IdsA is the major geranylgeranyl pyrophosphate synthase involved in carotenogenesis in Corynebacterium glutamicum.

IdsA is the major geranylgeranyl pyrophosphate synthase involved in carotenogenesis in Corynebacterium glutamicum Sabine A. E. Heider1, Petra Peters-Wendisch1, Jules Beekwilder2 and Volker F. Wendisch1 1 Chair of Genetics of Prokaryotes, Faculty of Biology & CeBiTec, Bielefeld University, Germany 2 Plant Research International, Wageningen, The Netherlands

Keywords CrtE; Corynebacterium; C50 carotenoid biosynthesis; IPP synthase; IdsA; prenyl transferase Correspondence V. F. Wendisch, Genetics of Prokaryotes, Faculty of Biology & CeBiTec, University of Bielefeld, 33615 Bielefeld, Germany Fax: +49 521 106 5626 Tel: +49 521 106 5611 E-mail: [email protected] (Received 17 April 2014, revised 16 July 2014, accepted 29 August 2014) doi:10.1111/febs.13033

Corynebacterium glutamicum, a yellow-pigmented soil bacterium that synthesizes the rare cyclic C50 carotenoid decaprenoxanthin and its glucosides, has been engineered for the production of various carotenoids. CrtE was assumed to be the major geranylgeranyl pyrophosphate (GGPP) synthase in carotenogenesis; however, deletion of crtE did not abrogate carotenoid synthesis. In silico analysis of the repertoire of prenyltransferases encoded by the C. glutamicum genome revealed two candidate GGPPS genes (idsA and ispB). The absence of pigmentation of an idsA deletion mutant and complementation experiments with a double deletion mutant lacking both idsA and crtE showed that IdsA is the major GGPPS of C. glutamicum and that crtE overexpression compensated for the lack of IdsA, whereas plasmid-borne overexpression of ispB did not. Purified His-tagged CrtE was active as a homodimer, whereas the active form of IdsA was homotetrameric. Both enzymes catalyzed prenyl transfer with isopentenyl pyrophosphate (IPP), dimethylallyl pyrophosphate, geranyl pyrophosphate and farnesylphosphate (FPP) as substrates. IdsA showed the highest catalytic efficiency with dimethylallyl pyrophosphate and IPP, whereas the catalytic efficiency of CrtE was highest with geranyl pyrophosphate and IPP. Finally, application of prenyltransferase overexpression revealed that combined overexpression of idsA and the IPP isomerase gene idi in the absence of crtE led to the highest decaprenoxanthin titer reported to date.

Introduction Terpenoids constitute an extensive group of natural secondary metabolites with > 55 000 known structures, a number that is constantly increasing because of new discoveries [1,2]. The variation in structure is reflected by a diversity of biological functions, e.g. as hormones, volatile signals, defensive compounds, electron carriers, pigments and light-harvesting compounds, and plant regulatory molecules [3]. Terpenoids are composed of a varying number of isoprene units, and

are synthesized from the universal five-carbon building block isopentenyl pyrophosphate (IPP). IPP and its isomer dimethylallyl pyrophosphate (DMAPP) are synthesized either in the mevalonate pathway or the methylerythritol phosphate pathway [4]. These compounds are substrates for isoprenylpyrophosphate synthases (IPPSs), which catalyze condensation reactions of isoprene units by using divalent metal ions such as Mg2+ and Mn2+ as cofactors [5,6]. Their products

Abbreviations DMAPP, dimethylallyl pyrophosphate; DPPR, decaprenyl-phosphate phosphoribosyltransferase; DW, dry weight; FPP, farnesyl pyrophosphate; GGPP, geranylgeranyl pyrophosphate; GPP, geranyl pyrophosphate; IPP, isopentenyl pyrophosphate; IPPS, isoprenylpyrophosphate synthase; IPTG, isopropyl thio-b-D-galactoside; PNP, purine nucleoside phosphorylase; WT, wild type.

