The EMBO Journal vol.9 no.13 pp.4503-4509, 1990

Identification of essential elements in U 14 RNA Saccharomyces cerevisiae

Artur Jarmolowski1, John Zagorski2, Haodong V.1i and Maurille J.Fournier Department of Biochemistry and Program in Molecular and Cellular Biology, Lederle Graduate Research Center, University of Massachusetts, Amherst, MA 01003, USA

'Permanent address: A. Mickiewicz University, Department of Biopolymer Biochemistry, 10 Fredry St., 61-701 Poznan, Poland 2Present address: Monsanto Co., Department of Health Sciences, 800 N. Lindbergh Blvd, St Louis, MO 63167, USA Communicated by I.W.Mattaj

The U14 RNA of Saccharomyces cerevisiae is a small nucleolar RNA (snoRNA) required for normal production of 18S rRNA. Depletion of U14 results in impaired processing of pre-rRNA, deficiency in 18S-containing intermediates and marked under-accumulation of mature 18S RNA. The present report describes results of functional mapping of U14, by a variety of mutagenic approaches. Special attention was directed at assessing the inportance of sequence elements conserved between yeast and mouse U14 as well as other snoRNA species. Functionality was assessed in a test strain containing a galactose dependent U14 gene. The results show portions of three U14 conserved regions to be required for U14 accumulation or function. These regions include bases in: (i) the 5'-proximal box C region, (ii) the 3'-distal box D region, and (iii) a 13 base domain complementary to 18S rRNA. Point and multi-base substitution mutations in the snoRNA conserved box C and box D regions prevent U14 accumulation. Mutations in the essential 18S related domain do not effect U14 levels, but do disrupt synthesis of 18S RNA, indicating that this region is required for function. Taken together, the results suggest that the box C and box D regions influence U14 expression or stability and that U14 function might involve direct interaction with 18S RNA. Key words: mutants/snoRNA/snRNA/U14/yeast

Introduction A growing number of non-spliceosomal snRNAs have been implicated in ribosome biogenesis, in a variety of organisms. Key observations supporting such a role include: (i) residency in the nucleolus-the site of rRNA synthesis and pre-ribosome assembly (Weinberg and Penman, 1968; Prestayko et al., 1970; Busch et al., 1982; Lischwe et al., 1985; Reddy et al., 1985; Tollervey, 1987; Zagorski et al., 1988; Tyc and Steitz, 1989), (ii) association with rRNA precursors (Prestayko et al., 1970; Zieve and Penman, 1976; Calvet and Pederson, 1981; Epstein et al., 1984; Tollervey, 1987; Zagorski et al., 1988), (iii) striking complementarity with rRNA sequences (Bachellerie et al., 1983; Crouch et al., 1983; Tague and Gerbi, 1984; Parker and Steitz, Oxford University Press

of

1987; Trihn-Rohlik and Maxwell, 1988), (iv) cross-linking to precursor rRNA (Maser and Calvet, 1989; Stroke and Weiner, 1989), and (v) disruption of pre-rRNA processing with loss of specific snRNA species (Tollervey, 1987; Kass et al., 1990; Li et al., 1990; Savino and Gerbi, 1990). Organisms from which the qualifying snRNAs have been characterized include: humans, rat, mouse, Xenopus laevis, Bombyx mori, Dictyostelium discoideum, broad bean and the yeasts, Schizosaccharomyces pombe and Saccharomyces cerevisiae. The most definitive evidence to date is for the mammalian U3 species where in vitro depletion has been shown to impair the first step in pre-rRNA processing (Kass et al., 1990). To date, nine S.cerevisiae snRNA species have been associated with ribosome synthesis, based on nucleolar residency and co-sedimentation with deproteinized 20S, 27S or 35S pre-rRNAs (Tollervey, 1987; Zagorski et al., 1988). Interestingly, only two of the nine snoRNAs are essential for growth, U3 and U14 (Hughes et al., 1987; Zagorski et al., 1988). U14, the subject of the present paper, and a second, non-essential snoRNA, snR10, have been experimentally linked with processing of rRNA. Disruption of the dispensable snRlO gene yielded a cold sensitive phenotype with impaired processing of the 35S primary rRNA transcript (Tollervey and Guthrie, 1985; Tollervey, 1987). 35S processing is also defective in cells repressed for U14 transcription and these cells are severely impaired in the ability to accumulate 18S RNA (Li et al., 1990). The U14 RNA of S.cerevisiae is also known as snR128, based on its content of 128 nucleotides (Zagorski et al., 1988; new data suggest a mix of 125-128 bases owing to 5' heterogeneity, A.Jarmolowski et al., unpublished). Structural homologues of the snR128 species have been identified in mouse, rat, human and X. laevis cells, giving rise to the common U14 designation (Maxwell and Martin, 1986; Trinh-Rohlik and Maxwell, 1988; E.S.Maxwell, personal

communication). In the present paper we describe results from a mutagenic analysis of the yeast U14 species. Our aim was to identify regions critical for snRl28 function, with special interest in assessing elements conserved among the U14 RNAs. One conserved region and portions of two others were shown to be vital. The essential segments include the box C and box D regions conserved among many nucleolar snRNAs and a 13 base segment complementary to 18S rRNA.

