 5653-5656. L~ltcke, H., Rausch, U., Vasiloudes, P., Scheele, A. and Kern, H.F.: A fourth trypsinogen(P23) in the rat pancreas induced by CCK, Nucleic Acids Res. 17 (1989) 6736. Lundgren, S., Ronne, H., Rask, L. and Peterson, P.A.: Sequence of an epidermal growth factor-binding protein. J. Biol. Chem. 259 (1984) ?780-7784. MacDonald, R.J., Stary, S.J. and Swift, G.H.: Two similarbut non-allelic

187 rat pancreatic trypsinogens. Nucleotide sequences of the cloned cDNAs. J. Biol. Chem. 257 (1982a) 9724-9732. MacDonald, R.J., Swift, G.H., Quinto, C., Swain, W., Pictet, R.L., Nikovits, W. and Rutter, W.J.: Primary structure of two distinct rat pancreatic preproelastases determined by sequence analysis of the complete cloned mRNA sequences. Biochemistry 21 (1982b) 14531463. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Meier, M., Kwong, P.C., Fregeau, C.J., Atkinson, E.A., Burlington, M., Ehrman, N., Sorensen, D., Lin, C.C., Wilkins, J. and Bleackley, R.C.: Cloning of a gene that encodes a new member of the human cytotoxic cell protease family. Biochemistry 29 (1990) 4042-4049. Neurath, H.: Evolution of proteolytic enzymes. Science 224 (1984) 350357. Neurath, H.: The versatility of proteolytic enzymes. J. Cell. Biochem. 32 (1986) 35-49. Nudel, U., Zakut, R., Shani, M., Neuman, S., Levy, Z. and Yaffe, D.: The nucleotide sequence ofthe rat cytoplasmic p-actin gene. Nucleic Acids Res. 11 (1983) 1759-1771. Okano, K., Aoki, Y., Shimizu, H. and Naruto, M.: Functional expression of human leukocyte elastase (HLE)/medullasin in eukaryotic cells. Biochem. Biophys. Res. Commun. 167 (1990) 1326-1332. Quivey, R.G., Faustoferri, R.C., Wesley, A.B. and FIores, J.S.: Polymerase chain reaction amplification, cloning, sequence determination and homologies of streptococcal ATPase-encoding DNAs. Gene 97 (1991) 63-68. Reich, E., Rifkin, D.B. and Shaw, E.: Proteases and Biological Control. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1975.

Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A.: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239 (1988) 487-491. Sakanari, J.A., Staunton, C.E., Eakin, A.E., Cralk, C.S. and McKerrow, J.H.: Serine proteases from nematode and protozoan parasites: isolation of sequence homologs u:~ag generic molecular probes. Proc. Natl. Acad. Sci. USA 86 (1989) 4863-4867. Sanger, R., Nicklen S. and Coulson, A.T.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 54635467. Shirasu, Y., Takemura, K., Y0shida, H., Sato, Y., lijima, H., Shimada, Y., Mikayama, T., Ozawa, T., lkeda, N., lshida, A., Tamai, Y., Matsuki, S., Tanaka, J., lkenaga, H. and Ogawa, M.: Molecular cloning of complementary DNA encoding one of the human pancreatic protease E isozymes. J. Biochem. 104 (1988) 259-264. Sinha, S., Dove),, H.F., Seubert, P., Ward, P.J., Blacher, R.W., Blaber, M., Bradshaw, R.A., Arici, M., Mobley, W.C. and Lieberburg, !.: The protease inhibitory properties of the Alzheimer's beta-amyloid precursor protein. J. Biol. Chem. 265 (1990) 8983-8985. Swih, G.H., Craik, C.S., Stary, SJ., Quinto, C., Lahaie, R.G., Rutter, W.J. and MacDonald, R.J.: Structure of the two related elastase genes expressed in the rat pancreas. J. Biol. Chem. 259 (1984) 1427114278. Tani, T., Kawashima, I., Mita, K. and Takiguchi, Y.: Nucleotide sequence of the human pancreatic trypsinogen III eDNA. Nucleic Acids Res. 18 (1990) 1631. Thomas, K.A., Baglan, N.C. and Bradshaw, R.A.: The amino acid sequence of the gamma-subunit of mouse submaxillary gland 7 S nerve growth factor. J. Biol. Chem. 256 (1981) 9156-9166.