.=) 1991 Oxford University Press
Nucleic Acids Research, Vol. 19, No. 22 6107-6112
Identification of transcriptional suppressor proteins that bind to the negative regulatory element of the human immunodeficiency virus type 1 Kazuo Yamamoto, Shigehisa Mori1, Takashi Okamoto1, Kunitada Shimotohno1 and Yoshimasa Kyogoku* Institute for Protein Research, Osaka University, Suita, Osaka 565, Japan and 'National Cancer Center, Research Institute, Tsukiji, Chuo-ku, Tokyo 104, Japan Received September 16, 1991; Accepted October 7, 1991
ABSTRACT Two different proteins which independently bound to neighboring sequences within the negative regulatory element (NRE) of human immunodeficiency virus type 1 (HIV-1) were detected in the nuclear extract of a virusinfected human T cell line. One of the factors bound to a novel dyad symmetrical sequence. This sequence is well conserved in various HIV-1 isolates and partial homology was found with the promoter region of the human retinoblastoma gene. Similar DNA binding activity was detected in a variety of virus-uninfected human T cell lines and HeLa cells by means of a gel mobility shift assay. The other factor bound to a putative AP-1 recognition sequence predicted for the HIV-1 NRE. However, this factor did not bind to a typical AP-1 site. The insertion of multiple copies of the binding site for the former or latter factor into a heterologous promoter reduced the promoter activity to one-tenth or one-third, respectively. Thus, each factor may function as a novel negative regulator of transcription.
INTRODUCTION Human immunodeficiency virus type 1 (HIV-1), an etiologic agent of acquired immunodeficiency syndrome (AIDS) (1-3), is a highly regulated retrovirus (reviewed in refs 4, 5). Previous studies demonstrated the location of cis-acting regulatory elements within the HIV-1 long terminal repeat (LTR). The trans-activation responsive (TAR) element, which is located between -17 and + 80 (+1 being the mRNA capping site; ref. 6), has been shown to be indispensable for trans-activation by a viral protein, Tat (7-12). The enhancer region (-105 to -80; refs. 6, 13) was shown to be responsible for the induction of HIV-1 gene expression through T cell activation signals (13-17). The negative regulatory element (NRE) was found far upstream from the transcription initiation site and is mapped over hundreds of bases (6, 18). Deletion of the NRE resulted in increases in the
*
To whom correspondence should be addressed
basal level and Tat-induced trans-activation of HIV-1 transcription (6, 16, 18). The molecular basis of the function of each element has been characterized through analysis of the sequence-specific DNA binding proteins that interact specifically with the individual elements. The interaction of LBP-1/UBP-1 (19-21) with the TAR element has been shown to be responsible for the basal and Tat-induced trans-activation of HIV-1 transcription (20, 22). The enhancer binding proteins, which have been extensively purified by several groups (21, 23, 24), are considered to transmit extracellular stimuli and to trigger HIV-1 transcription (25). The NRE also has a number of potential protein-binding sites. The sequence between -349 and -330 contains putative recognition sites for the cellular trans-activator protein, AP-1 (26). It was reported, however, that this region was bound by a T cell protein, presumably a member of the steroid/thyroid hormone receptor super family, not by AP-1 (27). More recently, human counterparts of the chicken ovalbumin upstream promoter transcription factors (COUP-TFs) were shown to bind to this region (28). The region from -254 to -216 was found to be protected from DNase I digestion by the nuclear extract of an activated human T cell line, Jurkat (29). A DNA fragment of the HIV-1 LTR containing these sequences competed with the canonical binding site for a T cell activation-specific transcription factor, NFAT-1 (29). The sequence between -179 and - 159 was also protected by a partially purified HeLa cell extract (19). This sequence is remarkably similar to that recognized by the upstream stimulatory factor (USF; ref. 30). Very recently, it was shown that a mutant HIV-1 provirus, of which the NFAT-l site or USF site within the NRE was selectively deleted, replicated more rapidly in Jurkat cells than the wild type did (31). In addition to the proteins described above, we identified a new member of the HIV-1 NRE-binding protein in a partially purified T cell nuclear extract. This cellular factor, designated as NRT-1, was shown to suppress the transcription from a heterologous promoter containing multiple copies of the binding site for this factor positioned upstream from the TATA box. We also
6108 Nucleic Acids Research, Vol. 19, No. 22 identified a weak transcriptional suppressor that bound to the putative AP-1 site within the HIV-1 NRE and present evidence that this factor is distinct from AP-1.
MATERIALS AND METHODS Cell culture and nuclear extract preparation The HIV-1-infected human CD4+ T cells, H9/IIIB, which were maintained in RPMI1640 medium containing 10% fetal calf serum, were kindly provided by Drs T.Hamakado and M.Mizukoshi (FUJIREBIO Inc., Ube, Japan). H9, Jurkat and MOLT4 cells were maintained in RPMI1640 medium containing 10% fetal calf serum. HeLa cells were maintained in minimal essential medium containing 5% fetal calf serum. Nuclear extracts were prepared as described (32), and then dialyzed against buffer PB-0. 1 containing 50 mM Tris -HCl (pH 7.9), 1 mM dithiothreitol, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 100 mM KCl and 20% glycerol. The handling of the virus-infected cells and preparation of the nuclear extract were carried out in the P3 facility at the FUJIREBIO Ube Laboratory.