Results Conserved elements in yeast and mouse U14 RNAs The sequences of the yeast and mouse U 14 RNAs are shown in Figure 1. The mouse species, also known as 4.5S hybRNA, was given the 'hyb' designation because of its ability to hybridize with 18S rRNA and mRNA (Maxwell and Martin, 1986; Trinh-Rohlik and Maxwell, 1988). The yeast RNA is longer by 41 nucleotides with most of the

4503

A.Jarmolowski et al. 1

I-

2

10

YEAST

MOUSE

Il A

-I 20

30

I

40

50

60

70

GAUCACGGUGAUGAAAGACUGGUUCCUUAA.CAUUCGCAGUUtUCCACGGUA6GA6UACGCUUACGAACCCU ..UCGCUGUGAUGAUGGA .... UUCCAAAACCAUUCGUAGUUUCCAC ...................... CA

II 11 MI 11 11 GATCTGA6CCTTTATTTTTTCTCATGAGATTATCAAATGTGGGTAATTTGAGGAGACAGATAATATATAT rI -70 -60 -50 -40 -30 -20 -10

11

box C

1

B 80

YEAST MOUSE

90

100

110

_

_

_

_

2

_

120

UCGUUAGUACUCUCGGUGACCGCUCUUCUUUAGAGA.CCUUCCUAGGAUGUCUGAGUGA. zn ..GAA.GUGCUGU.GUUGGCU ............ AGUUCCUUCCUUGGAUGUCUGAGCGAA s

MI II 111111

Fig. 1. Relatedness of yeast and mouse U 14 RNA sequences. Segments 1-3 correspond to major regions of homology. Elements A and B identify the largest U14 segments complementary to the cognate 185 rRNAs (13 and 14 bases respectively). Box C and box D are sequences conserved among nucleolar small RNAs (summarized by Tyc and Steitz, 1989). The yeast sequence was deduced from the DNA sequence and SI nuclease mapping. The mouse structure is from direct sequencing of 4.5S hybRNA (Maxwell and Martin, 1986).

difference accommodated by three spacer or expansion-like elements. These elements consist of four, 12 and 22 bases and account for 38 of the 41 additional nucleotides. When the spacer sequences are ignored the two RNAs show 77 % sequence identity. Three regions of striking sequence relatedness are highlighted (1-3) corresponding to nucleotide matches of 7/7, 21/25 and 20/22. Region 1 contains the UGAUGA sequence of the box C element conserved among several nucleolar snRNAs analyzed thus far (initially defined as a nine base element in U3 species; Wise and Weiner, 1980; Hughes et al., 1987; Parker and Steitz, 1987; Jeppesen et al., 1988; and summarized by Tyc and Steitz, 1989). Regions 2 and 3 include different 13 and 14 base segments complementary to 18S rRNA (labeled A and B respectively). While several regions of rRNA complementarity occur, the A and B segments are the largest and have the added promise of existing within the two longest regions of U14 homology. Finally, the distal portion of region 3 also contains the box D consensus sequence of nucleolar snRNAs, PuUGUGA (Tyc and Steitz, 1989). The box C and box D sequences have been postulated to be possible binding sites for the nucleolar protein fibrillarin (Parker and Steitz, 1987; Tyc and Steitz, 1989). Both RNAs can be folded into Y-shaped structures, however, the degree of similarity is not strong for the two lowest free energy forms. Mutagenesis strategy Four approaches were taken to developing a preliminary functional map of the yeast U14 RNA. These included: (i) random chemical mutagenesis of the entire U 14 gene region; (ii) oligonucleotide substitutions in the conserved sequences; (iii) base deletions at existing and newly created restriction sites; and (iv) directed mutations within one region implicated in function (domain A). Mutagenesis was carried out on plasmid-encoded U14 DNA and biological activity assessed by transformation into a haploid test strain containing a wild-type chromosomal SNRJ28 gene under control of the galactose-inducible, glucose-repressible GAL] promoter. Since snRl28 is essential, cells containing the GALI::SNRJ28 fusion allele display a galactose dependent (Gald) phenotype. Plasmids defective in SNRJ28 function were identified by screening growth

