Journal of Neuroscience Research 29:437-448 (1991)

Identification of Transcriptionally Regulated Genes After Sciatic Nerve Injury M. De Leon, A.A. Welcher, U. Suter, and E.M. Shooter Department of Neurobiology , Stanford University School of Medicine, Stanford, California

Mammalian peripheral nerve fibres can regenerate after injury. In an attempt toward a better understanding of the underlying molecular events, we have isolated novel and known rat cDNA sequences, the expression of which are regulated during sciatic nerve regeneration. For this purpose, cDNA libraries were constructed from either the nerve segment distal to the crush site or the corresponding contralateral uninjured nerve of the same animals. These libraries were screened by differential hybridization and several transcriptionally repressed and induced sequences were isolated. Out of 2,000 cDNA clones screened from the distal library, 11 sequences were found to be induced in the distal nerve segment. This set of induced cDNAs included the rat homolog of vimentin, 28 S and 18 S ribosomal RNA species, and two novel sequences. Of 5,000 screened colonies of the contralateral library, 30 colonies contained sequences that were repressed in the distal segment after nerve crush. They were identified as myelin basic protein, myelin Po, a-globin, cytochrome oxidase subunit 1, creatine kinase (muscle type, M) and collagen type I. In addition, five novel sequences were found that were dramatically repressed after sciatic nerve crush. Representative clones were tested by northern blot analysis to study their time course of transcriptional regulation during nerve regeneration. The observed patterns suggest that the regeneration phenomenon shows complex gene regulation in which the nonneuronal cells of the distal segment play an important role. Further characterization of the isolated regulated known and unknown sequences will increase our understanding of the molecular events associated with neuronal regeneration. Key words: regeneration, sciatic nerve injury, cDNA libraries, differential hybridization, transcriptional regulation

INTRODUCTION The sequellae of events which occur distal to an injury to the adult rat sciatic nerve have been well de0 1991 Wiley-Liss, Inc.

scribed (Cajal, 1928; Schwartz, 1987). These include axon breakdown, changes in the permeability of the blood vessels, invasion of macrophages, proliferation of Schwann cells, myelin breakdown, and the phagocytosis of myelin fragments by Schwann cells and macrophages. The distal nerve segment provides an environment which is supportive of the regeneration of the nerve fibers (Cajal, 1928; David and Aguayo, 1981). Some of the molecules which may provide the trophic support for regeneration have been identified. For example, the levels of the NGF mRNA and protein synthesized by the nonneuronal cells of the distal nerve increase markedly after nerve injury, and only decline when axonal regrowth to the muscle is complete (Heumann et al., 1987a). The synthesis of NGF is probably mediated by interleukin- 1 released by the invading, activated macrophages (Lindholm et al., 1987). The latter also secrete apolipoprotein E, which together with apolipoprotein A infiltrating from the blood, play a major role in the storage and reuse of lipid, principally cholesterol, during the nerve degeneration and regeneration (Snipes et al., 1986; Ignatius et al., 1986, 1987; Boyles et al., 1989). Other mRNAs and protein molecules, which increase in amount during regeneration, have been identified, and include the NGF receptor (Heumann et a]., 1987b; Taniuchi et al., 1986), glial derived nexin (Meier et al., 1989), glial maturation factor beta (Bosch et al., 1989), and adipsin (Cook et al., 1987). These proteins are likely to play roles in regeneration although their functions have not been precisely defined. Yet another class of molecules exist which are recognized through changes in their rates of protein synthesis in the distal segment during nerve degeneration or regeneration, but their identities, let alone functions, are unknown (Muller et al., 1986). We have been interested in determining how many of these as yet unknown proteins (genes) are involved in the process of nerve regeneration, and to this end, have used differential hybrid-

Received January 2, 1991; accepted January 17, 1991. Address reprint requests to Dr. Marino De Leon, Neurobiology and Anesthesiology Branch, Building 30, Rm. B-20, NIH-NIDR, Bethesda, MD 20852.

438

De Leon et al.

ization techniques to screen cDNA libraries from crushed and naive sciatic nerve. As reported here, these screens have identified a number of known and unknown cDNA sequences, the expression of which were either induced or repressed after nerve injury.

METHODS Surgery and Animal Care The procedures used in these experiments followed the NIH Guide for the Care and Use of Laboratory Animals at Stanford University. Sprague-Dawley rats [160-200 g, male, (Bantam and Kingman)] were anesthetized prior to surgery with a mixture of ketamine (6 mg/kg, intraperitoneal) and chloral hydrate (30 mg/kg). The sciatic nerves were exposed at the hip level by doing a blunt dissection on both legs of the animal. The left sciatic nerve was crushed using a jeweler’s forceps until the nerve was translucent (15-30 sec). Effectiveness of the crush was confirmed by the absence of muscle twitch after pinching the nerve at the crush site, and the location of the injury was marked with a loose tie. In some experiments the nerve was cut and the proximal and distal nerve segment stumps were reapposed to each other. In experiments where regeneration was not allowed to take place, the nerve was cut and the proximal segment was diverted away from the muscle. Sham operations were performed on the contralateral side and these contralateral nerves as well as both sciatic nerves from a separate group of untreated animals served as control samples. After regeneration had proceeded for the indicated length of times, the animals were euthanized in a CO, atmosphere and the sciatic nerves dissected. Ten millimeter nerve segments just distal to the crush site (for the crushed cDNA library) and a corresponding segment on the contralateral side (for the contralateral cDNA library) were collected. Immediately after dissection the nerve segments were frozen on dry ice and stored at - 80°C. RNA Purification RNA was purified from the sciatic nerve essentially as described by Chomczynski and Sacchi (1987) with the following modifications: The frozen tissues were homogenized with a Polytron (Brinkmann) at 30,000 rpm for a 3 X 5 sec burst in a guanidine isothiocyanate buffer [l ml/g of nerve, 4 M guanidine isothiocyanate, 25 mM sodium citrate (pH 7), 0.5% sarcosyl, and 100 mM 2mercaptoethanol] and the homogenate was centrifuged at 3,000 rpm for 10 rnin at 4°C in an IEC clinical centrifuge. The supernatant was transfered to another tube and the following added sequentially: 2 M sodium citrate, pH 4 (0.1 ml/ml homogenate), water-saturated phenol (1 ml/

