Phytochemistry 99 (2014) 44–51

Contents lists available at ScienceDirect

Phytochemistry journal homepage: www.elsevier.com/locate/phytochem

Identification of UGT84A13 as a candidate enzyme for the first committed step of gallotannin biosynthesis in pedunculate oak (Quercus robur) Juliane Mittasch a, Christoph Böttcher b, Nadezhda Frolova a, Markus Bönn c,d, Carsten Milkowski a,⇑ a

Interdisciplinary Center for Crop Plant Research, Martin-Luther University Halle-Wittenberg, Hoher Weg 8, D-06120 Halle, Germany Department of Stress and Developmental Biology, Leibniz Institute of Plant Biochemistry, Weinberg 3, D-06120 Halle, Germany UFZ – Helmholtz Centre for Environmental Research, Department of Soil Ecology, Theodor-Lieser-Str. 4, 06120 Halle, Germany d Institute of Computer Science, Martin-Luther University Halle-Wittenberg, Von-Seckendorff-Platz 1, 06120 Halle, Germany b c

a r t i c l e

i n f o

Article history: Received 5 September 2013 Received in revised form 5 November 2013 Available online 9 January 2014 Keywords: Quercus robur Fagaceae Gallotannins Glucosyltransferase Substrate specificity

a b s t r a c t A cDNA encoding the ester-forming hydroxybenzoic acid glucosyltransferase UGT84A13 was isolated from a cDNA library of Quercus robur swelling buds and young leaves. The enzyme displayed high sequence identity to resveratrol/hydroxycinnamate and hydroxybenzoate/hydroxycinnamate glucosyltransferases from Vitis species and clustered to the phylogenetic group L of plant glucosyltransferases, mainly involved in the formation of 1-O-b-D-glucose esters. In silico transcriptome analysis confirmed expression of UGT84A13 in Quercus tissues which were previously shown to exhibit UDP-glucose:gallic acid glucosyltransferase activity. UGT84A13 was functionally expressed in Escherichia coli as N-terminal His-tagged protein. In vitro kinetic measurements with the purified recombinant enzyme revealed a clear preference for hydroxybenzoic acids as glucosyl acceptor in comparison to hydroxycinnamic acids. Of the preferred in vitro substrates, protocatechuic, vanillic and gallic acid, only the latter and its corresponding 1-O-ß-D-glucose ester were found to be accumulated in young oak leaves. This indicates that in planta UGT84A13 catalyzes the formation of , 1-O-galloyl-ß-D-glucose, the first committed step of gallotannin biosynthesis. Ó 2013 Elsevier Ltd. All rights reserved.

Introduction Hydrolyzable tannins (HTs), also denoted as gallotannins, are polyphenolic compounds, which accumulate in a wide range of dicotyledonous plants. As potent protein-denaturing agents and antioxidants, as well as antimicrobial, antiviral and antitumor substances, HTs have been widely used (reviewed by Gross et al., 1999). In planta, HTs form part of the chemical defense against pathogens and herbivors (Beart et al., 1985; Scalbert, 1991; Iason, 2005). HTs are characterized by a common ester structure composed of gallic acid and a polyol, mostly b-D-glucose (Freudenberg, 1920). Besides simple galloylglucoses (mono- to penta-O-galloyl-ß-D-glucose), HTs include the groups of complex gallotannins characterized by depsidic meta-digalloyl moieties, and ellagitannins formed by oxidative linkage of adjacent galloyl groups. By further coupling, substitution and oligomerization reactions plants synthesize a large array of diverse HTs, which accumulate in speciesand organ-specific patterns (Niemetz and Gross, 2005). ⇑ Corresponding author. Tel.: +49 (0)345 55 22644; fax: +49 (0)345 55 27531. E-mail address: [email protected] (C. Milkowski). 0031-9422/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.phytochem.2013.11.023

The biochemistry of HT formation was elucidated by enzymatic studies with protein extracts from HT-producing plants like pedunculate oak (Quercus robur), northern red oak (Quercus rubra) or staghorn sumach (Rhus typhina) (Gross, 1999; Grundhöfer et al., 2001). Biosynthesis of HTs starts with the formation of 1-O-galloylß-D-glucose (b-glucogallin) from UDP-glucose and gallic acid. By a series of acyltransfer reactions, 1-O-galloyl-ß-D-glucose is then successively converted to 1,2,3,4,6-penta-O-galloyl-ß-D-glucose (pentaGG). Remarkably, the energy-rich b-acetal ester 1-O-galloyl-ß-D-glucose serves as activated acyl donor as well as acyl acceptor in gallotannin biosynthesis. In this regard, HT biosynthesis resembles the formation of acyl glucoses in wild tomato (Li et al., 1999) and of sinapate esters in Brassicaceae (Milkowski et al., 2004), which also utilize 1-O-esters of ß-D-glucose. Moreover, recent studies provided evidence of 1-O-galloyl-ß-D-glucose as acyl donor for the galloylation of proanthocyanidins in grapevine (Vitis vinifera) (Khater et al., 2012) and of catechin in the tea plant (Camellia sinensis) (Liu et al., 2012). Given the pivotal role of 1-O-galloyl-ß-D-glucose in the biosynthesis of HTs and other galloylated compounds, the interest in identification of UDP-glucose-dependent glycosyltransferases (UGTs), which catalyze the formation of 1-O-galloyl-ß-D-glucose