Fractionation of the nuclear extract The H9/IIB nuclear extract (approximately 100 mg protein) was applied to a 30 ml heparin-Sepharose (Pharmacia) column equilibrated with buffer PB-0. 1. The column was washed with 150 ml of buffer PB-0. 1, and then the bound proteins were fractionated by step-wise elution. The 0.4 M KCl fraction was diluted with buffer PB-0.0 (no KCI) to 0.1 M KCl and subsequently loaded onto a 10 ml DEAE-Sepharose (Pharmacia) column equilibrated with buffer PB-0. 1. The column was washed with 30 ml of PB-0. 1 and then the bound proteins were recovered by step-wise elution with buffer PB-0.2 and PB-0.4, containing 0.2 M and 0.4 M KCl, respectively. Each fraction was precipitated by 60-70% saturation with ammonium sulfate. The pellets were suspended and dialyzed against buffer PB-0. 1, and then stored in aliquots at -800C. Plasmid construction and DNA probes A 718-base-pair (bp) DraI fragment containing the entire U3 and R regions of HIV-1 was excised from a plasmid, pCD12 (33), and then sub-cloned into the SnaI site of another plasmid, pTZ18R (United States Biochemical Corp.). This construct, pTHL8RSS, was 3'-end-labeled at the EcoRI site with [a-32P]dATP and the Klenow enzyme, followed by cleavage at the HincH site. The labeled fragments were isolated by polyacrylamide gel electrophoresis as described (34) and used as probes for DNase I footprint experiments. To obtain a smaller DNA fragment suitable for the methylation interference experiment, plasmid pTHL8RSS was digested with DramI and BstYI, and then blunt-ended with T4 DNA polymerase. One of the resultant DNA fragments containing the region from -404 to -245 of HIV-1 NRE was purified and then cloned into the SmaI site of pTZ18R. Probe preparation from the resultant constructs was performed as described above, followed by partial methylation with dimethyl sulfoxide as described (34). For gel mobility shift assays, double-stranded oligonucleotides complementary to the sequences protected from DNase I digestion were chemically synthesized (the sequences are listed in Fig. 2) with a DNA synthesizer (Applied Biosystem model 380B). In addition, oligonucleotides containing 3 base-substitutions in half
of the symmetrical sequence of probe A and 2 base-substitutions in the sequence of probe B were also synthesized (see Fig. 2). These oligonucleotides were 5'-end-labeled with [,y-32P]ATP and T4 polynucleotide kinase, annealed and then electrophoretically purified. For the insertion of multiple copies of a binding site, we designed the synthetic oligonucleotides so as to be connected in one direction. The complementary DNAs for site 1 (5'TGCTACAAGCTAGTACCA-3') and site 2 (5'-TATCCACTGACCTTT-3'), with three guanine and cytosine residues at the 5'-end of the upper and lower strands, respectively, were chemically synthesized. These oligonucleotides were 5'-phosphorylated with ATP and T4 polynucleotide kinase, annealed and then polymerized with T4 DNA ligase. The polymerized DNA containing four copies of each site was excised from a polyacrylamide gel and then cloned into the unique SmaI site of a plasmid, pRAU3-CAT (35). The direction of the inserted fragment was determined by SmaI digestion of the resultant
plasmid. DNA binding experiments Binding reactions were carried out in 20 1l for DNase I footprint analysis or in 10 tdl for the gel mobility shift assay, with 1 Ag of unlabeled poly (dI-dC) and various amounts of the protein fraction, under final buffer conditions of 25 mM Tris -HCl (pH 7.9), 50 mM KCl, 1 mM dithiothreitol, 0.1 mM EDTA and 10% glycerol. Each mixture was preincubated for 10 min on ice, followed by the addition of 1-5 ng ofthe end-labeled DNA probe (5,000-10,000 cpm). The binding reactions were performed for 20 min at room temperature. For DNase I footprint analysis, the binding reaction mixtures were digested for 1 min by the addition of 5 Al of a DNase I digestion mixture (5 mM CaCl2, 10 mM MgCl2 and 0.2-0.5 units of RQl DNase purchased from Promega Inc., with the same buffer conditions as for the binding reactions). The digestion was terminated by the addition of 60 yl of a STOP solution (50 mM EDTA, 0.2% sodium dodecyl sulfate and 100 itg/ml tRNA), followed by extraction with phenol and chloroform, and then precipitation twice with ethanol. The pellets were rinsed with 70% ethanol and then dried before loading on a 10% sequencing gel. For the gel mobility shift assay, the binding reactions were mixed with 4 1d of a loading buffer (0.05 % bromophenol blue and 0.05% xylene cyanol, with the same buffer conditions as for the reactions) and then electrophoresed on a 6% nondenaturing polyacrylamide gel at 5°C. For the methylation interference assay, the binding reactions with the partially methylated DNA probes were scaled up to 10-fold. Free and bound DNAs were separated as described above and then purified with QIAGEN-tip (DIAGEN). The DNAs were cleaved as described (34) and then applied on a 8 % sequencing gel.