ml homogenate), and chloroform-isoamyl alcohol (0.2 ml/ml homogenate, 24: 1 v/v). The mixture was vortexed for 10 sec, cooled on ice for 20 min, and centrifuged at 10,OOOg for 20 rnin at 4°C.The RNA was precipitated by adding one volume of isopropanol and incubation at -20°C for at least 2 hr. The RNA was pelleted by sedimentation at 10,OOOg for 10 min, and the pellet solubilized in 0.3 ml of guanidine-isothiocyanate buffer. The RNA was reprecipitated, pelleted, and dissolved in 50-100 p1 of distilled water. Poly(A+) RNA was prepared by affinity chromatography on oligo(dT)-cellulose (Maniatis et al., 1982). The RNA was quantitated spectrophotometrically and 260/280 ratios better than 1.80 were routinely obtained. The integrity of the RNA was also tested by electrophoresis through ethidium bromide-stained formaldehy de-agarose gels as described below.

Northern Blot Analysis RNA was fractionated by electrophoresis through 1.2% agarose/formaldehyde gels and transferred overnight to Hybond-N membranes (Amersham) in a solution of 20 x SSC, following the manufacturer’s instructions. The nylon filters were baked for 30 min at 80°C, and subjected to UV cross-linking for 4 min on a Spectroline 302 nm UV transilluminator. The filters were then prehybridized for at least 4 hr at 42°C in prehybridization buffer [50% formamide, 5 X SSC (0.75 M NaC1, 0.075 M sodium citrate, pH7.0), 5 X Denhardt’s solution (0.5% Ficoll, 0.5% polyvinylpyrrolidone, 0.5% bovine serum albumin), 0.1% sodium dodecyl sulfate (SDS), and 100 pg/ml heat-denatured salmon sperm DNA]. Filters were hybridized for 48 hr at 42°C in hybridization solution (same as prehybridization solution except 1 X Denhardt’s and 5 ng/ml 32P-labeled cDNA probe). cDNA probes were labeled with [32P]dCTPto a specfic activity of 5 x lo8 to 3 X lo9 c p d p g DNA using the random hexamer procedure (Feinberg and Vogelstein, 1984). After hybridization, filters were washed twice at room temperature ( 3 min each) in 2 X SSC/O.1% SDS followed by two washes at 55°C for 15 rnin in 0.5X SSC/O.1% SDS. The filters were air dried and autoradiography performed (Maniatis et al., 1982). Bound cDNA was quantitated by densitometer scanning (Microscan 1000 densitometer, Technology Resources). Appropriate exposures (in the linear range of the film) were scanned. To remove bound cDNA from the membrane for reprobing, the membranes were boiled in a solution containing 0.5% SDS for 5 min. Complete removal of the cDNA was verified by autoradiography. In some experiments, the cDNA encoding cyclophilin (a gift of Dr. J.G. Sutcliffe, Scripps Clinic, La Jolla CA) was used to quantify the northern blot analysis.

Regulated Genes During Regeneration

Preparation of cDNA Libraries The cDNA libraries were made from 5 pg of poly(A +)mRNA using the Librarian I cDNA kit (Invitrogen). Double-stranded cDNA (ranging from 0.3 to 7 kb) was ligated to BstXI nonpalindromic linkers, and unligated linkers were separated from the cDNA by agarose gel electrophoresis (Maniatis et al., 1982). After ligation into the BstXI site of the CDM8 expression plasmid (Seed, 1987), the plasmids were used to transform P3 E. cafi, and plamid-containing colonies were selected on LBketracycline plates (Maniatis et al., 1982) for 36 hr at 37°C. Screening of Libraries The two sciatic cDNA libraries were screened by differential hybridization. The cDNA clones were grown on LBketracycline plates by incubation for 36 hr at 37°C. Individual colonies were picked and grown for 16 hr at 37°C in 96-well microtiter plates in LB/tetracycline media containing 5% glycerol. The colonies were replica plated on two 12 X 12 cm agar plates using a Multipoint Inoculator (Denley) and grown as before. After replica plating, the master 96-well plates were stored at -20°C. Colonies were transfered in duplicate to 8 X 11.5 cm sheets of Whatman 540 paper. The filters were then placed (colonies up) for 5 min on Whatman 3MM paper saturated with 0.5 M NaOH and dried for 1 hr at 37°C. The filters were washed sequentially with 0.5 M NaOH, 0.5 M Tris-HC1, pH 7.5, and 2 x SSC for 10 min each, followed by 2X SSC for 10 min, rinsed with ethanol, and air dried. Bacterial debris was removed by washing the dried filters in proteinase buffer (50 mM Tris-HC1, pH 7.5, 5 mM EDTA, 0.5% SDS) containing 0.1 mg/ml Proteinase K for 2 hr at 37°C with agitation. Finally, the filters were washed for 5 min each with 2 X SSC, then 95% ethanol, and dried at room temperature. The filters were incubated in 5 ml/filter prehybridization solution (50% formamide, 5X SSPE, 100 pg/ml denatured salmon sperm DNA) for 4 hr at 42°C. Duplicate filters were hybridized with 32P-labeled cDNA made from either purified crushed RNA or contralateral RNA (see below). The filters were washed as described above and subjected to autoradiography .

439

(Promega), and reverse transcriptase 200 U (BRL) were added. After first strand synthesis for 75 min at 37"C, 90 pl of TE (10 mM Tris-HC1, pH 7.5, 1 mM EDTA) and 20 pl of 2 M NaOH were added, followed by an incubation for 1 hr at 37°C. Next, SDS (0.1% final) and denatured salmon sperm DNA (0.5 mg) were added. The labeled cDNA was separated from unincorporated nucleotides by size exclusion chromatography on a 5 ml G-50 Sephadex (Pharmacia) column and the radioactivity in the 0.3 ml fractions measured by scintillation counting. The fractions containing cDNA were pooled, and one volume 20X SSPE, and two volumes formamide were added (final conc: 5 X SSPE, 50% formamide). This mixture was passed over a 2 ml CC31 (Whatman) column. The flow through was collected, and the column washed with 5 X SSPE/5O% formamide/lOO pg/ml denatured salmon sperm DNA, until a total volume of 15 ml was collected. The radioactivity in an aliquot of the sample was measured by scintillation counting, and equal counts from the two reactions were used for hybridizations. Typically, the filters were hybridized with 1-3 X lo6 cpdfilter in a volume of 3 ml/filter, for at least 72 hr at 42°C.