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51

(EC 2.4.1.136) has rapidly grown. Early enzymatic studies described the formation of 1-O-galloyl-ß-D-glucose from UDP-glucose and gallic acid by leaf extracts from Q. robur (Gross, 1982) and detected an UGT activity in leaves of Q. rubra that converted several hydroxybenzoic (HBA) and hydroxycinnamic acids (HCA) into the related 1-O-esters of ß-D-glucose (Gross, 1983). Recently, the advances in transcriptome analysis combined with the sequence information available on the UGT enzyme family produced evidence for candidate genes in several crop plants. In pomegranate (Punica granatum) gene expression analysis identified putative UGT sequences whose expression corresponded to HT accumulation (Ono et al., 2012). This led to speculations about a potential role of the encoded enzymes as UDP-glucose:gallic acid glucosyltransferases. From grapevine, three UGTs have been described which nonspecifically catalyzed the formation of 1-O-ß-D-glucose esters with HBAs and HCAs (Khater et al., 2012). The authors suggest that these UGTs could be involved in planta in the synthesis of 1-O-galloyl-ß-D-glucose, the predicted acyl donor for the galloylation of proanthocyanidins. From the tea plant, enzymatic studies revealed an UDP-glucose:gallic acid glucosyltransferase activity, which provides 1-O-galloyl-ß-D-glucose as the acyl donor for catechin galloylation (Liu et al., 2012). Here, we describe the identification of a gene from pedunculate oak (Q. robur) that encodes the glucosyltransferase UGT84A13. In vitro assays confirmed that UGT84A13 catalyzed preferentially the formation of 1-O-ß-D-glucose esters with several HBAs including gallic acid, the phenolic constituent of gallotannins, which represents an abundant metabolite within the leaf metabolome of Q. robur. In silico transcript analysis revealed expression of UGT84A13 in planta.

Results and discussion Cloning of UGT84A13 from Q. robur and heterologous expression The enzyme UDP-glucose:gallic acid glucosyltransferase converts gallic acid into the corresponding b-acetal ester 1-O-galloylß-D-glucose by transferring the glucosyl moiety from UDP-glucose to the carboxyl group of the acid. Within the family 1 of UGTs, this specificity of ester formation is related to phylogenetic group L, whereas the capacity to form O-glucosides is distributed among the other phylogenetic UGT groups (Ross et al., 2001; Li et al., 2001). Accordingly, to isolate candidate cDNAs for UDP-glucose:gallic acid glucosyltransferase a targeted approach was used aiming at the identification of abundant group L UGTs from HTproducing oak tissues followed by heterologous expression and in vitro characterization of the encoded enzymes. Swelling buds and young leaves of Q. robur, described as a rich source for HT biosynthetic enzymes (Grundhöfer et al., 2001), were used to generate a plasmid-based cDNA library of about 900,000 clones. From this library, 30 -sequences of potential UGT reading frames were amplified by PCR with degenerate primers derived from the highly conserved THCGWN peptide motif. This peptide motif is part of the plant secondary product glycosyltransferase (PSPG) box, the UGT signature sequence, which forms the binding site for the activated nucleotide sugar in the mature enzyme (Hughes and Hughes, 1994). To increase the specificity of the approach, PCR-amplification was split into eight reactions. Each reaction was performed with a low degenerate forward primer against the THCGWN motif in combination with a specific reversed primer recognizing 30 -flanking vector sequences (for details see Section ‘‘cDNA library construction and isolation of UGT sequences’’). Amplicons generated by individual PCR-reactions were pooled and cloned into pGEMTeasy plasmid vector followed by transformation of Escherichia coli. By colony-PCR using M13 primers that bind to

45

flanking sequences of the cloning vector, 160 clones were tested for cDNA insertions. As a result, 71 clones were found to carry cDNA inserts. Since UDP-glucose:gallic acid glucosyltransferase should be highly expressed in the HT-producing tissues of swelling buds and young leaves, a sample set of about 30% of the cloned cDNA population was subjected to sequence analysis. Sequence comparison to Genbank database (http://www.ncbi.nlm.nih.gov/ genbank/) revealed two candidate cDNAs (QrUGT1, QrUGT2) sharing sequence identities in the range of 70–80% with functionally proven UGTs. A Neighbor Joining analysis showed that QrUGT1 clustered within the phylogenetic group L of UGTs together with ester-forming glucosyltransferases. In contrast, QrUGT2 clustered outside of group L together with UGTs involved in the formation of O-glucosides (Fig. 1). Since this initial classification strongly suggested an ester-forming specificity for the QrUGT1 gene product, a full-length coding sequence was generated for QrUGT1. Therefore, the 50 -coding sequence of QrUGT1 was amplified from the Q. robur cDNA library by a RACE-PCR approach. In silico combination of the overlapping 50 - and 30 -partial QrUGT1-cDNAs revealed a complete open reading frame used to derive specific primers for PCR-amplification of the full length coding sequence of QrUGT1 from the Q. robur cDNA library. The cDNA of QrUGT1 (Genbank accession KF527849) was found to encode a protein of 510 amino acid residues with a predicted molecular mass of 56.554 kDa and a calculated isoelectric point (pI) of 4.88. According to the UGT nomenclature by Mackenzie et al. (1997), the glucosyltransferase QrUGT1 was denominated as UGT84A13. At the amino acid level, UGT84A13 shared sequence identity of 86% with three related enzymes: a resveratrol/hydroxycinnamate glucosyltransferase from Vitis labrusca (VIRSgt, Genbank accession ABH03018; Hall and De Luca, 2007) and two hydroxybenzoate/hydroxycinnamate glucosyltransferases from V. vinifera (VvgGT2, Genbank accession AEW31188; VvgGT3, Genbank accession AEW31189; Khater et al., 2012). With the related enzyme VvgGT1 (Genbank accession AEW31187) UGT84A13 showed a sequence identity of 84%. In silico analyses confirmed the expression of UGT84A13 in planta. Using the facilities of the TrophinOak platform (http:// www.ufz.trophinoak.de), a tblastx search of the UGT84A13 cDNA against the OakContig DF159.1 database (Tarkka et al., 2013) resulted in a single close match. Contig 28422_c0_seq1 was found to cover the full length of the UGT84A13 cDNA and showed 98% identity. A megablast search of the UGT84A13 sequence against the Quercus EST collection of Genbank database revealed 40 ESTs. Electronic Northern Blot analysis showed that 40% of these UGT84A13 ESTs originated from buds, 30% from roots and about 18% from leaves (Supplemental Fig. S1). The results clearly proved expression of UGT84A13 in the oak tissues where previous studies (Gross, 1983) showed UDP-glucose:gallic acid glucosyltransferase activity to be found. For functional assays, UGT84A13 was expressed in E. coli as Nterminal His-tag fusion protein and purified from the bacterial extract by metal affinity chromatography with Ni-NTA (Fig. 2). From 2 l of induced culture, 7.2 mg of recombinant UGT84A13 protein were obtained. Substrate preference of UGT84A13 and kinetic data To verify the catalytic activity of UGT84A13 in vitro, the purified His-tag fusion protein was tested for the ability to catalyze the transfer of the glucosyl moiety from UDP-glucose to several hydroxybenzoic (HBA, C6–C1 compounds) and hydroxycinnamic acids (HCA, C6–C3 compounds). According to the substrate preferences described for the purified UGT activity from Q. robur (Gross, 1983) and related enzymes from grapevine (Khater et al., 2012), gallic acid, protocatechuic acid and vanillic acid (C6–C1), as well as caffeic acid, ferulic acid, and sinapic acid (C6–C3) were tested