Transfection and CAT assay The plasmids used for transfection were quantitated by measurement of the optical density at 280 nm and then on an ethidium bromide-stained agarose gel. 2 x 106 Jurkat cells were co-transfected with 4 yg of each CAT construct described above and 4 itg of a control plasmid carrying the ,3-galactosidase gene under the control of the j3-actin promoter by means of electroporation (36). The transfected cells were cultured for 48 hours in RPMI1640 medium containing 10% fetal calf serum
Nucleic Acids Research, Vol. 19, No. 22 6109 and then harvested for CAT assays. The CAT assays were performed with 3 jig of a cell lysate under the standard conditions (36, 37). Transfection efficiency was determined by measurement of 3-galactosidase activity in the lysate. The conversion of chloramphenicol in each assay was determined by densitometric scanning of the autoradiograph. Values were normalized to the transfection efficiency.
RESULTS Identification of HIV-1 NRE-binding proteins in the nuclear extract of a HIV-1 infected human T lymphocyte cell line We prepared a nuclear extract from a HIV-1-infected human CD4+ T cell line, H9/IIIB, and fractionated it on a heparin -Sepharose column. The 0.4 M KCl fraction from the column, in which the majority of the stimulatory activity for HIV-l LTR-specific transcription was present (33), was further fractionated by step-wise elution from a DEAE-Sepharose column. The resulting eluates were used for a DNase I footprint experiment. Fr4. 1 (the flow-through fraction from the DEAE- Sepharose column) protected the region of the HIV-l LTR between -338 and -325 upstream from the transcription initiation site (Fig. 1). This region contains one of two putative recognition sites for a cellular transcription factor, AP-1 (26; Fig. 2). Another fraction, Fr4.2 (the 0.2 M fraction from the DEAE-Sepharose column), contained a novel factor which bound to a region adjacent to the region protected by Fr4. 1 (-320 to -295; Fig. 1). This newly identified region contains a pseudo-dyad symmetrical sequence (Fig. 2). To precisely localize the sequence recognized by this factor, a DNase I footprint experiment on the other strand and a methylation interference experiment on both strands were performed for Fr4.2. The results are summarized in Fig. 2. Some other regions downstream from those indicated in Fig. 1 were also protected, such as the enhancer region by
Fr4.1
G AG
0 5 1
Fr4. 1 and the TAR region by Fr4.2, respectively (data not shown). To confirm the sequence-specificity of each factor, we performed gel mobility shift assays with synthetic oligonucleotide probes containing the protected sequence in the DNase I footprint experiment (see Fig. 2). A specific protein-DNA complex was detected when the protein fraction was incubated with the corresponding radio-labeled probe (Fig. 3). A 10- or 50-fold molar-excess of the unlabeled oligonucleotides efficiently competed with the probe, while the same amount of basesubstituted mutant oligonucleotides (the sequences listed in Fig. 2) did not. Moreover, a similar type of competition experiment involving DNase I footprint assays gave a consistent result, that is, the footprint of the -320 to -295 region was effectively abolished in the presence of the wild type oligonucleotides, but not in the presence of the mutant ones (data not shown). These results indicate the highly sequence-specific interaction of these NRE-binding proteins with DNA.
-f
.^
.ISO
o
1
AGGAGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGATA TCCTCAGTCTATAGGTGACTGGAAACCTACCACGATGTTrCGATCATGG,CAACTCGGTCTATTCTAT 0 0 L. 9 ....JL
site 2 Pabsb
site 1 GGATGGTGCTACAAGCTAGTACCAGTTGAGCCAG
nm 1: pbes nt 2.
TOC
GCA
GGTCAGATATCCACTGACCTTTGG GT
Figure 2. A portion of the NRE sequence in the HIV-l LTR. The brackets indicate regions protected from DNase I digestion. The dashed lines indicate regions of weak protection. The arrows between the sequences indicate the pseudo-dyad symmetry found in site 1. The dashed lines between the sequences are putative AP-1 recognition sites. The asterisks and open circles represent points of strong and weak methylation interference, respectively. The sequences of the probes and the base-substituted oligonucleotides used in the gel mobility shift assays are also indicated.
Fr4.2 0 5 10 0
Fr4.1/probe B
Fr4.2/probe A
*I+#*1-3X
competitor
mt
wt
wt
50
10
h~
WH
10
mt 2
50
10
50
-295
35
1
2 34 56 7
Figure 1. HIV-lI NRE binding activity in fractions of HIV-lI-infected H9 cells. The DNase I protection patterns for the non-coding strand of the HIV-lI LTR with no protein (lanes 1, 4 and 7), and 5 Asl (lanes 2 and 5) and 10 Al (lanes 3 and 6) of partially purified protein fractions of a HIV-1-infected H9 nuclear extract (designated as Fr4. 1 or Fr4.2; see Materials and methods) are shown. G and AG are Maxam-Gilbert sequence ladders. The regions protected from DNase I digestion are also indicated, as boxes with the corresponding nucleotide numbers.