Analysis of the Isolated Clones After rescreening of initially positive clones, plasmid DNA from individual colonies was prepared by the boiling method (Maniatis et al., 1982). All clones were subsequently subjected to cross-hybridizations. Selected clones were sequenced using the dideoxy method (Sanger et al., 1977). Sequence analysis was carried out using the University of Wisconsin Genetics software (Devereux et al., 1984). The FASTA program was used to compare segments of 100 to 200 bp of each cDNA sequence to the GenBank (Bilofsky et a]., 1986) and EMBL (Hamm and Cameron, 1986) databases.

RESULTS Isolation of Regulated Sequences Sequences whose expression is regulated during regeneration were isolated as outlined in Figure 1. Poly(A+) RNA was isolated from the rat sciatic nerve and used to construct two cDNA libraries. The first cDNA library was prepared using RNA from the distal Preparation of cDNA Probes segment of the sciatic nerve, 3 days after a crush injury. 3'P-labeled cDNA was made from total RNA pu- This cDNA library is referred to as the distal library rified from either contralateral or crushed distal nerve. In (DL), and it was constructed to identify sequences whose a total reaction volume of 20 p1, 200 pCi [32P]dCTP(20 expression is induced during nerve regeneration. A secp1 concentrated to 1 p1 by centrifugal lyophilization, ond cDNA library was constructed using RNA from the Amersham), 10 p g total RNA, 10 pg/ml oligo(dT), re- uninjured contralateral nerves of the same pool of aniaction buffer (50 mM Tris-HC1, pH 8.3, 75 mM KC1, 10 mals used for the first library. This contralateral library mM DTT, 3 mM MgCl,), 0.5 mM dATP, 0.5 mM (CL) served for the isolation of sequences whose expresdGTP, 0.5 mM dTTP, 10 pM dCTP, RNasin 20 U sion is repressed during nerve regeneration. Total RNA

440

De Leon et al.

-

:. . . . . . . .Sciatic nerve library (Distal) ............................................... ....................................................

a ’

I

I

Sciatic nerve library (Contraiateral) :

..........................................

+ +

PolyA+ enriched RNA

I

cDNA library

i

Screening of library

1

1 Selection of induced/repressed clones I

+ +

1

Partial sequencing of clones

I

Data bank search

I

Crosshybridization study

1

I

Final list of selected clones

I

Fig. 1. Flow sheet of procedures. The upper part illustrates the tissues used to construct the cDNA libraries. The area enclosed in the rectangle represents a 10 mm segment distal to the crush site (top panel) or a 10 mm nerve segment from a

I

homologous area of the contralateral nerve (lower panel). The lower part of the diagram shows the steps followed to obtain the final list of cDNA clones. See Methods for detail (DRG, dorsal root ganglia).

Regulated Genes During Regeneration TABLE I. Induced Sequences Isolated From the Distal Nerve Library 3 Days After Nerve Crush

Clone CD CD CD CD CD

2 5 6 8 12

Number of copies identified

4 4 1 1 1

TABLE 11. Repressed Sequences Isolated From the Contralateral Nerve Library 3 Days After Nerve Crush

Induction level"

Identification

Clone

++ ++ ++ ++ ++

Vimentin 28 S rRNA Novel sequence 18 S rRNA Novel sequence

SR7 SRlO SR13 SR17 SR18 SR22 SR37 SR39 SR43 SR49 SR58

+ + indicates that the expression of that sequence was induced 2- to 5-fold on the distal side relative to the contralateral level, 3 days after a crush injury.

a

yields from the collected 10 mm segments of sciatic nerve averaged 15-20 Fgkegment, and the poly(A+ ) RNA averaged 2-4% of the total RNA. The isolated mRNA was used to construct cDNA libraries in the CDM8 expression vector. Approximately 50% of the DL colonies and 70% of the CL colonies contained plasmids with cDNA inserts greater than 200 bp. The average size of inserts in both libraries was about 1.2 kb (data not shown). Both libraries were screened by differential hybridization to identify clones containing sequences which were regulated during nerve regeneration. A total of 2,000 colonies were screened from the DL, and 11 colonies were isolated that contained sequences putatively induced during neuronal regeneration. The cDNA inserts in these colonies were partially sequenced, and the sequences were compared to the GenBank and EMBL DNA sequence databases. A summary of the sequences isolated is shown in Table I. Four of the sequences were homologous to vimentin, five were homologous to rRNA, and two were not homologous to any sequences in the database (novel sequences). Cross-hybridization studies were carried out to further confirm the identity of these sequences. The two novel sequences failed to hybridize to each other or to any of the other isolated known sequences. The induction levels were 3- to 5-fold for all sequences mentioned in Table I. A total of 5,000 colonies of the CL library were also screened by differential hybridization. After two rounds of screening, 30 colonies contained sequences whose expression was repressed 3 days after nerve crush. These sequences were analyzed as described above, and the identity of the isolated sequences is shown in Table 11. Several known sequences were isolated including myelin Po, a-globin, myelin basic protein, cytochrome oxidase (subunit I), skeletal muscle creatine kinase (M creatine kinase), and collagen (type al).Also, 5 groups of novel sequences were isolated as determined by crosshybridization studies. The extent of repression of these sequences ranged from 3-fold to more than 10-fold.

441

Number of copies identified 1 1

7 12 1 1 1 1 3 1 1

-

Repression indexa

Identification

++ ++ +++ +++ +++ ++ ++ +++ +++ ++ ++

Novel sequence Novel sequence Novel sequence Myelin P , a-Globin Novel sequence Novel sequence Myelin basic protein Cytochrome oxidase sub. I Creatine kinase Collagen type 1

"+ + indicates that the expression of that sequence was 2- to 5-fold lower on the distal side than the contralateral side, 3 days after nerve ciush. + + + indicates that the expression was greater than 10-fold lower on the distal side relative to the contralateral side.