46

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51

98

99 97 99 100

81 92

96

100 98 63 72

100

ester formation

glucoside formation

0.1

Fig. 1. Composite tree of UGT sequences showing that UGT84A13 clusters with 1-O-ester-forming UGTs. The tree was derived from a multiple alignment of peptide sequences of about 120 amino acids starting with the conserved HCGWN motif of the PSPG box. The tree was inferred using the Neighbour-Joining method (Saitou and Nei, 1987) implemented in MEGA4 (Tamura et al., 2011). The scale represents 0.1 fixed mutations per site. Bootstrap values (1000 replicates) over 60% are indicated. The dashed line highlights functional diversification of UGTs catalyzing the formation of 1-O-glucose esters or glucosides. The ester-forming UGTs shown belong to the phylogenetic cluster L of UGTs (Ross et al., 2001). Ant5GT(Ph), Petunia hybrida anthocyanin 5-O-GT (BAA89009); Ant5GT(Gh), Glandularia hybrida anthocyanin 5-O-GT (BAA36423); Ant5GT1(Pf), Perilla frutescens anthocyanin 5-O-GT (BAA36421); Fv3GT(Gt), Gentiana triflora anthocyanidin 3-O-GT (Q96493); Fvd3GT(Vv), Vitis vinifera flavonoid 3-O-GT (BAB41026); Fvd3GT(Fi), Forsythia intermedia flavonoid 3-O-GT (AAD21086); Fvd3GT(Pf), Perilla frutescens flavonoid 3-O-GT (BAA19659); QrUGT2, Quercus robur putative UGT; UGT7(Fi), Forsythia intermedia coniferylalcohol GT (BA165909); UGT84A9, Brassica napus sinapic acid 1-O-GT; UGT84A2, Arabidopsis thaliana (At) sinapic acid 1-O-GT; UGT84A1, A3, A4, At hydroxycinnamic acid 1-O-GT; QrUGT1 (UGT84A13), Quercus robur gallic acid 1-O-GT; VvGT1-3, Vitis vinifera hydroxybenzoate/hydroxycinnamate glucosyltransferases (AEW31187, AEW31188, AEW31189). The resveratrol/hydroxycinnamate glucosyltransferase from Vitis labrusca (VIRSgt, ABH03018) was identical with VvGT2 over the sequence considered for this analysis.

as potential glucosyl acceptor. Qualitative analyses of enzymatic reaction mixtures by UPLC/ESI(-)-QTOFMS revealed in all cases formation of a single reaction product whose elemental composition was in accordance with a glucosylated HBA/HCA (Fig. 3A and B). Among them, 1-O-galloyl-ß-D-glucose and 1-O-sinapoyl-ß-D-glucose were identified using authenticated standards. For the remaining products, analysis of the collision-induced dissociation mass spectra obtained from the deprotonated molecular ion indicated the presence of similar characteristic fragment ions as observed for 1-O-galloyl-ß-D-glucose and 1-O-sinapoyl-ß-D-glucose (Fig. 3C). Hence, UGT84A13 converts all tested C6–C1 and C6–C3 phenolic acids into the corresponding 1-O-esters of ß-D-glucose. Specific enzyme activities indicated a clear preference of UGT84A13 for C6–C1 phenolic acids as glucosyl acceptors compared to the C6–C3 phenolic acids (Fig. 4). With regard to sinapic acid, the best C6–C3 substrate tested, UGT84A13 activity was increased by factors of 3.5–5 with all C6–C1 glucosyl acceptors investigated. This clearly distinguished UGT84A13 from the related glucosyltransferases VvGT1-3 from grapevine, which displayed

specific activities in the same range toward protocatechuic, gallic and caffeic acid, accompanied by a relatively high activity toward sinapic acid (Khater et al., 2012). Therefore, by substrate specificity, UGT84A13 was classified as hydroxybenzoic acid UGT. Kinetic measurements showed that the Vmax values of UGT84A13 for the three C6–C1 substrates tested were in the similar range with a slight increase for protocatechuic acid (Table 1). The KM values indicated the highest affinity of UGT84A13 for vanillic acid followed by protocatechuic acid and gallic acid. In summary, the in vitro kinetic data suggested a slight preference of UGT84A13 for protocatechuic acid and vanillic acid to gallic acid. This resembled the catalytic properties of a glucosyltransferase activity purified from leaves of red oak (Gross, 1983; Weisemann et al., 1988). Compared to VvGT1, described as the most efficient gallic acid glucosyltransferase among the three related grapevine enzymes (Khater et al., 2012), in our experiments with UGT84A13 the KM was about 20% lower and the Vmax about fivefold higher with gallic acid (Table 1). This revealed that UGT84A13 was more efficient in the formation of 1-O-galloyl-ß-D-glucose than VvGT1. The KM values