4906

FEBS Journal 281 (2014) 4906–4920 ª 2014 FEBS

S. A. E. Heider et al.

GGPPS involved in carotenogenesis

range from the C10 unit geranyl pyrophosphate (GPP) to natural rubber with several million of carbon atoms. IPPSs have been classified into four major groups on the basis of prenyl chain length, stereochemistry of the final product, and their subunit composition. Short-chain IPPS of group I are trans-prenyltransferases synthesizing C10 to C20 products, by catalyzing the condensation of one molecule of DMAPP with one to three molecules of IPP, respectively [7]. They are categorized, according to their product length, as GPP synthase, farnesyl pyrophosphate (FPP) synthase, or geranylgeranyl pyrophosphate (GGPP) synthase. Typically, they are active as homodimers, but heterodimeric GPP synthases have also been described [8,9]. The group I short-chain IPPSs, which catalyze the condensation of one molecule of DMAPP with one to three molecules of IPP, have been studied most extensively [2,5,6,10]. According to the product chain length, GPP (C5) synthase (EC 2.5.1.1), FPP (C10) synthase (EC 2.5.1.10) and GGPP (C20) synthase (EC 2.5.1.29) can be distinguished, although some enzymes also synthesize products longer by one [11,12] or two [10] C5 units in vitro. The condensation reaction catalyzed by IPPSs is initiated by elimination of the diphosphate ion from an allylic diphosphate (DMAPP in the case of short-chain IPPSs) to yield an allylic cation that is then attacked by the nucleophilic moiety of IPP. Through the stereospecific removal of a proton, a new C–C bond and a new double bond in the elongated product are formed [5]. Two highly conserved

A

Asp-rich regions (DDxxD) are critical for substrate binding and catalysis via chelation with the divalent cation (Mg2+) as cofactor [13–17]. These DDxxD motifs and the fifth residue before the first DDxxD motif determine the product chain length [18–20]. The Gram-positive Corynebacterium glutamicum, which is used for the large-scale production of amino acids for the food and feed industries, is pigmented because of synthesis of the yellow C50 carotenoid decaprenoxanthin [3,21] (Fig. 1A). C. glutamicum possesses the genes for the methylerythritol phosphate pathway and has a carotenogenic operon crtE–cg0722– crtBIYeYfEb (Fig. 1B) encoding six enzymes for the synthesis of decaprenoxanthin from IPP [21–23], as well as the gene crtB2 for an alternative phytoene synthase [23] and the gene crtX for C50 carotenoid glucosyltransferase [24]. By metabolic engineering of the terminal carotenoid pathway in C. glutamicum strains for the overproduction of lycopene [23], the C50 carotenoids decaprenoxanthin, sarcinaxanthin and C.p.450 [24], the C40 carotenoids b-carotene and zeaxanthin [24] and the sesquiterpene (C15) valencene [25] have been obtained. Overexpression of crtE annotated as a putative GGPPS [26] was beneficial for carotenoid overproduction [23,24], but not for sesquiterpene synthesis [25]. To study the potential of C. glutamicum for the production of carotenoids, monoterpenes, sesquiterpenes, and diterpenes, its genetic repertoire of prenyltransferases was investigated in more detail. On the basis of our initial finding that a crtE deletion mutant was still

B

Fig. 1. Carotenoid biosynthesis pathway of C. glutamicum (A) and genetic organization of carotenoid genes (B). Gene names are indicated next to the reactions catalyzed by the respective gene products. In addition, gene identifiers are given in (B). Structures of selected intermediates and carotenoids are presented. PPi, inorganic pyrophosphate.


4907


pigmented, putative prenyltransfaserases encoded by the C. glutamicum genome were analyzed in silico, and a putative second IPPS gene (idsA, cg2384) was identified. Deletion and complementation analysis in combination with biochemical characterization of purified His-tagged CrtE and IdsA identified IdsA as major GGPPS in C. glutamicum.