Northern Blot Analysis of Selected Clones During Sciatic Nerve Regeneration The regulation of some of these sequences was studied by northern blot analysis. RNA was isolated from the distal segments and the contralateral sciatic nerve segments at different days after sciatic nerve crush. The RNA was fractionated by formaldehyde-agarose electrophoresis, transferred to nylon membranes, and subsequently hybridized with the different 32P-labeled sequences. In general, three patterns of expression were observed. Some of the sequences were induced during regeneration, some were repressed, and some showed more complicated patterns of expression. Representative examples from each of these groups will be presented separately. Induced sequences. The first group of sequences was isolated from the distal library, and contained sequences whose expression was induced during nerve regeneration. One example of this group, is the sequence encoding the intermediate filament protein vimentin. This sequence was isolated in four separate colonies, the longest cDNA insert was 1.2 kb. partial sequence comparison between this isolate and the sequence for hamster vimentin is shown in Figure 2. The rat vimentin sequence has not yet been cloned. The total homology over the 76 nucleotides compared is 87%. The homology at the nucleotide level of the coding region is 90%, while the homology in the 3' noncoding region was 82%. The amino acid sequence of the rat and hamster coding regions was 100%. Based on this type of analysis, the isolated sequence represents the rat vimentin homolog. Similar analysis was used in establishing the identity of the other known sequences listed in Tables I and 11. The

442

De Leon et al.

Rat

GTGATCAATGAGACTTCTCAGCACCACGATGACCTTGAATAAAAACTGCACAGGCTCAGTGCAACGGCGCAGTACC

Hamster (exon 9)

GTGATCAATGAAACCTCTCAGCATCATGATGACCTTGAATAAAAATTGCACATACTCTGTGCAACAACGCAGTACC

ll/I0IlIIl ll IIIIIIII ll llllllllllllllllll llllll Ill lllllll lllllllll Nucleotide Homolom Total

87 Yo

Coding region

90 Yo

Non-coding region

82 Yo

Protein Homology

100 Yo

Fig. 2 . Comparison of the DNA sequences of hamster vimentin (exon 9) and the rat vimentin cDNA clone isolated in the present study. The vimentin cDNA clone was isolated from the DL cDNA library, and partially sequenced. The obtained nucleotide sequence was compared with the sequences reported in the GenBank and EMBL databases. Note that the rat vimentin clone shows 100% protein homology to hamster vimentin in this region. longest rat vimentin insert was used to study the time course of expression of the vimentin gene during regeneration. Northern blot analysis indicated that vimentin gene expression was clearly induced on the crushed side relative to the level on the contralateral side by day 6 and remained induced through day 14 (Fig. 3). Quantitation, using scanning densitometry, showed that the level of vimentin mRNA found in the distal segment was induced 2-fold by day 6, and 3.5-fold by day 14 after sciatic nerve crush, compared to the expression in the contralatera1 nerve. Repressed sequences. An alternative expression pattern was observed with sequences isolated from the contralateral library. It was expected that these clones would contain sequences whose expression was repressed during nerve regeneration. The first example of this type of regulation is shown in Figure 3 . The same northern blot used for the analysis of the vimentin insert was hybridized with a 32P-labeled my elin Po sequence isolated from the CL. Myelin P, was the most abundant regulated sequence isolated from the library, and the sequence of several of the cDNAs was 98% homologous, over the 62 bp compared, to the previously reported rat myelin Po sequence (Lemke and Axel, 1985). The one nucleotide change, found in several cDNAs isolated, was located in the 3' noncoding region, and may represent a DNA polymorphism. The longest cDNA insert (1.6 kb) was used for northern blot analysis. In agreement with

previous reports (Trapp et al., 1988), myelin Po expression was repressed within one day after sciatic nerve crush (Fig. 3), and repressed by greater than 90% at days 3 and 6. By day 14, the expression on the distal side was 10% of expression on the contralateral side. The second most abundant sequence isolated from the contralateral library (SR13) was a novel sequence. Seven different copies of this sequence were isolated, ranging in size from 0.3 to 1.8 kb. The regulation of this sequence is shown in Figure 4. The SR13 probe recognized an RNA with an size of 1.8 kb, and expression was decreased by day one (40% of contralateral), and remained repressed through day 6 (less than 5% of contralateral). The expression pattern was similar to that of the myelin Po sequence, although the level of repression at day 1 was not as pronounced as for myelin Po. The last example of a sequence that was repressed during nerve regeneration was identified as skeletal muscle creatine kinase. One copy of this sequence, with a size of 300 bp, was isolated from the contralateral library. The isolated partial cDNA showed 100% homology, over 150 nucleotides compared, to the rat skeletal muscle creatine kinase. The same sequence showed less than 60% homology to the rat brain creatine kinase gene, over the same 150 bp, thus confirming that the isolated sequence corresponded to the rat muscle creatine kinase mRNA. The regulation of this sequence is shown in Figure 5 . The 1.4 kb creatine kinase mRNA was completely

Regulated Genes During Regeneration

3

1

N

D

D

6

C

D

443

14

C

D

C

+- Vimentin

4-

Po

Fig. 3. Comparison of the pattern of mRNA expression of tissues at the specified day (1, 3, 6, and 14), after unilateral vimentin and Po during sciatic nerve regeneration. Vimentin crush as described in Methods. The integrity and equivalency and Po cDNAs were isolated as described in Methods. The of RNA loading was verified by staining the gel with ethidium vimentin and Po cDNAs hybridized with RNA species of 2.0 bromide, and also by reprobing the filter with the cyclophilin and 1.9, kb respectively. Each lane of a formaldehyde-agarose cDNA clone. N, naive nerve; D, distal nerve segment; C, gel was loaded with 5 pg of total RNA purified from nerve contralateral nerve segment.