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51

M [kDa]

1

2

3

4

47

sequencing of EST collections from gallotannin-producing tissues should be applied. Experimental Plant material

66.4 55.6

Swelling buds and young leaves were harvested from two individual plants of pedunculate oak (Q. robur) from the natural habitat, immediately frozen in liquid nitrogen and stored at 80 °C. Chemicals

Fig. 2. SDS–PAGE of protein fractions from the purification of His-tagged UGT84A13 expressed in E. coli. Proteins were stained with Coomassie brilliant blue. M, molecular weight marker; lane 1, crude protein extract; lanes 2–4, eluted fractions from affinity column. Protein fraction of lane 3 was used for in vitro characterization of UGT84A13. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

of UGT84A13 obtained with protocatechuic, vanillic and gallic acid (Table 1) were in the range of KM values described for glucosyltransferases from Arabidopsis, which catalyzed the formation of 1-O-ß-D-glucose esters with several C6–C1 phenolic acids (Lim et al., 2002; Eudes et al., 2008). UPLC/ESI(-)-QTOFMS-based analyses of methanolic extracts prepared from one and 3 week old leaves of Q. robur failed in the detection of vanillic and protocatechuic acid and revealed only trace amounts of the corresponding glucose esters 1-O-vanilloylß-D-glucose and 1-O-protocatechuoyl-ß-D-glucose near the detection limit, if any. In contrast, gallic acid and the related 1-O-galloyl-ß-D-glucose were found in major abundance (Supplemental Fig. S2). This suggests that – in terms of enzyme evolution – glucosyl acceptor specificity of UGT84A13 was not selected against vanillic and protocatechuic acid.

Concluding remarks To isolate a cDNA of the enzyme UDP-glucose:gallic acid glucosyltransferase we used a strategy designed to clone abundantly expressed sequences of ester-forming UGTs from gallotanninproducing tissues of Q. robur. The approach resulted in the isolation and characterization of a novel glucosyltransferase denominated as UGT84A13. In vitro kinetic measurements demonstrated that UGT84A13 transferred the glucosyl moiety preferentially to the carboxyl group of several HBAs including gallic acid, the highly abundant phenolic substrate of gallotannin biosynthesis. In contrast to gallic acid, other in vitro glucosyl acceptors of UGT84A13 like protocatechuic acid and vanillic acid were not detectable in young oak leaves; and the corresponding 1-O-esters of ß-D-glucose were at detection limit or below. This indicates that gallic acid is the preferred substrate of UGT84A13 in developing leaves of Q. robur. In summary, the results strongly suggest that UGT84A13 catalyzes the first committed step of gallotannin biosynthesis in planta. Although the cloning strategy described here has proven successful in detecting abundant ester-forming group L UGTs from other plants (Mittasch et al., 2007), we cannot exclude the presence of related UGTs, which may contribute to the formation of 1-O-galloyl-ß-D-glucose in Q. robur. To answer this question, deep

The substrates protocatechuic acid and vanillic acid as well as ferulic acid and caffeic acid were purchased from Roth (http:// www.carl-roth.de/). Gallic acid, sinapic acid and UDP-glucose were purchased from Sigma (http://www.sigmaaldrich.com/). From the authenticated standards, 1-O-sinapoyl-ß-D-glucose was isolated from seedlings of Brassica napus and provided by Baumert et al. (2005). 1-O-galloyl-ß-D-glucose (b-glucogallin) was purchased from Phytolab (http://www.phytolab.com/). cDNA library construction and isolation of UGT sequences From swelling buds and 1 week old leaves of Q. robur total RNA was purified by commercial preparation kits applying selective adsorption onto silica (RNeasy Plant Mini Kit, Qiagen; http:// www.qiagen.com). Poly (A+) RNA was enriched from total RNA by selective binding to oligo (dT)-Oligotex beads (Oligotex mRNA Mini Kit, Qiagen). For cDNA library construction, 100 ng of poly (A+) RNA pooled from swelling buds and 1 week old leaves were subjected to cDNA synthesis and cloning into plasmid pSMART2IFD using the In-FusionÒ SmarterÒ Directional cDNA Library Construction Kit (Clontech; http://www.clontech.com). The resulting plasmid-based cDNA library was transformed into E. coli by electroporation using Stellar Electrocompetent Cells (Clontech, http://www.clontech.com). The library covered about 900,000 clones, which were pooled and stored as DMSO freeze stocks at 80 °C. For downstream application the cDNA library was purified from the bacterial host by commercial plasmid preparation kits (GeneJET Plasmid Miniprep Kit, Thermo Scientific). Partial 30 UGT sequences were amplified from the Q. robur cDNA library by PCR with degenerate forward primers derived from the conserved PSPG box peptide motif THCGWN (ACS(W) CAY TGY GGS(W) TGG AAC; ACS(W) CAY TGY GGS(W) TGG AAT) and a reverse primer (CCTCTTCGCTATTACGCCAGC) binding to the 30 adjacent sequence of the library vector. PCR was run with DyNAzyme DNA Polymerase I (ThermoScientific; http://www.thermoscientificbio.com/finnzymes/) in a 50 ll reaction mixture containing 1 ll of the diluted (1:100) cDNA library as the template. For yield optimization, a touch down protocol was developed including successively declining annealing temperatures (2 cycles at melting temperature (Tm) + 5 °C, followed by 5 cycles of Tm + 3 °C, 5 cycles of Tm + 1 °C, 7 cycles of Tm  1 °C, 7 cycles of Tm  3 °C, and 10 cycles of Tm  5 °C). PCR cycles included denaturation for 15 s at 95 °C, annealing for 30 s followed by elongation for 1 min at 72 °C. PCR products were purified using the MinElute PCR Purification Kit (Qiagen) and cloned into the E. coli plasmid pGEMTeasy (Promega; http://www.promega.com). Transformant clones were analyzed for cDNA insertion by colony-PCR with M13 uni (21) (TGTAAAACGACGGCCAGT) and M13 reverse (29) (CAGGAAACAGCTATGACC) primers using MangoMix (http://www.bioline.com). The identified 30 partial QrUGT1 sequence was used to derive the specific reverse primer for amplification of the 50 sequence of QrUGT1 (GGCTTCACCACGGCACATTC). For 50 sequence