W 2
3
4
5
6
7
8
9
10
Figure 3. Gel mobility shift assays with the NRE-binding factors. 2 A1 aliquots of Fr4.2 (lanes 1 to 5) and Fr4.1 (lanes 6 to 10) were incubated with the corresponding probes. The results of competition experiments with the indicated molar-excess amounts of non-radiolabeled wild type or mutant oligonucleotides are shown.
6110 Nucleic Acids Research, Vol. 19, No. 22
A
. .w #Am~
U Is.
*. .
%
:.
.I
I
~~miMiUMmhiIIW.:: Figure 4. Detection of the interaction of protein(s) in various cell lines. Nuclear extracts were incubated with (A) probe A or (B) probe B indicated in Fig. 2, respectively. 2 yg of Fr4.2 (lane I in A) or Fr4.1 (lane I in B), and 10 tzg aliquots of nuclear extracts of HIV-l-infected H9 (lanes 3 and 4), uninfected H9 (lanes 5 and 6), Jurkat (lanes 7 and 8), MOLT4 (lanes 9 and 10) and HeLa (lanes 11 and 12) cells were incubated with (lanes 2, 4, 6, 8, 10 and 12) or without the wild type competitor (lanes 1, 3, 5, 7, 9 and 11).
Distribution of the HIV-1 NRE-binding factors in various cell lines We next, examined the nuclear extracts of various HIV-1-uninfected cell lines, by means of gel mobility shift assays, to determine whether the HIV- 1 NRE-binding factors are viral or cellular proteins, which are constitutively expressed or induced by viral infection. A protein-DNA complex with the same mobility as that of Fr4.2 was detected in the nuclear extracts prepared from HIV-1-uninfected H9, Jurkat, MOLT4 and HeLa cells, respectively (Fig. 4A). The binding specificity of each complex was confirmed by the competition with a 10-fold molarexcess of unlabeled oligonucleotides. The amount of this factor in HIV-1-infected or uninfected H9 cells seems to be greater than that in Jurkat, MOLT4 or HeLa cells (compare lanes 3 and 5 with lanes 7, 9 and 11). Fig. 4B shows the presence of the factor detected in Fr4. 1 in various T cell lines. In HeLa cells, there was no detectable band corresponding to that observed for Fr4. 1, whereas a thick band migrating more rapidly was detected in the gel (Fig. 4B, lane 11). This suggests that a related but different molecule which recognizes the same DNA sequence is expressed in different cell types or that the same protein is modified in different ways in different tissues (see below). From these observations, we concluded that the factors detected in the H9/IIIB nuclear extract fractions were cellular proteins which are constitutively expressed in the many cell lines examined here. A factor distinct from AP-1 binds to a putative AP-1 site in the HIV-1 NRE The factor detected in Fr4. 1 bound to a region containing a putative AP-l binding site (Fig. 2; ref. 26). To determine whether this factor is identical or related to AP-1, a collagenase gene enhancer which contains a typical AP-1 site (38) was analyzed as to its binding to the factor in Fr4. 1. When the AP- 1 like sequence in the HIV-1 NRE was used as a probe, the formation
of a specific protein-DNA complex was not affected by the addition of either wild type or mutant oligonucleotides of the AP-l site from the collagenase gene enhancer (Fig. 5). Similar DNA binding specificity was demonstrated with the factor detected in HeLa cell nuclei. These results indicate that the factor that bound to this HIV- 1 sequence has a DNA binding specificity distinct from that of AP- 1. Conversely, when the AP- 1 site was used as a probe, no retarded band was observed for Fr4. 1 (data not shown). Thus, we conclude that the factor in Fr4. 1 is a DNA binding protein distinct from AP-1.
Multiple copies of the NRE-binding factor recognition sequence suppress the transcription from a heterologous promoter To examine the function of each NRE-binding factor in transcription in vivo, we first examined the promoter activity of HIV- 1 LTR mutants, in which the binding sites for each or both factors were disrupted by means of site-directed mutagenesis, in Jurkat cells using the CAT assay. The results indicated that the mutation in site 1 reproducibly increased the promoter activity about two-fold and that the mutation in site 2 did not significantly affect the promoter activity (data not shown). Thus, to determine the function of each factor more directly, we inserted four copies of the binding site for each factor into the upstream region of a heterologous promoter, which was derived from the Rous sarcoma virus (RSV) LTR by deleting other cis-elements upstream from the functional TATA box and linked to the bacterial chloramphenicol acetyltransferase (CAT) gene (pRAU3-CAT; ref. 35). Each chimeric promoter-CAT construct (site lX4 and site2X4), as well as the parental plasmid as a control, was co-transfected with a plasmid carrying the ,B-galactosidase gene under the control of the ,B-actin promoter as an internal control into Jurkat cells by means of electroporation, and then the promoter activity was determined as the CAT activity. The efficiency of each transfection was determined as the /galactosidase activity. For reproducibility of the experiments, the
Fr4.1 competitor
_-
cold B AP1 - wt mt wt mt "
t
_
*
Nucleic Acids Research, Vol. 19, No. 22 6111 HeLa NE cold B
AP1
- wt mt wt mt
control
-Isite1X4 site2X4I
smaC (-2?gV-82)
* *
i3E3EE-
0
*
*-
7
8
Nucleic Acids Research, Vol. 19, No. 22 6107-6112
Identification of transcriptional suppressor proteins that bind to the negative regulatory element of the human immunodeficiency virus type 1 Kazuo Yamamoto, Shigehisa Mori1, Takashi Okamoto1, Kunitada Shimotohno1 and Yoshimasa Kyogoku* Institute for Protein Research, Osaka University, Suita, Osaka 565, Japan and 'National Cancer Center, Research Institute, Tsukiji, Chuo-ku, Tokyo 104, Japan Received September 16, 1991; Accepted October 7, 1991
ABSTRACT Two different proteins which independently bound to neighboring sequences within the negative regulatory element (NRE) of human immunodeficiency virus type 1 (HIV-1) were detected in the nuclear extract of a virusinfected human T cell line. One of the factors bound to a novel dyad symmetrical sequence. This sequence is well conserved in various HIV-1 isolates and partial homology was found with the promoter region of the human retinoblastoma gene. Similar DNA binding activity was detected in a variety of virus-uninfected human T cell lines and HeLa cells by means of a gel mobility shift assay. The other factor bound to a putative AP-1 recognition sequence predicted for the HIV-1 NRE. However, this factor did not bind to a typical AP-1 site. The insertion of multiple copies of the binding site for the former or latter factor into a heterologous promoter reduced the promoter activity to one-tenth or one-third, respectively. Thus, each factor may function as a novel negative regulator of transcription.