3

1

N D

C D

6

C D

C

4-SR 13

Fig. 4. Expression of SR13 mRNA during the first week after sciatic nerve crush. The conditions are similar to those described in Figure 3. Five micrograms of total RNA was loaded in each lane. repressed at days 3 and 6 (less than 5% of contralateral). Figure 5 also shows that this down regulation was associated with regeneration, since by day 40 the expression level of CK mRNA was the equal for the crushed, regenerated side, and the contralateral side (40R). Furthermore, if the nerve was cut and not allowed to regenerate, the repression of CK mRNA was still observed 40 days after the cut injury (40D). Figure 5 also shows that the most abundant cytochrome oxidase mRNA species was not regulated during regeneration, however, a mRNA of higher molecular weight was repressed at day 3 after sciatic nerve crush (data not shown). Whether this represents an alternatively spliced mRNA or a cross-hybridizing mRNA is under investigation. Sequences showing both induction and repression. The last type of gene regulation observed during sciatic nerve regeneration showed a complex mixture of the two patterns described above. These type of se-

quences were isolated from both libraries, and their expression pattern was consistent with the library from which they were isolated. Two examples are shown in Figure 6. The first sequence is a novel sequence (CD 12) and was isolated from the DL. One copy of this sequence was isolated with a size of 0.5 kb. The CD 12 insert hybridized to a single mRNA species with a molecular weight of approximately 0.7 kb. At days 1 through 6 the expression was induced (approximately 2-fold) in the distal side relative to the contralateral side. However, by day 14 after sciatic nerve crush, the expression was repressed on the distal side (5% of the contralateral level). A further time point at 40 days after sciatic nerve crush showed that the expression in the distal side was less than 5% of the contralateral level (data not shown). The same figure shows the regulation of the novel sequence SR7, isolated from the CL library. The 0.3 kb cDNA insert was used to probe the northern blots and hybridized to a single mRNA species with an apparent molecular weight of 0 . 8 kb (Fig. 6). At day 1, the expression was induced, at day 3 the expression was repressed, at day 6 the expression was induced, and at day 14 the expression was repressed again. Several repeats of these experiments confirmed these results, and exclude possible variations between animals, or amounts of RNA used per lane as reasons for the oscillations in gene expression.

Contralateral Effects In the previous section, the expression in the distal segment of the nerve, was compared to the expression in the contralateral side. It became apparent however, that

444

De Leon et al.

1 D

N

3 D

C

4OR D C

6 D C

40D D C 4- CK 4- co

Fig. 5. Expression of the mRNAs encoding creatine kinase (CK) and cytochrome oxidase (CO). Conditions were similar to those described in Figure 3 . Each lane of the gel was loaded with 5 pg of RNA, purified from nerve segments at different days after nerve crush (1, 3, 6, and 40R) or cut nerve (40D). 40R, nerve was crushed and allowed to regenerate for 40 days; 40D, nerve was cut, and not allowed to regenerate for 40 days after the cut.

N

1

3

D C

D C

6

D

14

C

D

C +CDI

+SR

12

7

Fig. 6. Northern blots demonstrating the CD 12 and SR7 mRNA regulation after sciatic nerve crush. Each lane was loaded with 5 pg of total RNA, and the conditions were the same as those described for Figure 3 . in some instances, gene expression in the contralateral sciatic nerve was influenced by the sciatic nerve crush to the opposite side (contralateral effect). The contralateral effect has been described in other regenerating systems (Rotshenker, 1988). In order to describe this phenomenon in rat sciatic nerve regeneration, the amount of gene expression on the contralateral side was compared to the expression in the sciatic nerve of naive, unoperated animals. Values were corrected for amounts of RNA in each lane by comparison with the hybridization to a control mRNA. Two examples of the contralateral effect are shown in Figure 7. The first example, myelin Po, showed similar levels of expression between the contralateral side and sciatic nerve from naive animals at day 3, but expression was slightly repressed on the contralateral side (90% of naive levels) at 6 and 14 days after sciatic nerve crush. A more dramatic example of the contralatera1 effect was seen with the SR7 cDNA. At days 1 through 6, the contralateral level was 20% of the naive level, and only by day 14 had the contralateral side returned to 80% of the naive levels. Examination of the

regulation of several other sequences indicated that the contralateral effect was not always seen. The expression of the mRNA for myelin P,,, SR13, vimentin, and creatine kinase showed relatively little contralateral regulation, while CD 12 and SR7 showed more pronounced contralateral changes. Although this set of experiments cannot distinguish between systemic and contralateral effects, it is clear that there is another level of regulation of gene expression from that described in the previous section.

DISCUSSION This study reports the construction and screening of two rat sciatic cDNA libraries in order to isolate known and unknown sequences whose expression are regulated during the process of nerve degeneration and regeneration. The libraries were made from RNA from either the distal segment of crushed sciatic nerves, or from RNA from the contralateral, uninjured sciatic nerves. Differential hybridization was used to identify regulated sequences and both repressed and induced sequences were

Regulated Genes During Regeneration

445

h

a,

.-> m c

I

0 Y

a,

.->

-m Y

O800 1

a, L

E

> a, a,

Q Z

LI

E

m

L

a,

i ,

m m i

u

c 0

u

0

I 0

10

20

Days a f t e r s c i a t i c n e r v e c r u s h

Fig. 7. Comparison of the mRNA expression of P , and SR7 RNAs in the contralateral nerves, compared to that of naive, uninjured nerves. The northern blots were performed as described in Figure 3, and the autoradiographs were scanned with a densitometer. isolated 3 days after sciatic nerve crush. This particular time point was chosen because by day 3, the Schwann cells in the distal segment have already begun to divide, and increased their synthesis of both DNA and RNA (Oderfield-Novak and Niemierko, 1969). The differential-screening approach proved to be quite sensitive, and was able to identify sequences with small changes in gene expression (2- to 3-fold, Fig. 3). However, the methods as applied in this paper preferentially identify sequences from relatively abundant mRNA species, because these sequences give the strongest signal after hybridization. Therefore, the identified sequences presented in this study do not represent the complete set of genes which are regulated during regeneration. However, these initial results give some idea of the complexity of the events involved in nerve regeneration. A large screening of more colonies, as well as changes in the screening procedures would allow the isolation of relatively rare regulated sequences. This approach provides complementary data to studies that have used polyacrylamide gel electrophoresis to identify proteins whose rate of synthesis are regulated after sciatic nerve crush (Muller et al., 1985; Skene, 1989; Rotshenker et al., 1990). Interestingly, only four sequences out of 2,000 screened clones from the DL were found to be specifi-