1

AATTTAT6l\TCACGGTGATUGMAACTGGTTCCTTAACATTCGCAGTTTCCACGGTA6GAGTACGCTTAC

box D

4504

~~~~I

#

III

+1

20

10

30

40

50

60

I~~~~~~ 1 liii0II 90I1 11 11

II

1

*

*

*

*

*

70

80

90

100

110

121110 I11

11111 *

120

*

130

Fig. 2. Distribution of nitrous acid mutations. Mutagenized U14 DNA was tested for function by transformation of Gald test strain YS153 and screening growth on solid glucose medium at 230C and 37°C. Plasmids with defective U14 DNA were recovered, amplified in E.coli and subjected to sequence analysis. The patterns shown are for 49 growth-impaired mutants containing from one to seven base changes; most variants encode three to four mutations. (|), sites of mutation; ( # ), point mutants.

phenotype on glucose medium, at 37°C, 32°C and room temperature (23-25°C). Mutations were defined by sequencing and verified by a second transformation of the test strain. Nitrous acid mutagenesis Our aim in this approach was to develop a rough map of domains indispensable for U14 function. In addition to the coding region the target DNA also included 77 bp of upstream sequence and four bp of 3'-flanking DNA. Mutagenic conditions were selected that would yield a high proportion of multiply hit target DNA, to enhance the probability of identifying domains that might be insensitive to single point mutations. Some 49 mutants were eventually isolated, from 3000 transformants examined. The distribution of mutated sites is shown in Figure 2. The mutated DNAs were found to contain from one to seven base changes, with most encoding three or four. Only four variants were point mutants and one of these occurred upstream of the coding sequence (G -26 - A). Within the coding sequence the mutations were clustered in four major groupings. These occurred: (i) in region 1 (box C); (ii) around nucleotide 50; (iii) at nucleotides 75-78, and (iv) in the 3 '-half of region 3, including elements of box D. The three point mutants occurred at position 11 in box C, base 51 in the large spacer region, and base 127 at the end of region 3. The presence of these mutations within three of the four multi-hit clusters supports the view that these groupings have functional significance, as opposed to simply being 'hot spots' for chemical mutagenesis. While the mutagenesis conditions introduced much noise into the analysis, it is quite striking that two of the major peaks of chemical alteration occur within box C and box D; the relevance of these regions was verified by directed mutations. On the other hand, it is curious that few hits were obtained within domain A of region 2 which was subse-

Functional mappping of yeast U14 RNA

A

Growth

U 14 Contenta

Mutation

240

320

370

240

320

370

All = G A50 = G G 127 = A

-

slow wt slow

wt

-

+

+

wt wt

wt +

wt +

++ +

I

awt

=

-

wild-type; + +

=

30-50% wt; +

=

20

2

5

f,

4,

1 14

B I

x

4

IV

30

40

V

trace amount

4

III

60

50

B

70

_ I

VI

VII

TCGTTAGTACTCTCGGTGACCGCTCTTCTTTAGAGACCTTCCTAGGATGTCTGAGTGA 12O 80

A

II

GATCACGGTGATGAAAGACTGGTTCCTTAACATTCGCAGTTTCCACGGTA6GTACGTTACGCCCA 10

slow

2

1

Table I. Properties of U14 point mutants

90

100

000

120

Fig. 4. Domain analysis of U14 RNA. The functional importance of the U14 conserved regions 1 -3 was tested by oligonucleotide substitution analysis. Seven multi-base substitutions (I -VII) were created to disrupt primary structure and potential RNA -RNA interactions. Substitutions were as follows: A -> C; C -> A; G -> T; and T -> G. Functionality was assessed in glucose medium at 32°C. The activities of the mutant RNAs are indicated as (+), functional and (-), non-functional. Additional properties are summarized in Table II.

6

Table II. Properties of domain substitution mutants t 14

a

m

Domain

(2 r>

1 14

f,

m

Fig. 3. Patterns of U14 RNA from cold sensitive point mutants. The level of U14 was determined by Northern hybridization analysis, for three transformants harboring U14 cs point mutants. RNA was isolated from cells 24 h after shifting from SG (galactose) to SD (glucose) media. The three panels correspond to the growth temperatures, 24°C (A), 32°C (B) and 37°C (C). By lane, the test DNAs were: (1) wildtype U14 in pJZ45; (2) parental plasmid lacking U14 DNA; (3) mutant Al l-G; (4) mutant A50-G; (5) mutant G127-A, and (6) mutant I from the multi-base substitution analysis of Figure 4 and Table II; mutant I is lethal. The upper band observed in some cases is U 14 RNA derived from the chromosomal GALJ::U14 allele, with five additional bases (Li et al., 1990).

quently shown to contain essential residues (see below). Properties of the point mutants are listed in Table I, including growth phenotype and U14 content. The hybridization patterns from the snRNA determinations are shown in Figure 3. All three mutations confer a cold sensitive phenotype, to different extents. The All -G mutation occurs in the heart of the box C-like sequence, at the third residue of the conserved UGAUGA sequence. Cells with this mutation have a strong cs phenotype and contain only trace amounts of U14. Cells with the A50 - G mutants are moderately cs and have wild-type levels of U14 at 240C and 32°C, suggesting minimal effect on synthesis or degradation. snRNA is less abundant at 370C where it is one-third to one-half of the control. The third mutant, G127 - A, mediates a strong cs with low levels of U14. The low content of mutant RNA in both the A 1I and G127 transformants argues that these mutations impair U14 production or stability. Levels of 18S rRNA correlated with snRNA content