INTRODUCTION Human immunodeficiency virus type 1 (HIV-1), an etiologic agent of acquired immunodeficiency syndrome (AIDS) (1-3), is a highly regulated retrovirus (reviewed in refs 4, 5). Previous studies demonstrated the location of cis-acting regulatory elements within the HIV-1 long terminal repeat (LTR). The trans-activation responsive (TAR) element, which is located between -17 and + 80 (+1 being the mRNA capping site; ref. 6), has been shown to be indispensable for trans-activation by a viral protein, Tat (7-12). The enhancer region (-105 to -80; refs. 6, 13) was shown to be responsible for the induction of HIV-1 gene expression through T cell activation signals (13-17). The negative regulatory element (NRE) was found far upstream from the transcription initiation site and is mapped over hundreds of bases (6, 18). Deletion of the NRE resulted in increases in the
*
To whom correspondence should be addressed
basal level and Tat-induced trans-activation of HIV-1 transcription (6, 16, 18). The molecular basis of the function of each element has been characterized through analysis of the sequence-specific DNA binding proteins that interact specifically with the individual elements. The interaction of LBP-1/UBP-1 (19-21) with the TAR element has been shown to be responsible for the basal and Tat-induced trans-activation of HIV-1 transcription (20, 22). The enhancer binding proteins, which have been extensively purified by several groups (21, 23, 24), are considered to transmit extracellular stimuli and to trigger HIV-1 transcription (25). The NRE also has a number of potential protein-binding sites. The sequence between -349 and -330 contains putative recognition sites for the cellular trans-activator protein, AP-1 (26). It was reported, however, that this region was bound by a T cell protein, presumably a member of the steroid/thyroid hormone receptor super family, not by AP-1 (27). More recently, human counterparts of the chicken ovalbumin upstream promoter transcription factors (COUP-TFs) were shown to bind to this region (28). The region from -254 to -216 was found to be protected from DNase I digestion by the nuclear extract of an activated human T cell line, Jurkat (29). A DNA fragment of the HIV-1 LTR containing these sequences competed with the canonical binding site for a T cell activation-specific transcription factor, NFAT-1 (29). The sequence between -179 and - 159 was also protected by a partially purified HeLa cell extract (19). This sequence is remarkably similar to that recognized by the upstream stimulatory factor (USF; ref. 30). Very recently, it was shown that a mutant HIV-1 provirus, of which the NFAT-l site or USF site within the NRE was selectively deleted, replicated more rapidly in Jurkat cells than the wild type did (31). In addition to the proteins described above, we identified a new member of the HIV-1 NRE-binding protein in a partially purified T cell nuclear extract. This cellular factor, designated as NRT-1, was shown to suppress the transcription from a heterologous promoter containing multiple copies of the binding site for this factor positioned upstream from the TATA box. We also
6108 Nucleic Acids Research, Vol. 19, No. 22 identified a weak transcriptional suppressor that bound to the putative AP-1 site within the HIV-1 NRE and present evidence that this factor is distinct from AP-1.
MATERIALS AND METHODS Cell culture and nuclear extract preparation The HIV-1-infected human CD4+ T cells, H9/IIIB, which were maintained in RPMI1640 medium containing 10% fetal calf serum, were kindly provided by Drs T.Hamakado and M.Mizukoshi (FUJIREBIO Inc., Ube, Japan). H9, Jurkat and MOLT4 cells were maintained in RPMI1640 medium containing 10% fetal calf serum. HeLa cells were maintained in minimal essential medium containing 5% fetal calf serum. Nuclear extracts were prepared as described (32), and then dialyzed against buffer PB-0. 1 containing 50 mM Tris -HCl (pH 7.9), 1 mM dithiothreitol, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 100 mM KCl and 20% glycerol. The handling of the virus-infected cells and preparation of the nuclear extract were carried out in the P3 facility at the FUJIREBIO Ube Laboratory.