cally upregulated in the distal segment of the sciatic nerve (Table I). The induced sequences account, therefore, for less than 1% of all sequences. This observation can be explained in several ways, First, the results indicate that there are only a few genes induced in the distal segment, 3 days after sciatic nerve crush. This interpretation is in line with the findings of other investigators who noted that only a few proteins increased their rates of synthesis in the distal segment of the sciatic nerve, after nerve crush (Skene and Shooter, 1983; Muller et al., 1986). An alternative possibility is that the majority of induced genes are of such low abundance, that they are not detectable by either approach. The most abundant induced mRNA sequence was identified as the rat homolog of vimentin. Vimentin is an intermediate filament protein found abundantly in central and peripheral nervous systems (Dahl and Bignami, 1985). These changes in vimentin mRNA expression, 2to 3-fold maximal induction 6 days after crush, are consistent with reports documenting the increase in the amount of vimentin protein present during regeneration and development (Cochard and Paulin, 1984; Neuberger and Cornbrooks, 1989). Since Schwann cells are known to synthesize vimentin (Neuberger and Cornbrooks, 1989), they are probably responsible for the changes seen in vimentin gene expression during sciatic nerve

446

De Leon et al.

regeneration. Several lines of evidence support this hypothesis. First, vimentin shows a very strong signal in northern blots of RNA extracted from an immortalized Schwann cell line (L. Bolin, unpublished data). Second, vimentin immunoreactivity is increased in Schwann cells of the distal segment of the rat sciatic nerve during the first 2 weeks after sciatic nerve crush. Moreover, vimentin is the most abundant intermediate filament protein observed during the whole regeneration period (Neuberger and Cornbrooks, 1989). The increase of vimentin immunoreactivity in the distal segment is triggered in the Schwann cells by the loss of axonal contact produced by axonal degeneration, and vimentin immunoreactivity returns to normal at the beginning of muscle reinnervation. The rat optic nerve also shows an increase in the amount of vimentin protein (up to 4-fold) after nerve lesion, but contrary to what is observed in the sciatic nerve, the higher levels of vimentin are maintained even 6 months after the initial injury (Dahl et al., 1982; Politis and Houle, 198.5). During the development of the central nervous system, vimentin is very abundant in embryonic and newborn tissues but during maturation the level of vimentin declines until it reaches a basal level of adulthood. It is not clear what function vimentin may play during development and regeneration; however, the fact that its developmental expression is recapitulated during regeneration suggests an important role that needs to be examined. Interestingly, the synthesis of glial fibrillary acidic protein (GFAP), another intermediate filament protein present in the Schwann cells, is dramatically repressed in the distal segment after nerve crush (Neuberger and Cornbrooks, 1989). By the onset of reinnervation the synthesis of GFAP increases in contrast to that of vimentin. Several induced sequences isolated from the distal library correspond to the ribosomal RNA genes. By in situ hybridization analysis, it was shown that the rRNA genes are regulated during the reinnervation of denervated neuropil of the dentate gyrus (Phillips et al., 1987), and a related phenomena may be occurring in the regenerating sciatic nerve. However, the isolation of these sequences may be an artifact of the screening procedure, and in situ hybridization analysis is needed to resolve this issue. Two unknown sequences were isolated from the DL library (Table I). Although both sequences are induced at day 3 as anticipated from the screening, the regulation of one of them (CD 12) was more complex (Fig. 6). Although, CD 12 was induced roughly 3-fold, compared to the contralateral nerve, from day 1 through day 6, its expression was repressed several fold by day 14, and by day 40 the expression was completely repressed (> SO fold). Since reinnervation occurs by day 40, the repression of this gene after early induction is quite striking.

Perhaps some irreversible step occurs that changes the expression of this gene during regeneration, such that its expression can no longer return to naive levels. The cDNA for apolipoprotein E was not isolated in this initial screen of the DL. The synthesis of the apolipoprotein E protein is markedly up-regulated during nerve regeneration (Ignatius et al., 1986; Muller et al., 1986). To test whether this regulation occurs at the mRNA level, northern blot analysis of the expression of apolipoprotein E was studied. The mRNA for this protein was induced by day 6, but not at day 3 , explaining why the apolipoprotein E sequence was not detected in the library. The contralateral library was screened to isolate sequences whose expression was repressed during regeneration. Approximately 1% of the CL sequences were repressed 3 days after sciatic nerve crush. This frequency is similar to the frequency of induced sequences isolated from the DL. In contrast to the induced sequences, the repressed sequences showed more pronounced changes in gene regulation. Two of the most frequently isolated sequences were cDNAs for myelin Po and myelin basic protein (MBP) (Table 11). The expression of these genes is dramatically down-regulated during degeneration of axons and their myelin sheaths, and our results are in agreement with previous reports (Trapp et al., 1988; Gupta et al., 1988) that the regulation of this repression occurs at the mRNA level. Schwann cells normally synthesize Po and MBP (and other proteins associated with myelin) in their role of maintaining the integrity of the myelin sheath. However, after nerve crush the Schwann cells stop synthesizing myelin and those proteins associated with it, and proliferate (reviewed by Gould et al., 1982). The next most abundant sequence isolated was SR13. Its expression is dramatically repressed as a result of the crush injury (Fig. 4). The expression of this gene was essentially zero by day 3 after crush, resembling the dramatic regulation shown by Po except that Po repression was observed earlier (by day 1) than SR13 (by day 3). SR13 hybridized to a 1.8 kb mRNA species, and represents an unknown sequence that is expressed at high levels in the naive rat sciatic nerve. We are presently further characterizing this cDNA in order to determine its function. Surprisingly, we found in the CL library a cDNA with 100% homology (over 150 nucleotides) to the gene encoding the muscle type creatine kinase. Northern blot experiments verified that this sequence was strongly repressed in the sciatic nerve during regeneration (Fig. 5). Creatine kinase is an important enzyme in the metabolism of muscle cells and is encoded by two different genes for its muscle (M) or brain (B) subunit. This protein comprises three isozymes (MM, MB, and BB) and it is controversial as to whether the muscle type creatine