Results CrtE is not required for carotenogenesis in C. glutamicum CrtE, encoded by the first gene of the carotenogenic crtE–cg0722–crtBIYeYfEb operon of C. glutamicum, was considered to be a major GGPPS of this bacterium because crtE overexpression improved the production of lycopene, decaprenoxanthin, and other carotenoids [23,24]. To test this hypothesis, crtE was deleted in C. glutamicum wild type (WT), and the resulting in-frame deletion mutant was named C. glutamicum DcrtE. Surprisingly, deletion of crtE did not result in a white phenotype. Rather, yellow pigmentation indicated that carotenogenesis proceeds up to the formation of decaprenoxanthin or its diglucosides in C. glutamicum DcrtE (Fig. 2). Accordingly, extraction of C. glutamicum WT and DcrtE yielded comparable decaprenoxanthin diglucoside concentrations (Fig. 2). Thus, one or more unknown enzymes compensated for

Fig. 2. Carotenoid accumulation in C. glutamicum WT and different GGPPS deletion mutants. Carotenoid elution profiles of methanolic cell extracts and the corresponding cell pellets derived from C. glutamicum WT (A), DcrtE (B), DidsA (C) and DcrtEDidsA (D) cultures, grown for 24 h in glucose minimal medium, are shown. Decaprenoxanthin diglucoside eluted as a major peak at 5.5 min.

4908


the lack of CrtE with respect to biosynthesis of the carotenoid decaprenoxanthin in C. glutamicum DcrtE. The C. glutamicum genome encodes 10 putative prenyltransferases, including the putative GGPPS IdsA As CrtE was dispensable for carotenoid biosynthesis, the C. glutamicum genome was analyzed with respect to genes encoding putative prenyltransferases. Besides the phytoene synthases CrtB and CrtB2, which catalyze reductive tail-to-tail condensation of two molecules of GGPP [23], only three prenyltransferases of C. glutamicum have been functionally characterized to date, namely lycopene elongase CrtEb [21–23], Z-decaprenyl-diphosphate synthase (UppS2; cg2508 [27]), and phosphoribose diphosphate:decaprenylphosphate phosphoribosyltransferase (DPPR synthase) [28]. DPPR synthase (encoded by cg3189) catalyzes the first reaction leading from phosphoribose diphosphate to decaprenylphosphoryl-D-arabinose, the donor of the essential D-arabinofuranosyl residues found in the cell walls of Mycobacterium tuberculosis and C. glutamicum [28]. In addition, putative functions have been assigned to other gene products that might prenylate non-isoprene substrates in C. glutamicum. These enzymes may function in the biosynthesis of the electron carriers of respiration menaquinone (MenA, cg0531) and cytochrome (CtaB, cg1773) [29–33], or in the isopentenylation of tRNAs that read codons starting with a uracil (MiaA, cg2130), which is a widespread tRNA base modification to avoid frameshift errors [34]. Two genes encode putative long-chain IPPSs involved in the synthesis of C55 undecaprenyl pyrophosphate in peptidoglycan biosynthesis [by UppS1 (cg1130) and UppS2 (cg2508)]. Besides CrtE, two further putative short-chain IPPSs, IdsA and IspB, are encoded in the C. glutamicum genome. Phylogenetic analysis of the characterized and putative prenyltransferases of C. glutamicum with homologs of other bacteria (Fig. 3) revealed distinct clusters for IPPSs (cluster I), MiaA (cluster II), UppS (cluster III), MenA (cluster IV), CtaB (cluster V), UbiA (cluster VI), DPPR synthases (cluster VII), and lycopene elongases (cluster VIII). Proteins similar to CrtE (subcluster Ia) and IdsA (subcluster Ib) of C. glutamicum were distinct from proteins similar to IspB of C. glutamicum and Escherichia coli (subcluster Ic) and IspA of E. coli and Bacillus subtilis (subcluster Id) (Fig. 3). As CrtE shares 29% identical residues with IdsA and 21% identical residues with IspB, whereas IdsA and IspB share 27% identical residues, both FEBS Journal 281 (2014) 4906–4920 ª 2014 FEBS