Fractionation of the nuclear extract The H9/IIB nuclear extract (approximately 100 mg protein) was applied to a 30 ml heparin-Sepharose (Pharmacia) column equilibrated with buffer PB-0. 1. The column was washed with 150 ml of buffer PB-0. 1, and then the bound proteins were fractionated by step-wise elution. The 0.4 M KCl fraction was diluted with buffer PB-0.0 (no KCI) to 0.1 M KCl and subsequently loaded onto a 10 ml DEAE-Sepharose (Pharmacia) column equilibrated with buffer PB-0. 1. The column was washed with 30 ml of PB-0. 1 and then the bound proteins were recovered by step-wise elution with buffer PB-0.2 and PB-0.4, containing 0.2 M and 0.4 M KCl, respectively. Each fraction was precipitated by 60-70% saturation with ammonium sulfate. The pellets were suspended and dialyzed against buffer PB-0. 1, and then stored in aliquots at -800C. Plasmid construction and DNA probes A 718-base-pair (bp) DraI fragment containing the entire U3 and R regions of HIV-1 was excised from a plasmid, pCD12 (33), and then sub-cloned into the SnaI site of another plasmid, pTZ18R (United States Biochemical Corp.). This construct, pTHL8RSS, was 3'-end-labeled at the EcoRI site with [a-32P]dATP and the Klenow enzyme, followed by cleavage at the HincH site. The labeled fragments were isolated by polyacrylamide gel electrophoresis as described (34) and used as probes for DNase I footprint experiments. To obtain a smaller DNA fragment suitable for the methylation interference experiment, plasmid pTHL8RSS was digested with DramI and BstYI, and then blunt-ended with T4 DNA polymerase. One of the resultant DNA fragments containing the region from -404 to -245 of HIV-1 NRE was purified and then cloned into the SmaI site of pTZ18R. Probe preparation from the resultant constructs was performed as described above, followed by partial methylation with dimethyl sulfoxide as described (34). For gel mobility shift assays, double-stranded oligonucleotides complementary to the sequences protected from DNase I digestion were chemically synthesized (the sequences are listed in Fig. 2) with a DNA synthesizer (Applied Biosystem model 380B). In addition, oligonucleotides containing 3 base-substitutions in half
of the symmetrical sequence of probe A and 2 base-substitutions in the sequence of probe B were also synthesized (see Fig. 2). These oligonucleotides were 5'-end-labeled with [,y-32P]ATP and T4 polynucleotide kinase, annealed and then electrophoretically purified. For the insertion of multiple copies of a binding site, we designed the synthetic oligonucleotides so as to be connected in one direction. The complementary DNAs for site 1 (5'TGCTACAAGCTAGTACCA-3') and site 2 (5'-TATCCACTGACCTTT-3'), with three guanine and cytosine residues at the 5'-end of the upper and lower strands, respectively, were chemically synthesized. These oligonucleotides were 5'-phosphorylated with ATP and T4 polynucleotide kinase, annealed and then polymerized with T4 DNA ligase. The polymerized DNA containing four copies of each site was excised from a polyacrylamide gel and then cloned into the unique SmaI site of a plasmid, pRAU3-CAT (35). The direction of the inserted fragment was determined by SmaI digestion of the resultant
plasmid. DNA binding experiments Binding reactions were carried out in 20 1l for DNase I footprint analysis or in 10 tdl for the gel mobility shift assay, with 1 Ag of unlabeled poly (dI-dC) and various amounts of the protein fraction, under final buffer conditions of 25 mM Tris -HCl (pH 7.9), 50 mM KCl, 1 mM dithiothreitol, 0.1 mM EDTA and 10% glycerol. Each mixture was preincubated for 10 min on ice, followed by the addition of 1-5 ng ofthe end-labeled DNA probe (5,000-10,000 cpm). The binding reactions were performed for 20 min at room temperature. For DNase I footprint analysis, the binding reaction mixtures were digested for 1 min by the addition of 5 Al of a DNase I digestion mixture (5 mM CaCl2, 10 mM MgCl2 and 0.2-0.5 units of RQl DNase purchased from Promega Inc., with the same buffer conditions as for the binding reactions). The digestion was terminated by the addition of 60 yl of a STOP solution (50 mM EDTA, 0.2% sodium dodecyl sulfate and 100 itg/ml tRNA), followed by extraction with phenol and chloroform, and then precipitation twice with ethanol. The pellets were rinsed with 70% ethanol and then dried before loading on a 10% sequencing gel. For the gel mobility shift assay, the binding reactions were mixed with 4 1d of a loading buffer (0.05 % bromophenol blue and 0.05% xylene cyanol, with the same buffer conditions as for the reactions) and then electrophoresed on a 6% nondenaturing polyacrylamide gel at 5°C. For the methylation interference assay, the binding reactions with the partially methylated DNA probes were scaled up to 10-fold. Free and bound DNAs were separated as described above and then purified with QIAGEN-tip (DIAGEN). The DNAs were cleaved as described (34) and then applied on a 8 % sequencing gel.