I II III IV V VI VII

Phenotype

U 14 content

18S rRNA content

lethal

(-) wt wt wt wt wt (-)

low normal low low normal normal low

wild-type lethal lethal wild-type wild-type lethal

(results not shown). That is, cells with reduced levels of U14 were deficient in rRNA, as seen previously for a different Gald test strain (Li et al., 1990). Substitution mutants The essentiality of each conserved U14 segment was tested by oligonucleotide substitution analysis. Seven substitution mutants were developed, one for region 1 and three each for regions 2 and 3. The strategy was to maintain size but alter the sequence to abolish potential base pairing. The locations and effects of these alterations are shown in Figure 4 and Table II and the supporting hybridization results are in Figure 5. The box C substitution (oligo I) abolishes U14 function and yields a lethal phenotype, consistent with the strong cs point mutant result developed at the same time. Mutant snRNA is barely detectable and the content of 18S RNA is low, in accord with the snr- phenotype (Table II). The results for region 2 show that the 5' portion of this segment is non-essential (oligo II), but that the 18S complementary sequences of region A are required (oligos III and IV). Cells with the oligo H mutation grow normally and have normal level of U14 and 18S RNA. The region 3 results indicate that the segment V and VI substitutions are without effect, but that the 3'-most segment is essential (oligo VII). Normal amounts of snRNA and rRNA occur in the oligo V and VI mutants, whereas mutant VII is deficient in both U14 and 18S RNA. The non-essential 5' portion of region 3 corresponds to the second large segment of 18S complementarity (domain B). As defined, substitution oligos VI and VII

4505

A.Jarmolowski et al.

and the G127 base shown to be important in the point mutant analysis. Deletion mutations Deletions were made at two natural and three newly created restriction sites. The new sites were generated by single base A changes, present in a statistical mix of synthetic coding 2 ; 4 R f v sequences. None of the individual mutations had an observable effect on growth (results not shown). The effects of several deletions at these sites are summarized in Figure 6. mutations include short deletions at each of four sites The P1IRNO I" made by trimming single strand extensions and religation. Three of the two-to-seven base deletions have no effect on 1l14 growth, including one that removes the last two nucleotides of the U14 conserved region 2 (SacII site). Slow growth was observed for the fourth, corresponding to seven base deletion G86 -G92 (BstEII site). All of the shorter deletion products occurred at wild-type levels. Lethal phenotypes were observed for two larger deletions, corresponding to: (i) a 12 base deletion from A45 to A56 (SacII-MluI), and (ii) a 25 base deletion from U61 to G85 B (MluI-BstEII). The first of these removed the last two I S rJ 3t 4 5 f} nucleotides of region 2 (distal to domain A) and 10 of 22 bases in the spacer segment that distinguishes the yeast and mouse snRNAs. As noted above the two domain A nucleotides were dispensable in the A45 -C46 deletion. This deletion also included the A50 base linked earlier with a cs 25S r-R\.\ phenotype. The lethal 25 base deletion removed the last eight bases of the 22 base spacer and 17 bases of weakly conserved IX.S. r \NA U 14 sequence. The snRNA levels were normal for both deletion variants, indicating that expression or turnover are unaffected. Loss of function for these larger deletions could be ..................due to loss of yet other functional elements or simply reflect = disruption of essential tertiary structure. The finding that RNA accumulates at normal levels for the larger 12 and 25 Fig. 5. Effect of ooligonucleotide substitutions on U14 and 18S RNA base deletions is particularly impressive and suggests that accumulation. Lev els of U14 and 18S rRNA were determined for each these unique size variants may be useful in future studies substitution mutant by hybridization (U14) and densitometric scanning of stained gels (rR]NA). RNAs were prepared 36 h after shifting from of U14 metabolism. wt_ri. frqrtinnqttin I /V t .Qr.torn Pihn-znm,l A1R^4 RNAcW%l 11V14M IIl 3%jto wciawc;it lU LJ ..m-A.i llWlki. 1nlUObuilIIdl formaldehyde/agarose. (A) U14 analysis; snRl90 served as internal Lethal domain A mutants control. (B) rRNA analysis. Sample lanes correspond to transformants The mapping data suggest that domain A may be required with: (1) plasmid-encoded wild-type snRl90 and U14; (2) vector for U14 function. The 5' end of domain A appears to coinlacking U14 DNA; and, (3-9) substitution mutants I-VII.

divide the box D sequence (PuUCUGA), with the first two bases in segment VI and the remainder in segment VII. Thus, altare I%rthb ^>iA L"ne"annt. tin aiters th6n! LA v L mutationU x n nucieiuL Lues Umi Ln'*h6l nt Xm oDJhas% IViedasgmeI

1

2

3

1B

A

m

0

20

40

m----

60

80

100

l

120

Phenotype

Growth

U14 Level

j

wt

wt

:

1

_

wt

(6)

E

]

wt

wt

U61-G85

(25)

[

G86-G92

(7)

F

slow

wt

C112-G115

(4)

[

WI

wt

Deletion

( nts )

A45-C46

(2)

[

A45-A56

(12)

U55-U60

I