48

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51

A R2

d

HO

-H+

HO

+H

O n

R1

O O

OH

HO

OH

b

c

B

a

compound

n

R1

R2

elem. comp.

1-O-galloyl-β-D-glucose

0

OH

OH

1-O-protocatechuoyl-β-D-glucose 0

OH

H

1-O-vanilloyl-β-D-glucose 1-O-caffeoyl-β-D-glucose

0

OCH3

1

OH

H H

C13H16O10

ret. time [s] 150a

[M-H]m/z 331.0663

error ppm 2.2

C13H16O9

72b

C14H18O9 C15H18O9

315.0711

3.5

154

b

329.0852

8.0

167

b

341.0877

0.2

b

355.1024

3.0

385.1127

3.4

1-O-feruloyl-β-D-glucose

1

OCH3

H

C16H20O9

239

1-O-sinapoyl-β-D-glucose.

1

OCH3

OCH3

C17H22O10

250b

a

b

gradient program 1, gradient program 2

C compound

[MH]-

[aH]-

[b-H]-

[cH]-

[cH2OH]193 (2)

[dH]-

[dH2OH]151 (48)

other ions

141 (3, [d-H-CO]-), 125 (14, [d-H-CO2]-), 123 (18[d-H-H2CO2]-), 119 (3, C4H7O4-), 113 (4, C5H5O3), 101 (3, C4H5O3-) 1-O-protocatechuoyl315 255 225 195 153 119 (3)*, 113 (4)*, 109 (3, β-D-glucose (60) (28) (3) (44) (100) [d-H-CO2]-), 101 (1)* 269 239 209 167 314 (4, [M-CH3-H]•-), 251 1-O-vanilloyl-β-D-glucose 329 (100) (18) (6) (65) (90) (2, [a-H2O-H]-), 221 (2, [b-H2O-H]-), 181 (16, [cCO-H]-), 123 (3, [d-HCO2]-), 119 (4)*, 113 (6)*, 101 (5)* 281 251 221 203 179 161 135 (2, [d-H-CO2]-), 133 1-O-caffeoyl-β-D-glucose 341 (13) (4) (1) (3) (3) (20) (100) (2[d-H-H2CO2]-), 119 (0.5)*, 113 (0.6)* 355 295 265 235 217 193 175 160 (5, [e-CH3-H]•-), 149 1-O-feruloyl-β-D-glucose (5) (3) (1) (4) (5) (17) (100) (1, [d-CO2-H]-), 134 (1, [d-CO2-CH3-H]•-), 119 (0.3)*, 113 (0.6)*, 101 (0.2)* 1-O-sinapoyl-β-D-glucose. 385 325 295 265 247 223 205 190 (4, [e-CH3-H]•-), 179 (8) (4) (1) (5) (7) (18) (100) (2, [d-H-CO2]-), 164 (1, [d-CO2-CH3-H]•-), 119 (0.4)*, 101 (0.3)* a=[M-C2H4O2]; b=[M-C3H6O3]; c=[M-C4H8O4]; d=[M-C6H10O5]; CE, collision energy; *for elemental composition see compound 1 1-O-galloyl-β-D-glucose

331 (40)

271 (25)

241(2)

211 (36)

169 (100)

CE [eV] 20

15 15

15

15

15

Fig. 3. Verification of reaction products by UPLC/ESI(-)-QTOFMS. (A) Mass spectral fragmentation of the deprotonated molecular ion of substituted 1-O-hydroxybenzoyl/ hydroxycinnamoyl-ß-D-glucoses upon collision-induced dissociation. (B) Accurate mass measurements of deprotonated molecular ions of enzymatic reaction products using UPLC/ESI(-)-QTOFMS. (C) Collision-induced dissociation mass spectra obtained from the deprotonated molecular ion of enzymatic reaction products using UPLC/ESI(-)QTOFMS [m/z (rel. int.)]. Elemental compositions of fragment ions are supported by accurate mass measurements (±10 ppm).

amplification the specific QrUGT1 reverse primer was used in combination with the forward primer TCACACAGGAAACAGCTATGA, which binds to the 50 adjacent sequence of the library vector, in a PCR with the cDNA library as template. PCR was run according to a touch-down protocol, which included an initial decrease of the annealing temperature from 61 °C to 51 °C over 10 cycles fol-

lowed by 25 cycles at 51 °C. The produced amplicons were separated by agarose gel electrophoresis and purified using the MinElute Gel Extraction Kit (Qiagen). Fragments were cloned into plasmid pGEMTeasy and subjected to sequence analyses. The identified overlapping 50 - and 30 -sequences of QrUGT1 were used to assemble a full length reading frame of QrUGT1 in silico. From this

Specific activity [nkat/mg]

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51

300 250

C6-C1

49

C6-C3

200 150 100 50 0

Fig. 4. Substrate specificity of UGT84A13 towards hydroxybenzoic acids (C6–C1) and hydroxycinnamic acids (C6–C3). Assays were performed in the presence of 4 mM UDPglucose and 2 mM phenolic acid. Specific activities were calculated from the linear increase in product formation over 4 min. Each bar represents the mean of three independent trials ± standard deviation.