Regulated Genes During Regeneration

kinase (MM) is completely muscle specific or is also expressed in the brain. Recently, Hamburg et al. (1990) used the polymerase chain reaction to detect creatine kinase M mRNA in the adult brain. The transcript was also found by in situ hybridization, but not by northern blot analysis. Thus the muscle creatine kinase gene is expressed at low levels in the brain. In contrast, we detected relatively high levels of M creatine kinase mRNA by northern blot analysis in the sciatic nerve. Although the amount of creatine kinase M mRNA was initially decreased after nerve crush, it returned to normal levels by day 40, more than 2 weeks after the nerve reinnervates the muscle. When the sciatic nerve was cut, to prevent regeneration, creatine kinase mRNA expression was still repressed at day 40 (Fig. 5, 40D). These observations correlate well with the pattern of expression of creatine kinase M during myogenesis. Creatine kinase RNA is not expressed in myoblasts at the time when they are undifferentiated and are sill proliferating. However, both the RNA and protein level of creatine kinase M increase when myoblast fusion occurs (Trask et al., 1988). Studies with the BC3Hl muscle cell line showed that the expression of creatine kinase M mRNA increased several hundred fold in tissue culture conditions that stimulate differentiation and cessation of proliferation (Spizz et al., 1986). However, when these differentiated, quiescent cells were stimulated to divide with fibroblast growth factor (FGF) or media containing 20% serum, the expression of creatine kinase M was repressed. It is intriguing that during sciatic nerve regeneration, the repression of creatine kinase parallels the initial proliferation of Schwann cells, followed by their later differentiation. Schwann cells may use creatine kinase M during normal metabolism, but then switch to a different energy pathway during proliferation. The function of a-globin, cytochrome, oxidase subunit 1, and collagen type 1, and the four unknown sequences including that for SR7, whose expression oscillates during regeneration, remains to be determined. Some of these transcripts may have been isolated from surrounding hematopoietic cells. The induction or repression during neuronal regeneration of the specific sequences reported here was assessed by the comparison of the crushed and uncrushed nerves of the same animals. It is clear, however, that there is a second level of regulation operating, when the expression is compared between operated and unoperated, naive animals. This effect can be small, as is shown in Figure 7, for genes such as myelin Po,or large, as observed for genes such as SR7. It has been previously shown, that the sciatic nerve lesion produces changes in the contralateral, uninjured nerve that include axonal sprouting (Rotshenker, 1988), neuronal chromatolysis (Watson, 1965), changes in protein metabolism (Me-

447

nendez and Cubas, 1990), and incorporation of [3H]~ridine into RNA (Gunning et al., 1977; Kaye et al., 1977). Several hypotheses have been suggested to explain these observations including transneuronal electrical activity, the release and trophic action of growth factors or systemic injury factors, and changes in the quality and quantity of the axonal transported material (Tamaki, 1936; Theiler and McClure, 1978; Levine et al., 1985; Rotshenker, 1988). Whatever the explanation, it is of interest that the time course of the effects reported here parallel the time course of neuronal degeneration and regeneration, suggesting that they are specific to the injured and uninjured nerves. Finally, it is worth noting that 13 out of the 41 sequences examined in this work represent unknown sequences, corresponding to as yet unknown genes which may play a role in neuronal degeneration and regeneration.

ACKNOWLEDGMENTS This work was supported by grants from NINDS (NS04270), the American Cancer Society (BC6791), the Juvenile Diabetes Foundation International, and the Isabelle M. Niemela Trust. M.D.L. and A.W. were supported by NIH-NRSA fellowships (GM11239, MRC, and NS08443, respectively). U.S. was supported by Geigy-Jubilaeumsstiftung and the Swiss National Science Foundation.

REFERENCES Bilofsky HS, Burks C, Fickett JW, Goad WB, Lewitter FI, Rindone WP, Swindell CD, Tung CS (1986): The GenBank genetic sequence databank. Nucl Acids Res 14:1-4. Bosch EP, Zhong W, Lirn R (1989): Axonal signals regulate expression of glial maturation factor-beta in Schwann cells: An irnmunohistochemical study of injured sciatic nerves and cultured Schwann cells. J Neurosci 9:3690-3698. Boyles JK, Zoellner CD, Anderson LJ, Kosik LM, Pitas RE, Weisgraber KH, Hui DY, Mahley RW, Gebicke-Haerter PJ, Ignatius MJ, Shooter EM (1989): A role for apolipoprotein E, apolipoprotein A-1, and low density lipoprotein receptors in cholesterol transport during regeneration and remyelination of the rat sciatic nerve. J Clin Invest 83:1015-1031. Cajal Y. Ram6n (1928): In May RM (ed): “Degeneration and Regeneration of the Nervous System. ” Oxford: Oxford University Press. Chomczynski P, Sacchi N (1987): Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroformextraction. Anal Biochem 162:156-159. Cochard P, Paulin D (1984): Initial expression of neurofilaments and vimentin in the central and peripheral nervous system of the mouse embryo in vivo. J Neurosci 4:2080-2094. Cook KS, Min HY, Johnson D, Chaplinsky RJ, Flier JS, Hunt CR, Spiegelman BM (1987): Adipsin: A circulating serine protease homolog secreted by adipose tissue and sciatic nerve. Science 237:402-405. Dahl D, Bignami A (1985): Intermediate filaments in nervous tissue. Cell Muscle Motil 675-96.

448

De Leon et al.