Fig. 6. Deletion mapping of U14 RNA. Deletion variants of U14 DNA were generated at natural and artificial restriction sites. The structures of six deletion mutants are shown below a map of conserved U14 elements and the effects on growth and U14 content (32°C) are summarized at the right.

4506

Functional mappping of yeast U14 RNA

cide with the 5' end of the essential portion of region 2. The 3' terminus of the essential region is less clear, however, with only a two base deletion serving as a potential boundary. A more direct test of domain A importance was conducted next by directed mutagenesis. To this end, a population of mutants was developed from a mix of mutagenic primers containing all four bases at each position (C31 -C43). Functional screening yielded lethal, cs and slow growing variants. Fifty seven were sequenced and found to contain from two to 10 base changes, at a variety of different positions in domain A. No point mutations were found, but these were anticipated to occur at a lower statistical frequency. A selection of 12 lethal two and three base mutant sequences are shown in Table 11. Like the larger substitution mutants all of these mutant RNAs accumulated at normal levels (32°C). The results show that a diverse array of mutations give the lethal phenotype. This diversity argues that most, possibly all, of the domain A nucleotides are required for U14 function.

Discussion The mapping data identify three segments of conserved sequence required for U 14 function in S. cerevisiae. These segments include, but may not be limited to: (i) the box C sequence, (ii) the 18S related domain A, and (iii) the 3'-distal portion of region 3 which overlaps with box D. Segments of the non-conserved spacer region are also implicated, based on impairment by the A50 point mutation, the two largest deletions (A45 -A56 and U61 -G85) and concentrations of nitrous acid mutations at A50 and U75 -U78. Mutations in the conserved sequences are of special interest, of course, as the functional defects observed for yeast snRl28 may also obtain for non-yeast U14 RNAs. On the other hand, it is possible that the conserved elements are not functionally identical. At least two classes of functional mutants have been discovered. One class has a low snRNA content and has the expected snr- growth and rRNA deficient phenotype. The mutations in this class are presumed to compromise snRNA synthesis or metabolic stability, creating a low steady-state abundance of snRNA and consequential deficiency in 18S RNA. Members of this group include mutants of box C and the distal region 3 mutants. The second class of mutants have normal levels of snRNA, but are phenotypically snr-. The two substitution mutants of domain A are in this class, as well as the 12 and 25 base deletions in the spacer region Table III. Lethal domain A mutations WILD-TYPE

C A U U C G C A G U U U C

DA2-1 DA2-2 DA3-1 DA3-2 DA3-3 DA34 DA3-5 DA3-6 DA3-7 DA3-8 DA3-9

U -U- AU - - - -U CG - - - U - - - - A - A C - U- UA- U U - - - -C AG- - - C C -A C -C- U - U UC C -A C A C---

DA3-1O

-

-

-

-

-

-

-

-

-

U

(A45 -A56 and U61 -G85). The snRNAs produced by these mutant alleles accumulate normally, but are unable to mediate the U14 function required for normal 18S RNA synthesis. Functional but impaired variants were also observed, including: (i) cold sensitive phenotypes for the A50 mutant and seven base deletion at G86 -G92 and (ii) slow growth at all temperatures tested for some directed domain A mutants (results not shown). If any of the snRNA low-abundance phenotypes is due to interference in SNR gene expression, this could be manifest at any level of synthesis, including transcriptional initiation or termination, processing, capping or base modification. The presence of snRNA abundance mutations within the coding sequence suggests that the promoter signal is not involved. However, this and other expression related models cannot be discounted as none of the transcriptional signals of the SNR128 gene have been identified and nothing is known about possible transcription factors which might bind within this sequence. It was anticipated that mutations in and around the box C and box D elements might influence U14 activity. These elements have been implicated in binding of the nucleolar fibrillarin protein and this activity has been postulated to be involved in movement of nucleolar snRNAs to that site or in pre-ribosomal RNP formation (Parker and Steitz, 1988; Tyc and Steitz, 1989; Schimmang et al., 1989). The two elements are in close proximity in hypothetical folding schemes (not shown), consistent with the possibility that each could be part of a common or unique protein binding domain, with the same or different function. The cs phenotype of the snRNA abundance mutants is consistent with impaired RNA -protein interaction, either during synthesis or posttranscriptional function. In addition to U14 the box C sequence UGAUGA also occurs in the U3, U8, U13 and snR190 RNAs. In S. cerevisiae it occurs in three of nine sequenced snoRNAs (Tollervey et al., 1983; Tollervey and Guthrie, 1985; Hughes et al., 1987; Parker et al., 1988; Zagorski et al., 1988). The functional mutants in the domain A region are particularly interesting, in view of the complementarity with 18S RNA and the demonstrated involvement of snR128 in 18S RNA production. The directed mutations in domain A demonstrate that bases throughout the element are required for function and that the domain A sequence itself may be critical. The segment required