Transfection and CAT assay The plasmids used for transfection were quantitated by measurement of the optical density at 280 nm and then on an ethidium bromide-stained agarose gel. 2 x 106 Jurkat cells were co-transfected with 4 yg of each CAT construct described above and 4 itg of a control plasmid carrying the ,3-galactosidase gene under the control of the j3-actin promoter by means of electroporation (36). The transfected cells were cultured for 48 hours in RPMI1640 medium containing 10% fetal calf serum
Nucleic Acids Research, Vol. 19, No. 22 6109 and then harvested for CAT assays. The CAT assays were performed with 3 jig of a cell lysate under the standard conditions (36, 37). Transfection efficiency was determined by measurement of 3-galactosidase activity in the lysate. The conversion of chloramphenicol in each assay was determined by densitometric scanning of the autoradiograph. Values were normalized to the transfection efficiency.
RESULTS Identification of HIV-1 NRE-binding proteins in the nuclear extract of a HIV-1 infected human T lymphocyte cell line We prepared a nuclear extract from a HIV-1-infected human CD4+ T cell line, H9/IIIB, and fractionated it on a heparin -Sepharose column. The 0.4 M KCl fraction from the column, in which the majority of the stimulatory activity for HIV-l LTR-specific transcription was present (33), was further fractionated by step-wise elution from a DEAE-Sepharose column. The resulting eluates were used for a DNase I footprint experiment. Fr4. 1 (the flow-through fraction from the DEAE- Sepharose column) protected the region of the HIV-l LTR between -338 and -325 upstream from the transcription initiation site (Fig. 1). This region contains one of two putative recognition sites for a cellular transcription factor, AP-1 (26; Fig. 2). Another fraction, Fr4.2 (the 0.2 M fraction from the DEAE-Sepharose column), contained a novel factor which bound to a region adjacent to the region protected by Fr4. 1 (-320 to -295; Fig. 1). This newly identified region contains a pseudo-dyad symmetrical sequence (Fig. 2). To precisely localize the sequence recognized by this factor, a DNase I footprint experiment on the other strand and a methylation interference experiment on both strands were performed for Fr4.2. The results are summarized in Fig. 2. Some other regions downstream from those indicated in Fig. 1 were also protected, such as the enhancer region by
Fr4.1
G AG
0 5 1
Fr4. 1 and the TAR region by Fr4.2, respectively (data not shown). To confirm the sequence-specificity of each factor, we performed gel mobility shift assays with synthetic oligonucleotide probes containing the protected sequence in the DNase I footprint experiment (see Fig. 2). A specific protein-DNA complex was detected when the protein fraction was incubated with the corresponding radio-labeled probe (Fig. 3). A 10- or 50-fold molar-excess of the unlabeled oligonucleotides efficiently competed with the probe, while the same amount of basesubstituted mutant oligonucleotides (the sequences listed in Fig. 2) did not. Moreover, a similar type of competition experiment involving DNase I footprint assays gave a consistent result, that is, the footprint of the -320 to -295 region was effectively abolished in the presence of the wild type oligonucleotides, but not in the presence of the mutant ones (data not shown). These results indicate the highly sequence-specific interaction of these NRE-binding proteins with DNA.
-f
.^
.ISO
o
1
AGGAGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGATA TCCTCAGTCTATAGGTGACTGGAAACCTACCACGATGTTrCGATCATGG,CAACTCGGTCTATTCTAT 0 0 L. 9 ....JL
site 2 Pabsb
site 1 GGATGGTGCTACAAGCTAGTACCAGTTGAGCCAG
nm 1: pbes nt 2.
TOC
GCA
GGTCAGATATCCACTGACCTTTGG GT
Figure 2. A portion of the NRE sequence in the HIV-l LTR. The brackets indicate regions protected from DNase I digestion. The dashed lines indicate regions of weak protection. The arrows between the sequences indicate the pseudo-dyad symmetry found in site 1. The dashed lines between the sequences are putative AP-1 recognition sites. The asterisks and open circles represent points of strong and weak methylation interference, respectively. The sequences of the probes and the base-substituted oligonucleotides used in the gel mobility shift assays are also indicated.
Fr4.2 0 5 10 0
Fr4.1/probe B
Fr4.2/probe A
*I+#*1-3X
competitor
mt
wt
wt
50
10
h~
WH
10
mt 2
50
10
50
-295
35
1
2 34 56 7
Figure 1. HIV-lI NRE binding activity in fractions of HIV-lI-infected H9 cells. The DNase I protection patterns for the non-coding strand of the HIV-lI LTR with no protein (lanes 1, 4 and 7), and 5 Asl (lanes 2 and 5) and 10 Al (lanes 3 and 6) of partially purified protein fractions of a HIV-1-infected H9 nuclear extract (designated as Fr4. 1 or Fr4.2; see Materials and methods) are shown. G and AG are Maxam-Gilbert sequence ladders. The regions protected from DNase I digestion are also indicated, as boxes with the corresponding nucleotide numbers.