Dahl D, Strocchi P, Bignami A (1982): Vimentin in the central nervous system: A study of the mesenchymal-type intermediate filament-protein in wallerian degeneration and in postnatal rat development by two-dimensional gel electrophoresis. Differentiation 22:185-190. David S , Aguayo AJ (1981): Axonal elongation into peripheral nervous system “bridges” after central nervous system injury in adult rats. Science 214:931-933. Devereux J, Haeberli P, Smithies 0 (1984): A comprehensive set of sequence analysis programs for the VAX. Nucl Acids Res 12: 387-392. Feinberg AP, Vogelstein B (1984): A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 137:266-267. Gould MR, Matsumoto D, Mattingly G (1982): In Lajtha A (ed): “The Schwann Cell. Handbook of Neurochemistry,” Vol. 1. New York: Plenum Press, pp 397-414. Gunning PW, Kaye PL, Austin L (1977): In vivo synthesis of rapidlylabelled RNA within the rat nodose ganglia after axotomy. J Neurochem 28: 1245-1248. Gupta S , Poduslo JF, Mezei C (1988): Temporal changes in Po and MBP gene expression after crush-injury of the adult peripheral nerve. Mol. Brain Res. 4:133-141. Hamburg RJ, Friedman DL, Olson EN, Ma TS, CortCz MD, Goodman C, Puleo PR, Penyman B (1990): Muscle creatine kinase isoenzyme expression in adult human Brain. J Bio Chem 265: 6403 -6409. Hamm GH, Cameron GN (1986): The EMBL data library. Nucl Acids Res 14:5-10. Heumann R, Korsching S, Bandtlow C, Thoenen H (1987a): Changes of nerve growth factor synthesis in non-neuronal cells in response to sciatic nerve transection. J Cell Biol 104:16231631. Heumann R, Lindholm D, Bantdlow C, Meyer M, Radeke MJ, Misko T, Shooter EM, Thoenen H (1987b): Differential regulation of mRNA encoding nerve growth factor and its receptor in rat sciatic nerve during development, degeneration and regeneration: roles of macrophages. Proc Natl Acad Sci USA 84:87358739. Ignatius MJ, Gebicke-Haerter J , Skene JHP, Schilling KH, Weisgraber KH, Mahley RW, Shooter EM (1986): Expression of apolipoprotein E. during nerve degeneration and regeneration. Proc Natl Acad Sci USA 83:1125-1129. Ignatius MJ, Shooter EM, Pitas RE, Mahley RW (1987): Lipoprotein uptake by neuronal growth cones in vitro. Science 236:959962. Kaye PLP, Gunning W, Austin L (1977): In vivo synthesis of stable RNA within the rat nodose ganglia following vagotomy. J Neurochem 28: 1241-1243. Lemke G , Axel R (1985): Isolation and sequence of a cDNA encoding the major structural protein of peripheral myelin. Cell 40:501508. Levine JD, Dardick SJ, Basbaurn AI, Scipio E (1985): Reflex Neurogenic inflammation 1. Contribution of the peripheral nervous system to spatially remote inflammatory responses that follow injury. J Neurosci 5: 1380-1386. Lindholm D, Heumann R, Meyer M, Thoenen H (1987): Interleukin-I regulates synthesis of nerve growth factor in non-neuronal cells of rat sciatic nerve. Nature (London) 330:658-659. Maniatis T, Fritsch EF, Sambrook J (1982): “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Meier R, Spreyer P, Ortmann R, Hare1 A, Monard D (1989): Induction of glia-derived nexin after lesion of a peripheral nerve. Nature (London) 342548350.

Menendez JA, Cubas SC (1990): Changes in contralateral protein metabolism following unilateral sciatic nerve section. J Neurobiol 21:303-3 12. Muller HW, Gebicke-Harter PJ, Hangen DH, Shooter EM (1985): A specific 37,000-dalton protein that accumulates in regenerating but not in nonregenerating mammalian nerves. Science 228: 499-501. Muller HW, Ignatius MJ, Hangen DH, Shooter EM (1986): Expression of specific sheath cell proteins during peripheral nerve regeneration in mammals. J Cell Biol 102:393-402. Neuberger TJ, Cornbrooks CJ (1989): Transient modulation of Schwann cell antigens after peripheral nerve transection and subsequent regeneration. J Neurocytol 18:695-7 10. Oderfeld-Nowak B, Niernierko S (1969): Synthesis of nucleic acids in the Schwann cells as the early cellular response to nerve injury. J Neurochem 16:235-248. Phillips LL, Nostrandt SJ, Chikaraishi DM, Steward 0 (1987): Increases in ribosomal RNA within the denervated neuropil of the dentate gyrus during reinnervation: evaluation by in situ hybridization using DNA probes complementary to ribosomal RNA. Mol Brain Res 2:251-261. Politis M, Houle JD (1985) Effect of cytosine arabinofuranoside (AracC) on reactive gl osis in vivo. An immunohistochemical and morphometric study. Brain Res 328:2Y 1-300. Rotshenker S (1988): Multiple Modes and sites for the induction of axonal growth. TINS I1:363-366. Rotshenker S , Reichert F, Shooter EM (1990): Lesion-induced synthesis and secretion of proteins by nonneuronal cells resident in frog peripheral nerve. Proc Natl Acad Sci USA 87: 1144-1 148. Sanger F, Nicklen S , Coulson AR (1977): DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463 -5467. Schwartz M (1987): Molecular and cellular aspects of nerve regeneration. CRC Crit Rev Biochem 22:89-110. Seed B (1987): An LFA-3 cDNA encodes a phospholipid-linked membrane protein homologous to its receptor CD2. Nature (London) 3292340-842. Skene JHP (1989): Axonal growth associated proteins. Annu Rev Neurosci 12:127-156. Skene JHP, Shooter EM (1983): Denervated sheath cells secrete a new protein after nerve injury. Proc Natl Acad Sci USA 80:41694173. Snipes GJ, McGuire CB, Norden JJ, Freeman JA (1986): Nerve injury stimulates the secretion of apolipoprotein E by non-neuronal cells. Proc Natl Acad Sci USA 83:1130-1134. Spizz G, Roman D, Strauss A, Olson EN (1986): Serum and fibroblast growth factor inhibit myogenic differentiation through a mechanism dependent on protein synthesis and independent cell proliferation. J Biol Chem 261:9483-9488. Tamaki K (1936): Further studies on the effect of section of one peroneal nerve of the albino rat on the intact nerve of the opposite side. J Comp Neurol 64:437-448. Taniuchi MH, Clark HB, Johnson EM Jr. (1986): Induction of nerve growth factor receptor in Schwann cells after axotomy. Proc Natl Acad Sci USA 83:4094-4098. Theiler RF, McClure WO (1978): Rapid axoplamic transport of proteins in regenerating sensory fibers. J Neurochem 3 1:433-447. Trapp BD, Hauer P, Lemke G (1988): Axonal regulation of myelin protein mRNA levels in actively myelinating Schwann cells. J Neurosci 8:3515-3521. Trask RV, Strauss AW, Billadello JJ (1988): Developmental regulation and tissue-specific expression of the human muscle creatine kinase gene. J Biol Chem 263:17142-17149. Watson WE (1965): An autoradiographic study of the incorporation of nucleic-acid precursors by neurons and glial during nerve regeneration. J Physiol 180:741-775.