for activity is presently defined by: (i) a functionally neutral upstream substitution of eight bases and (ii) a two base deletion at the 3' end which is also without effect (A45 -C46). While the 5' boundary of the domain is well defined the 3' terminus is less clear. The relevant domain may or may not end with the 18S related segment (C31 -C43). In any event, the large lethal deletion on the 3' side (A45-A56) involves a region that appears to be specific to yeast. A tentative boundary for the 3' end of this spacer domain has been established by the functional six base deletion at U55 -C59. Although the 3' limit of the 18S related functional domain is uncertain, it is clear that nucleotides in the conserved region A are critical. When considered with the snRNA depletion effects on 18S RNA synthesis this finding suggests the possibility that U14 may pair directly with 18S RNA in carrying out its function. Perfect complementarity exists between the 13 related bases of yeast U14 and yeast 18S RNA and the 18S sequence is almost absolutely conserved 4507

A.Jarmolowski et al.

phylogenetically (Dams et al., 1988). The corresponding mouse RNAs possess a single, centrally located mismatch, at the single site of non-identity that distinguishes yeast and mouse U14; the mouse and yeast 18s sequences are identical in this region (Trinh-Rohlik and Maxwell, 1989). Secondary folding models predict the 18S segments to be single stranded (yeast, Hogan et al., 1984; rat, Chan et al., 1984). Of course, it remains to be determined if the relationship of the essential U 14 sequence with rRNA is more than coincidental. Interaction of the non-essential 18S related region with 18S RNA is not ruled out for S. cerevisiae, only that such an interaction is not essential for function. The finding that substantial portions of two conserved U14 elements are apparently dispensable in yeast is also interesting. The relevant regions correspond to: (i) the eight bases at the 5' end of region 2 and (ii) presumably all 14 bases of segment B in region 3. Thirteen of the 14 bases in this latter segment are complementary with 18S RNA, with one central mismatch; perfect complementarity exists for the two mouse RNAs (Trinh-Rohlik and Maxwell, 1989). The conserved sequences could simply be unimportant for function. Alternatively, the dispensability in yeast could reflect differences in biosynthesis or function of the two snRNAs. The mammalian species might, for example, carry out the same ribosome related function as the yeast homologue, but may have some additional function as well. It is also possible that the functions of the U 14 RNAs are identical, but mediated by machinery and processes that are not. In this regard, any common U14 segment could be dispensable in one or even both snoRNA species if an encoded function is supplied by another RNA or a protein. Future studies will be devoted to developing functional maps of higher resolution, with special interest in the box C and box D elements and the essential 18S related region. The possibility that these latter nucleotides do, indeed, pair with 18S RNA is currently being assessed, with potentially compensating base changes in tagged rDNA. Efforts to characterize suppressors of U14 mutations are also in progress.

Materials and methods Strains and culture conditions The yeast strain used was YS153 (Ura-, Trp-, His+'-, Gald, HIS3::GALJ::SNR128). Expression of snR128 in this strain is under control of the GAL] promoter (Johnston and Davis, 1984; Li et al., 1990). A 720 bp EcoRI-BamHI fragment from plasmid B620, containing the GAL] -GALJO promoters and UAS was ligated into the BclI site of pJZ14 (Zagorski et al., 1988) to create pJZ46, with GAL] located 4 bp upstream of the U14 start site. A second fragment containing HIS3 DNA was then introduced by ligating a 1.8 kb EcoRI-XbaI fragment from pUC18-HIS3 into the corresponding sites in pJZ46. The resulting plasmid, pJZ50, is HIS3::GALJO GALI::SNRJ28. A 3.5 kb ClaI fragment from pJZ50 was then used to transform the His- Gal+ haploid strain GRF167 (ca his3A ura3-167 Gal+). Several His+ Gald transformants were recovered. Southern blot analysis verified that the wild-type SNR128 gene had been replaced by the GALI::SNRJ28 allele. The new strain YS133 was mated with E280 (a his4-280 trpl canR Gal+) and a haploid isolate (Trp- His+/- Ura- Gald) was recovered after sporulation and used as test strain YS153. Strains GRF167 and E280 were obtained from G.Fink and plasmids pUC 18 -HIS3 and pB620 from A.Tzagaloff and G.Fink. Cells were maintained in: (i) rich medium containing glucose or galactose (YPD or YDG: 1 % yeast extract, 2% peptone, 2% dextrose or galactose) or (ii) minimal medium (SD or SG: 0.67% yeast nitrogeni base with 2 % dextrose or galactose) supplemented with histidine (20 jig/ml)-to relieve any galactose interference of HIS3 function, and uracil (20 jig/ml). Cells were cultured at 32°C except where indicated. All other yeast manipulations were carried out as described by Sherman et al. (1985). Except where

4508