W 2
3
4
5
6
7
8
9
10
Figure 3. Gel mobility shift assays with the NRE-binding factors. 2 A1 aliquots of Fr4.2 (lanes 1 to 5) and Fr4.1 (lanes 6 to 10) were incubated with the corresponding probes. The results of competition experiments with the indicated molar-excess amounts of non-radiolabeled wild type or mutant oligonucleotides are shown.
6110 Nucleic Acids Research, Vol. 19, No. 22
A
. .w #Am~
U Is.
*. .
%
:.
.I
I
~~miMiUMmhiIIW.:: Figure 4. Detection of the interaction of protein(s) in various cell lines. Nuclear extracts were incubated with (A) probe A or (B) probe B indicated in Fig. 2, respectively. 2 yg of Fr4.2 (lane I in A) or Fr4.1 (lane I in B), and 10 tzg aliquots of nuclear extracts of HIV-l-infected H9 (lanes 3 and 4), uninfected H9 (lanes 5 and 6), Jurkat (lanes 7 and 8), MOLT4 (lanes 9 and 10) and HeLa (lanes 11 and 12) cells were incubated with (lanes 2, 4, 6, 8, 10 and 12) or without the wild type competitor (lanes 1, 3, 5, 7, 9 and 11).
Distribution of the HIV-1 NRE-binding factors in various cell lines We next, examined the nuclear extracts of various HIV-1-uninfected cell lines, by means of gel mobility shift assays, to determine whether the HIV- 1 NRE-binding factors are viral or cellular proteins, which are constitutively expressed or induced by viral infection. A protein-DNA complex with the same mobility as that of Fr4.2 was detected in the nuclear extracts prepared from HIV-1-uninfected H9, Jurkat, MOLT4 and HeLa cells, respectively (Fig. 4A). The binding specificity of each complex was confirmed by the competition with a 10-fold molarexcess of unlabeled oligonucleotides. The amount of this factor in HIV-1-infected or uninfected H9 cells seems to be greater than that in Jurkat, MOLT4 or HeLa cells (compare lanes 3 and 5 with lanes 7, 9 and 11). Fig. 4B shows the presence of the factor detected in Fr4. 1 in various T cell lines. In HeLa cells, there was no detectable band corresponding to that observed for Fr4. 1, whereas a thick band migrating more rapidly was detected in the gel (Fig. 4B, lane 11). This suggests that a related but different molecule which recognizes the same DNA sequence is expressed in different cell types or that the same protein is modified in different ways in different tissues (see below). From these observations, we concluded that the factors detected in the H9/IIIB nuclear extract fractions were cellular proteins which are constitutively expressed in the many cell lines examined here. A factor distinct from AP-1 binds to a putative AP-1 site in the HIV-1 NRE The factor detected in Fr4. 1 bound to a region containing a putative AP-l binding site (Fig. 2; ref. 26). To determine whether this factor is identical or related to AP-1, a collagenase gene enhancer which contains a typical AP-1 site (38) was analyzed as to its binding to the factor in Fr4. 1. When the AP- 1 like sequence in the HIV-1 NRE was used as a probe, the formation
of a specific protein-DNA complex was not affected by the addition of either wild type or mutant oligonucleotides of the AP-l site from the collagenase gene enhancer (Fig. 5). Similar DNA binding specificity was demonstrated with the factor detected in HeLa cell nuclei. These results indicate that the factor that bound to this HIV- 1 sequence has a DNA binding specificity distinct from that of AP- 1. Conversely, when the AP- 1 site was used as a probe, no retarded band was observed for Fr4. 1 (data not shown). Thus, we conclude that the factor in Fr4. 1 is a DNA binding protein distinct from AP-1.
Multiple copies of the NRE-binding factor recognition sequence suppress the transcription from a heterologous promoter To examine the function of each NRE-binding factor in transcription in vivo, we first examined the promoter activity of HIV- 1 LTR mutants, in which the binding sites for each or both factors were disrupted by means of site-directed mutagenesis, in Jurkat cells using the CAT assay. The results indicated that the mutation in site 1 reproducibly increased the promoter activity about two-fold and that the mutation in site 2 did not significantly affect the promoter activity (data not shown). Thus, to determine the function of each factor more directly, we inserted four copies of the binding site for each factor into the upstream region of a heterologous promoter, which was derived from the Rous sarcoma virus (RSV) LTR by deleting other cis-elements upstream from the functional TATA box and linked to the bacterial chloramphenicol acetyltransferase (CAT) gene (pRAU3-CAT; ref. 35). Each chimeric promoter-CAT construct (site lX4 and site2X4), as well as the parental plasmid as a control, was co-transfected with a plasmid carrying the ,B-galactosidase gene under the control of the ,B-actin promoter as an internal control into Jurkat cells by means of electroporation, and then the promoter activity was determined as the CAT activity. The efficiency of each transfection was determined as the /galactosidase activity. For reproducibility of the experiments, the
Fr4.1 competitor
_-
cold B AP1 - wt mt wt mt "
t
_
*
Nucleic Acids Research, Vol. 19, No. 22 6111 HeLa NE cold B
AP1
- wt mt wt mt
control
-Isite1X4 site2X4I
smaC (-2?gV-82)
* *
i3E3EE-
0
*
*-
7
8