Table 1 Kinetic parameters of UGT84A13. Substrate

Vmax [nkat mg1]

KM (lM)

Vmax/KM [(nkat/(lM mg)1]

Gallic acid Protocatechuic acid Vanillic acid

204 283 203

420 290 230

0.49 0.98 0.88

sequence, specific primers were derived for the amplification of full length QrUGT1. Amplification was performed with the Q. robur cDNA library as template and the MyFi DNA Polymerase Mix (Bioline) using the specific primers ATGGGATCCGAAGCTCTAGTTC (fw) and CTAGGCCTCCACCAATTCTACC (rev). PCR amplification was run for 35 cycles at constant annealing temperature of 55 °C according to the protocol given by the supplier. Heterologous expression of UGT84A13 cDNA A full-length UGT84A13 coding sequence except for the start codon was amplified from UGT84A13 cDNA with primers introducing restriction sites for BamHI (GTAGGATCCGAAGCTCTAGTTC (fw)) and PstI (TACCTGCAGCTAGGCCTCCACCAATTC (rev)) using DyNAzyme DNA Polymerase I (ThermoScientific). The amplification product was inserted as BamHI-PstI fragment into plasmid pQE30 (Qiagen) thereby generating a 50 fusion to 6xHis codons resulting in the N-terminal His tag of the expressed UGT84A13 protein. The ligation product was transformed into E. coli strain M15 [pREP4] (Qiagen). For heterologous expression, cells were grown under vigorous shaking at 37 °C in liquid Luria–Bertani medium supplemented with ampicillin (100 lg ml1) and kanamycin (25 lg ml1) to the early exponential phase (OD600 0.7). The expression of recombinant UGT84A13 was then induced by further cultivation in the presence of 1 mM isopropyl-b-D-thiogalactopyranoside at 20 °C for 20 h. Cells were harvested by centrifugation (10 min, 10,000g, 4 °C), and the cell pellets were stored at 80 °C. Purification of recombinant UGT84A13 A bacterial cell pellet from 2 l of induced culture was re-suspended in 40 ml ice-cold binding buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) supplemented with 300 ll of Proteinase Inhibitor Cocktail (Sigma–Aldrich, http://

www.sigmaaldrich.com) and 0.8 mg ml1 lysozyme (Applichem, http://www.applichem.com) and incubated for 30 min on ice. After cell lysis by sonication (2  1 min on ice), high molecular DNA was digested by DNaseI (Applichem) added to a final concentration of 10 mg ml1 for 10 min at room temperature. Cell debris was removed by centrifugation (20,000g, 4 °C, 45 min) and the clear supernatant passed through a cellulose acetate syringe filter of 0,45 lm pore size (30/0,45 CA-S; Whatman, http://www.whatman.com). The recombinant His tag UGT84A13 protein was purified by immobilized metal ion affinity chromatography (IMAC) on Ni2+ Sepharose using the Äkta explorer 100 chromatographic system (Pharmacia Biotech) equipped with a HisTrap HP column (1 ml, 0.7  2.5 cm) and Unicorn™ 5.31 software (GE Healthcare; http://www.gelifesciences.com). The Äkta system was run with a flow rate of 1 ml min1 at 20 °C and a pressure of 0.5 MPa. The column was equilibrated with binding buffer and the filtrated bacterial raw extract was applied using Superloop 50 ml (GE Healthcare). After washing with 10 column volumes of binding buffer, elution was done by a linear gradient from 10 mM to 500 mM imidazole over 20 column volumes. Fractions of 2 ml were collected and analyzed for protein content by measuring the absorption at 280 nm. Selected fractions were applied to PD-10 Sephadex G-25 columns (GE Healthcare), and the protein eluted into 50 mM phosphate buffer (pH 7.0), 0.5 mM EDTA, 10% (v/v) glycerol, 0.1% b-mercaptoethanol. Protein concentration was determined by the method of Bradford (1976) with bovine serum albumin as the standard. Purified proteins were analysed by SDS– polyacrylamide gel electrophoresis on an 11% gel according to Laemmli (1970). The selected fractions were tested for UGT activity under standard assay conditions with gallic acid as the glucose acceptor. UGT activity assays Standard UGT assays were performed in 0.1 M MES, 10% glycerol, 0.01% ß-mercaptoethanol, 0.5 mM EDTA (pH 6.0) containing 6 lg ml1 of recombinant UGT84A13 protein, 4 mM UDP-glucose, and 2 mM of the hydroxybenzoic or hydroxycinnamic acid substrate. Reaction mixtures were incubated at 30 °C, and the reactions stopped after 1, 2, 3 and 4 min by mixing aliquots of the assay mixture with equal volume of methanol (C6–C1 phenolic acids) or with 0.2 volume of trifluoroacetic acid (C6–C3 phenolic acids). Reaction products were analyzed by HPLC-PDA. Specific