indicated Escherichia coli strains and culturing conditions were as described previously (Zagorski et al., 1988; Li et al., 1990). Nucleic acid manipulation Procedures for preparing and analyzing yeast DNA and RNA have been described (Zagorski et al., 1988; Li et al., 1990). In the present study small RNA hybridization filters (Zeta Probe membranes, Bio-Rad Laboratories, Richmond, CA) were preincubated for 1 h to overnight at 30°C in standard 5 x SSC, 50 mM sodium phosphate pH 6.5, 10 x Denhardt's solution (0.2% Ficoll, 0.2% polyvinylpyrollidone, 0.2% bovine serum albumin), % SDS, 1 mg/mi salmon sperm DNA and 50% formamide. Hybridizations were in the same solution containing a 5'-labeled 31 base oligonucleotide complementary to snR128 nucleotides C43-U74 (1-5 x 106 c.p.m./ml). The probe was labeled with 32P as described by Ausubel et al. (1987). After incubation for 4 h to overnight, filters were washed twice for 15 min each in 2 x SSC, 1% SDS at 65°C. DNA sequencing was done by the dideoxynucleotide method using a primer that borders the SNR128 gene (complementary to -T73 to -T93). Chemical mutagenesis Chemical mutagenesis was carried out with 1 M nitrous acid (Ausubel, 1987). A 1.5 kb HindIII fragment of pJZ14 (Zagorski et al., 1988) containing both the U 14 and SNR190 genes was cloned into M13 mpl9. Three libraries were prepared, two consisting of DNA treated with nitrous acid for 1 h, the third included both sense and antisense DNAs exposed for 15 min (independently). After second strand synthesis the DNA was cut with BglII and AccI and the resulting 209 bp product subcloned into a yeast shuttle vector via a pUC19 derivative. The mutagenized fragment included the last 10 nucleotides of the upstream SNR 190 coding sequence, 67 bp that separate SNRJ90 and U14 DNA, the U 14 coding region and four bases of 3'-flanking DNA. An - 850 bp ClaI-NheI fragment containing target DNA and 450 and 200 bp of up and downstream wildtype yeast DNA was cloned into CEN3 vector, pJZ64. Vector pJZ64 is pYe(CEN3)30 (Fitzgerald-Hayes et al., 1982) with the ori and fl regions from pZ150 (Zagursky and Berman, 1984) and an asymmetric ClaI-SpeI linker inserted into the ClaI site. Functionality of the mutagenized SNR128 gene region was assessed by transforming the Gald yeast test strain YS153. Following growth on SG, phenotypes were tested on SD plates at 37°C and 23°C. Colonies showing growth impairment were collected for further analysis. Plasmids were recovered, amplified in E.coli and the mutagenized DNA region sequenced with a primer corresponding to -T172 to -G189. The genetic basis of the mutant phenotypes was verified by retransforming the Gald test strain and rescreening growth properties. Site directed mutagenesis Substitution mutants were prepared by the procedure of Kunkel (Kunkel, 1985; Kunkel et al., 1987), with a kit supplied by Bio-Rad Laboratories, Richmond, CA. The manufacturer's instructions were followed except that single stranded DNA for sequencing was prepared with helper phage R408 (Russell et al., 1986; Wang et al., 1989), with Ecoli DH 5uF' [,080d lacZA15 (lacZYA -argF) U169 endA1 recA1 hsdRJ7 (rK- mK+) supE44 thi-l X- gyrA relAl; Bethesda Research Labs]. The mutagenic oligonucleotides were prepared with a Biosearch Model 8700 DNA synthesizer. The primers ranged in size from: (i) 29-33 bases for substitutions of five to nine consecutive nucleotides and (ii) 33 bases for mapping of the 13 base domain A region; the altered sequences were centrally located. The base changes in the first case were: C - A, A - C, G - T, and T - G. All possible bases were used for higher resolution mapping of domain A. The mutations were introduced with the aid of the phagemid pJZ45. This vector contains: (i) a 1.3 kb ClaI yeast DNA fragment that includes both the SNRJ90 and SNR128 genes (Zagorski et al., 1988), (ii) the yeast TRP-ARS for replication and selection and CEN3 for maintenance at single copy-from pYe(CEN3)30 (Fitzgerald-Hayes et al., 1982) and, (iii) AmpR, ori and fl from pZ150 for propagation in E.coli and single strand DNA sequencing (Zagursky and Berman, 1984). Uracil-containing single stranded pJZ45 DNA was propagated and isolated from E.coli CJ236 [dut-l ung-1 thi-1 reMA-1/pCJIO5 (CamR)] after superinfection with helper phage R408. Two hundred pmol of each oligonucleotide were phosphorylated and 3-6 pmol were then used for annealing to - 300 ng of template, at primer to template ratios of 15:1 to 30:1. Second strand synthesis was mediated by T4 phage DNA polymerase. The resulting phagemids were transformed into E coli DH5ceF' and mutants identified by sequencing. Functionality of the mutant SNR genes in yeast was evaluated in the Gald test strain YS 153. Growth properties of the test transformants was examined on SD plates and compared with those of positive and negative control transformants. The control cells contained pJZ45, with the wild-type ClaI SNR DNA fragment or the parent plasmid lacking this insert. Mutant

Functional mappping of yeast U14 RNA

plasmids were recovered from yeast and resequenced to confirm the nature of the mutations.