IdsA and IspB were analyzed further to determine whether they function as IPPSs. Deletion analyses revealed that idsA encodes the major GGPP synthase in C. glutamicum To test the roles of IspB and IdsA in carotenogenesis, we attempted to construct in-frame deletion mutants. Although several attempts were made, it was not possible to obtain an ispB deletion mutant of C. glutamicum. Although this may be attributable to technical problems, it has to be noted that ispB was shown to be essential in E. coli, because it could only be deleted if ispB was expressed in trans from a plasmid [35]. IspB of E. coli is an octaprenyl diphosphate synthase responsible for the synthesis of the side chain of the isoprenoid quinones menaquinone and ubiquinone [35], and it is conceivable that IspB is required for menaquinone biosynthesis in C. glutamicum. In contrast, it was possible to delete idsA. The resulting mutant C. glutamicum DidsA showed a white phenotype, and neither decaprenoxanthin nor other carotenoids were detected in extracts (Fig. 2). Plasmidborne expression of idsA or crtE complemented the mutant C. glutamicum DidsA (Fig. 4A). With an inducer concentration of 0.1 mM isopropyl thio-b-D-galactoside (IPTG), carotenoid production was comparable to that of the WT carrying the empty vector. Plasmidborne overexpression of idsA led to red pigmentation, which increased with a higher inducer concentration (0.1 versus 1 mM IPTG; data not shown). Analysis of extracts of strains overexpressing idsA revealed that lycopene accumulated, which explains the red pigmentation (Fig. 4). A double deletion mutant lacking both crtE and idsA was constructed. Plasmid-borne expression of either idsA or crtE complemented the double mutant DcrtEDidsA, whereas it remained white upon ectopic expression of ispB (Fig. 4B). Thus, unlike the redundant CrtE, IdsA has an essential role in carotenoid biosynthesis in C. glutamicum. Lack of IdsA can be complemented by plasmid-borne overexpression of crtE. Purification and biochemical characterization of GGPP synthases CrtE and IdsA For characterization of the kinetic properties of GGPP synthases, both enzymes were produced in recombinant E. coli BL21(DE3) as N-terminal His-tagged proteins. Both His-tagged enzymes were purified to homogeneity (Fig. 5A). Gel filtration chromatography and activity assays showed that each protein eluted in a single fraction (Fig. 5B). Whereas CrtE was active as FEBS Journal 281 (2014) 4906–4920 ª 2014 FEBS


a homodimer with a molecular mass of ~ 84 kDa, the active form of IdsA behaved as a homotetramer of ~ 158 kDa. Enzyme activity was determined by following the initial rates of pyrophosphate release in a photometric assay with coupling to pyrophosphatase and purine nucleoside phosphorylase. For activity of both proteins, the presence of the divalent metal cation Mg2+ was required. The addition of K+ as a further metal ion at concentrations of 50–400 mM affected the enzyme activity negatively, although IdsA seemed to be less sensitive to potassium ions (Fig. 6B). Furthermore, Triton X-100 and Tween-20, which have been shown to activate the GGPP synthases from Micrococcus luteus [36], Saccharomyces cerevisiae [37], and humans [38], were tested as potential effectors. Both compounds were assayed at concentrations between 0.1% and 0.3% (v/v), but no significant effects on enzyme activities were observed (data not shown). Stability against thermal inactivation was tested by incubating the enzyme for 1 h in 50 mM Tris/HCl (pH 7.5) with 1 mM MgCl2 at different temperatures prior to determining the activity at 30 °C. Temperatures of 40 °C and higher led to a complete loss of activity for CrtE, whereas IdsA activity was reduced by ~ 80% at 40 °C (data not shown). The optimal temperatures for activity were determined to be approximately 25 °C for CrtE and 30–35 °C for IdsA, which are similar to the optimal growth temperature for C. glutamicum. At temperatures higher than 40 °C, both proteins showed strongly decreased enzyme activities. The kinetic parameters of CrtE and IdsA for the condensation of IPP with DMAPP, GPP, and FPP, respectively, were determined under optimal assay conditions (30 °C and pH 7.5 in 50 mM Tris buffer with 1 mM MgCl2). Determination of bisubstrate kinetics revealed that both CrtE and IdsA had similar affinities for the substrates IPP (KM of 5 lM for CrtE and 8 lM for IdsA) and DMAPP (KM of 7 lM for CrtE and 8 lM for IdsA). IdsA showed a similar affinity for the C10 substrate GPP (KM of 8 lM), but a higher KM for the C15 substrate FPP (20 lM). The KM of CrtE for FPP (6 lM) was in the same range; however, CrtE showed a very high affinity for GPP, with a KM of 0.1 lM. Most significantly, the kcat values of CrtE and IdsA showed very strong differences. Whereas the substrates IPP and DMAPP were processed very efficiently by IdsA, with a kcat of ~ 1 s1, the turnover by CrtE was ~ 50-fold lower. The turnover numbers for GPP and FPP were, in general, lower for both enzymes, with CrtE showing a very low KM for GPP. These results support a role of IdsA as major GGPP synthase, whereas CrtE may serve to convert GPP possibly originating from nonprocessive catalysis to GGPP.