50

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51

enzyme activities were calculated from the increase in the formation of reaction products and expressed as nmol of substrate glucosylated per second and per mg protein (nkat mg1). Kinetic parameters were determined from enzyme assays under standard conditions (pH 6.0; 30 °C; 6 lg ml1 recombinant UGT84A13). Initial reaction velocities were measured over a range of 0.2–3.0 mM phenolic acid in the presence of 4 mM UDP-glucose. Product formation was quantified after 1, 2 and 4 min. KM and Vmax values were calculated from hyperbolic Michaelis–Menten saturation curves by non-linear fitting using the Enzyme Kinetics 1.3 module of Sigma Plot 10 (Systat Software, http://systat.de). HPLC separations were performed on a C18 column Atlantis T3 (4.6  150 mm, 5 lm particle size) obtained from Waters (http:// www.waters.com) using the LaChrom Elite HPLC system equipped with a L-2450 Photodiode Array Detector (Hitachi; http:// www.hitachi-hta.com). For analysis of hydroxybenzoyl glucose esters, HPLC solvents A and B were water and acetonitrile, both containing 0.1% (v/v) formic acid. After injection, the linear gradients to 1.8%, 26%, and 95% B in 6, 12, and 0.1 min, respectively, were successively run. The analytes were detected by their absorption at 280 nm (1-O-galloyl-ß-D-glucose) or at 265 nm (1-O-vanilloylß-D-glucose; 1-O-protocatechuoyl-ß-D-glucose). For analysis of hydroxycinnamoyl glucose esters, HPLC solvents A and B were water and 98% (v/v) aqueous acetonitrile, respectively, both containing 0.1% (v/v) trifluoroacetic acid. After injection, the linear gradients to 20%, 27%, and 95% B in 1, 12, and 1 min, respectively, were successively run. The analytes were detected by their absorption at 330 nm (1-O-feruloyl-ß-D-glucose; 1-O-sinapoyl-ß-D-glucose; 1-O-caffeoyl-ß-D-glucose). The assay products were quantified by external standardization with the corresponding acids as reference compounds. All assays were repeated in quadruplicate, HPLC measurements were done with three technical replicates for each data point. Characterization of enzymatic reaction products and leaf extracts by UPLC/ESI-QTOFMS After 100-fold dilution with water, enzymatic reaction mixtures (2 ll) were separated on a Acquity UPLC platform (Waters) equipped with a HSS T3 column (100  1.0 mm, particle size 1.8 lm, Waters) applying the following binary gradient programs at a flow rate of 150 ll min1: gradient program 1; 0–1 min, isocratic 100% A (water/0.1% formic acid), 0% B (acetonitrile/0.1% formic acid); 1–5 min, linear from 0% to 7% B; gradient program 2; 0–1 min, isocratic 95% A, 5% B, 1–10 min, linear from 5% to 40% B. For separation of oak leaf extracts gradient program 3 (0–1 min, isocratic 98% A, 2% B, 1–16 min; linear from 2% to 60% B) was used. Eluting compounds were consecutively detected in a wavelength range of 190–500 nm using a photodiode array detector (Waters) and in a m/z range of 50–1000 using a MicrOTOF-Q I hybrid quadrupole time-of-flight mass spectrometer equipped with an Apollo II electrospray ion source (Bruker Daltonics) in negative ion mode. For specific instrument settings and instrument calibration see Böttcher et al. (2009). For acquisition of collision-induced dissociation (CID) mass spectra, deprotonated molecular ions were isolated in the first quadrupole (isolation width of m/z ± 3) and fragmented inside the collision cell applying collision energies in the range of 15–20 eV. Argon was used as collision gas. Sequence analysis DNA and protein sequences were analyzed by the software package Clone Manager (Scientific & Educational Software). For sequence comparison, the BLAST algorithm (Altschul et al., 1990) was employed. The online database used was Genbank (http://