Deletion mutants New restriction sites for KpnI, MluI and SacII were introduced into the SNR128 coding sequence through single base changes at each site by replacement of the BcI-BstEII region (nucleotides 1-90) with synthetic DNA fragments. This region was divided into three segments which were synthesized as three pairs of oligonucleotides. The fragments for the positive strand were GI-AI5, A16-G51 and G52-G85; the corresponding negative strand products were T5-C21, C22-G57 and C58-G90. The DNA synthesizer was programmed to yield oligonucleotides containing an equal mix of wild-type and mutant bases at the desired positions. Assembly of the fragments was predicted to yield eight U14 gene types with equal probabilities. The isolates expected included wild-type DNA and seven mutants with one to three new sites in all combinations. Twenty pmols of each gel-purified oligo were phosphorylated in 50 mM Tris-HCI pH 7.5, 10 mM MgCl2, 1 mM ATP, with 10 U of polynucleotide kinase for 45 min as 37°C. The kinase was inactivated by incubation at 65°C for 10 min and the complementary oligos were combined as specific pairs for annealing in 150 mM NaCl as described by Theriault et al. (1988). Annealing involved incubation at 95°C for 10 min, 65°C for 30 min, 37°C for 30 min and 15°C for 1 h. Five pmol of each annealed product were combined and ligated at 14°C for 12 h, followed by phenol -chloroform extraction and ethanol precipitation. The ligated DNA was digested with BclI and BstEll to yield the desired monomeric fragment. After phenol -chloroform extraction and ethanol precipitation, this DNA was combined with BclI and BstEII digested pJZ39 vector at a molar ratio of 20:1 (insert:vector) and ligated overnight at 14°C. Plasmid pJZ39 is pYe(CEN3)30 (Fitzgerald-Hayes et al., 1982) with a 1.3 kb ClaI fragment containing the SNRJ90 and SNR128 gene regions (Zagorski et al., 1988). The wild-type and mutant variants were identified by restriction enzyme screening and DNA sequencing. All but the three novel site variant were found, in the first 20 colonies examined. Deletions at the MluI, BstEII and AvrII sites were made by trimming single stranded extensions with S1 nuclease followed by religation. Deletions of sequences between SacH and MluI and BstEII were achieved by converting both digested sites into blunt ends with T4 DNA polymerase and ligation. Deletion mutants were identified by restriction enzyme analysis and confirmed by DSA sequencing. Densitometric analysis The relative abundances of snRNA and rRNA were estimated from densities of film images as described previously (Li et al., 1990).

Acknowledgements

Johnson,M. and Davis,R.W. (1984) Mol. Cell. Biol., 4, 1440-1448. Kass,S., Tyc,K., Steitz,J.A. and Sollner-Webb,B. (1990) Cell, 60, 897-908. Kunkel,T.A. (1985) Proc. Natl. Acad. Sci. USA, 82, 488-492. Kunkel,T.A., Roberts,J.D. and Zakour,R.A. (1987) Methods Enzymol., 154, 367-382. Li,H.V., Zagorski,J. and Fournier,M.J. (1990) Mol. Cell. Biol., 10, 1145-1152. Lischwe,M.A., Ochs,R.L., Reddy,R., Cook,R.G., Yeoman,L.C., Tan,E.M., Reichlin,M. and Busch,H. (1985) J. Biol. Chem., 260, 14304-14310. Maser,R.L. and Calvet,J.P. (1989) Proc. Natl. Acad. Sci. USA, 86, 6523-6527. Maxwell,E.S. and Martin,T.E. (1986) Proc. Natl. Acad. Sci. USA., 83, 7261 -7265. Parker,K.A. and Steitz,J.A. (1987) Mol. Cell. Biol., 7, 2899-2913. Parker,R., Simmons,T., Shuster,E.O., Siliciano,P.G. and Guthrie,C. (1988) Mol. Cell. Biol., 8, 3150-3159. Prestayko,A.W., Tonato,M. and Busch,H. (1970) J. Mol. Biol., 47, 505-515. Reddy,R., Henning,D. and Busch,H. (1985) J. Biol. Chem., 260, 10930-10935. Russel,M., Kidd,S. and Kelley,M.R. (1986) Gene, 45, 333-338. Savino,R. and Gerbi,S.A. (1990) EMBO J., 9, 2299-2308. Schimmang,T., Tollervey,D., Kern,H., Frank,R. and Hurt,E.C. (1989) EMBO J., 8, 4015 - 4024. Sherman,F., Fink,G.R. and Hicks,J.B. (1985) Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Stroke,I.L. and Weiner,A.M. (1989) J. Mol. Biol., 210, 497-512. Tague,B.W. and Gerbi,S. (1984) J. Mol. Evol., 20, 362-367. Theriault,N.Y., Carter,J.B. and Pulaski,S.P. (1988) BioTechniques, 6, 470-473. Tollervey,D. (1987) EMBO J., 6, 4169-4175. Tollervey,D. and Guthrie,C. (1985) EMBO J., 4, 3873-3878. Tollervey,D., Wise,J.A. and Guthrie,C. (1983) Cell, 35, 753-762. Trinh-Rohlik,Q. and Maxwell,E.S. (1988) Nucleic Acids Res., 16, 6041 -6056. Tyc,K. and Steitz,J.A. (1989) EMBO J., 8, 3113-3119. Wang,L.-M., Geihl,D.K., Ghosh Choudhury,G., Minter,A., Martinez,L., Weber,D.K. and Sakaguchi,A.Y. (1989) BioTechniques, 7, 1000-1010. Weinberg,R.A. and Penman,S. (1968) J. Mol. Biol., 38, 289-304. Wise,J.A. and Weiner,A.M. (1980) Cell, 22, 109-118. Zagorski,J., Tollervey,D. and Fournier,M.J. (1988) Mol. Cell. Biol., 8. 3282-3290. Zagursky,R.J. and Berman,M.L. (1984) Gene, 27, 183-191. Zieve,G. and Penman,S. (1976) Cell, 8, 19-31.

Received on August 2, 1990; revised on October 8, 1990

We thank Richard Lempicki for synthesis of the DNA oligonucleotides and E.Stuart Maxwell for helpflil discussions about metazoan U 14 RNA species. This work was supported by NIH grant GM19351.

References Ausubel,F.M., Brent,R., Kingston,R.E., Moor,D.D., Seidman,J.G., Smith,J.A. and Struhl,K. (eds) (1987) Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York. Bachellerie,J.P., Michot,B. and Raynal,F. (1983) Mol. Biol. Rep., 9, 79-86. Busch,H., Reddy,R., Rothblum,L. and Choi,Y.C. (1982) Annu. Rev. Biochem., 51, 617-654. Calvet,J.P. and Pedersen,T. (1981) Cell, 26, 363-370. Chan,Y.-I., Gutell,R., Noller,H.F. and Wool,I.G. (1984) J. Biol. Chem., 259, 224-230. Crouch,R.J., Kanaya,S. and Earl,P.L. (1983) Mol. Biol. Rep., 9, 75-78. Dams,E., Hendriks,L., Van de Peer,Y., Neefs,J.-M., Smiths,G., Vendenbempt,I. and De Wachter,R. (1988) Nucleic Acids Res., 16, r87-rI73. Epstein,P., Reddy,R. and Busch,H. (1984) Biochemistry, 23, 5421-5425. Fitzgerald-Hayes,M., Clarke,L. and Carbon,J. (1982) Cell, 29, 235-244. Hogan,J.J., Gutell,R.R. and Noller,H.F. (1984) Biochemistry, 23, 3322 -3330.

Hughes,J.M.X., Konings,D.A.M. and Cesareni,G. (1987) EMBO J., 6, 2145-2155.

Jeppesen,C., Stebbins-Boaz,B. and Gerbi,S.A. (1988) Nucleic Acids Res., 16, 2127-2148.

4509