www.ncbi.nlm.nih.gov/GenBank/index.html). Phylogenetic tree construction was done with the Neighbour-Joining method (Saitou and Nei, 1987) implemented in the MEGA4 software package (Tamura et al., 2011). The isolated cDNA sequence for UGT84A13 described in this paper was submitted to Genbank database and assigned the accession number KF527849. Acknowledgements We are grateful to S. Herrmann and M. Tarkka from the UFZ – Helmholtz Centre for Environmental Research for discussions and access to the TrophinOak platform. Support by E. Blum (Martin Luther University Halle-Wittenberg, Institute of Pharmacy) with the Äkta Explorer 100 Chromatographic System and skillful technical assistance of A. Wodak (Martin Luther University Halle-Wittenberg, Institute of Pharmacy) are gratefully acknowledged. This work was supported by the German Research Foundation (DFG) in two independent projects, MI 723/3-1 and the ‘‘TrophinOak – multitrophic interactions with Oaks’’ project. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.phytochem. 2013.11.023. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Baumert, A., Milkowski, C., Schmidt, J., Nimtz, M., Wray, V., Strack, D., 2005. Formation of a complex pattern of sinapate esters in Brassica napus seeds, catalysed by enzymes of a serine carboxypeptidase-like acyltransferase family. Phytochemistry 66, 1334–1345. Beart, J.E., Lilley, T.H., Haslam, E., 1985. Plant polyphenols – secondary metabolism and chemical defence: some observations. Phytochemistry 24, 33–38. Böttcher, C., Westphal, L., Schmotz, C., Prade, E., Scheel, D., Glawischnig, E., 2009. The multifunctional enzyme CYP71B15 (PHYTOALEXIN DEFICIENT3) converts cysteine-indole-3-acetonitrile to camalexin in the indole-3-acetonitrile metabolic network of Arabidopsis thaliana. Plant Cell 21, 1830–1845. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Eudes, A., Bozzo, G.G., Waller, J.C., Naponelli, V., Lim, E.-K., Bowles, D.J., Gregory III, J.F., Hanson, A.D., 2008. Metabolism of the folate precursor p-aminobenzoate in plants. J. Biol. Chem. 283, 15451–15459. Freudenberg, K., 1920. Die Chemie der Natürlichen Gerbstoffe. Springer, Berlin. Gross, G.G., 1982. Synthesis of b-glucogallin from UDP-glucose and gallic acid by an enzyme preparation from oak leaves. FEBS Lett. 148, 67–70. Gross, G.G., 1983. Partial purification and properties of UDP-glucose:vanillate 1-Oglucosyltransferase from oak leaves. Phytochemistry 22, 2179–2182. Gross, G.G., 1999. Biosynthesis of hydrolysable tannins. In: Pinto, B.M. (Ed.), Comprehensive Natural Products Chemistry, vol. 3. Elsevier, Amsterdam, pp. 799–826. Gross, G.G., Hemingway, R.W., Yoshida, T. (Eds.), 1999. Plant Polyphenols 2. Chemistry, Biology, Pharmacology, Ecology. Kluwer Academic/Plenum Publishers, New York. Grundhöfer, P., Niemetz, R., Schilling, G., Gross, G.G., 2001. Biosynthesis and subcellular distribution of hydrolyzable tannins. Phytochemistry 57, 915–927. Hall, D., De Luca, V., 2007. Mesocarp localization of a bi-functional resveratrol/ hydroxy-cinnamic acid glucosyltransferase of Concord grape (Vitis labrusca). Plant J. 49, 579–591. Hughes, J., Hughes, M.A., 1994. Multiple secondary plant product UDP-glucose glucosyltransferase genes expressed in cassava (Manihot esculenta Crantz) cotyledons. DNA Seq. 5, 41–49. Iason, G., 2005. The role of plant secondary metabolites in mammalian herbivory: ecological perspectives. Proc. Nutr. Soc. 64, 123–131. Khater, F., Fournand, D., Vialet, S., Meudec, E., Cheynier, V., Terrier, N., 2012. Identification and functional characterization of cDNAs coding for hydroxybenzoate/hydroxycinnamate glucosyltransferases co-expressed with genes related to proanthocyanidin biosynthesis. J. Exp. Bot. 63, 1201–1214. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Li, Y., Baldauf, S., Lim, E.-K., Bowles, D.J., 2001. Phylogenetic analysis of the UDPglycosyltransferase multigene family of Arabidopsis thaliana. J. Biol. Chem. 276, 4338–4343.

J. Mittasch et al. / Phytochemistry 99 (2014) 44–51 Li, A.X., Eannetta, N., Ghangas, G.S., Steffens, J.C., 1999. Glucose polyester biosynthesis. Purification and characterization of a glucose acyltransferase. Plant Physiol. 121, 453–460. Lim, E.-K., Doucet, C.J., Li, Y., Elias, L., Worrall, D., Spencer, S.P., Ross, J., Bowles, D.J., 2002. The activity of Arabidopsis glycosyltransferases toward salicylic acid, 4-hydroxybenzoic acid, and other benzoates. J. Biol. Chem. 277, 586– 592. Liu, Y., Gao, L., Liu, L., Yang, Q., Lu, Z., Nie, Z., Wang, Y., Xia, T., 2012. Purification and characterization of a novel galloyltransferase involved in catechin galloylation in the tea plant (Camellia sinensis). J. Biol. Chem. 287, 44406–44417. Mackenzie, P., Owens, I., Burchell, B., Bock, K., Bairoch, A., Belanger, A., FournelGigleux, S., Green, M., Hum, D., Iyanagi, T., et al., 1997. The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence. Pharmacogenetics 7, 255–269. Milkowski, C., Baumert, A., Schmidt, D., Nehlin, L., Strack, D., 2004. Molecular regulation of sinapate ester metabolism in Brassica napus: expression of genes, properties of the encoded proteins and correlation of enzyme activities with metabolite accumulation. Plant J. 38, 80–92. Mittasch, J., Strack, D., Milkowski, C., 2007. Secondary product glycosyltransferases in seeds of Brassica napus. Planta 225, 515–522. Niemetz, R., Gross, G.G., 2005. Enzymology of gallotannin and ellagitannin biosynthesis. Phytochemistry 66, 2001–2011.

51

Ono, N.N., Bandaranayake, P.C.G., Tian, L., 2012. Establishment of pomegranate (Punica granatum) hairy root cultures for genetic interrogation of the hydrolysable tannin biosynthetic pathway. Planta 236, 931–941. Ross, J., Li, Y., Lim, E.-K., Bowles, D.J., 2001. Higher plant glycosyltransferases. Genome. Biol. 2, reviews 3004.1–3004.6. Scalbert, A., 1991. Antimicrobial properties of tannins. Phytochemistry 30, 3875– 3883. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tarkka, M.T., Herrmann, S., Wubet, T., Feldhahn, L., Recht, S., Kurth, F., Mailänder, S., Bönn, M., Neef, M., Angay, O., Bacht, M., Graf, M., Maboreke, H., Fleischmann, F., Grams, T.E.E., Ruess, L., Schädler, M., Brandl, M., Scheu, S., Schrey, S.D., Grosse, I., Buscot, F., 2013. OakContigDF159.1, a reference library to study differential gene expression in Quercus robur L. during controlled biotic interactions: first assessment by transcriptomic profiling in ectomycorrhizal symbiosis. New Phytol. 199, 529–540. Weisemann, S., Denzel, K., Schilling, G., Gross, G.G., 1988. Enzymatic synthesis of 1O-phenylcarboxyl-ß-D-glucose esters. Bioorg. Chem. 16, 29–37.