4909


4910





Fig. 3. Phylogenetic relationships of prenyltransferases of C. glutamicum. The sequence alignment and phylogenetic tree analysis were performed with MEGA version 5.2, with CLUSTAL W and the neighbor-joining method. Cluster I comprises IPPS enzymes similar to CrtE (subcluster Ia) and IdsA (subcluster Ib) of C. glutamicum, IspB of C. glutamicum and E. coli (subcluster Ic), or IspA of E. coli and B. subtilis (subcluster Id). Cluster II comprises tRNA isopentenyltransferases and cluster III undecaprenyl pyrophosphate synthase of peptidoglycan biosynthesis. Enzymes prenylating electron carriers of the respiratory chain are in cluster IV (MenA), cluster V (CtaB), and cluster VI (UbiA). DPPR synthases involved in lipoarabinomannan biosynthesis of actinobacteria are in cluster VII. Cluster VIII comprises C50-specific lycopene elongases of actinobacteria (subcluster VIIIa) and halophilic archae (subcluster VIIIb).

A

B

Fig. 4. Overproduction of CrtE and IdsA in C. glutamium DidsA (A) and DcrtEDidsA (B) restored decaprenoxanthin production. (A) Decaprenoxanthin (dark gray) and lycopene (light gray) concentrations in cell extracts of C. glutamicum DidsA-derived strains. (B) Cell pellets of C. glutamicum DcrtEDidsA-derived strains in comparison with the WT grown in glucose minimal medium and 1 mM IPTG for induction.

IdsA as a target for metabolic engineering of carotenoid production in C. glutamicum To evaluate the roles of idsA and crtE in carotenoid production, decaprenoxanthin overproduction was analyzed when either crtE or idsA was overexpressed in the wild-type background as well as in the double deletion mutant DcrtEDidsA. Decaprenoxanthin accumulation increased slightly in the wild-type-derived strains from 0.4 0.04 mgg1 dry weight (DW) to 0.7 0.04 mgg1 DW in WT(pVWEx1)(pEKEx3crtE) and 0.6 0.04 mgg1 DW in WT(pVWEx1) (pEKEx3-idsA) (Fig. 7). Surprisingly, in C. glutamicum DcrtEDidsA, ectopic expression of IPPSs led to much higher levels of carotenoid. Overexpression of crtE in this background led to 4.3 0.04 mgg1 DW decaprenoxanthin, whereas the empty vector control strain was white and did not accumulate carotenoids. Overexpression of idsA in C. glutamicum DcrtEDidsA FEBS Journal 281 (2014) 4906–4920 ª 2014 FEBS

also led to higher decaprenoxanthin production (2.4 0.1 mgg1 DW) (Fig. 7); however, 0.3 0.1 mgg1 DW lycopene also accumulated (data not shown), indicating a bottleneck in decaprenoxanthin biosynthesis subsequent to the IdsA reaction. To increase lycopene conversion in this strain, three further strains were constructed and analyzed. Upon overexpression of the endogenous lycopene-processing genes crtEb and crtYe/f, 0.3 mgg1 DW lycopene still accumulated (data not shown). However, the heterologous expression of the genes crtE2 and crtYg/h from M. luteus for conversion of lycopene to sarcinaxanthin or lbtABC from Dietzia sp. CQ4 for lycopene conversion to C.p. 450 led to the production of sarcinaxanthin and C.p. 450, respectively, without lycopene formation (data not shown). As lycopene elongase transfers DMAPP to lycopene, provision of DMAPP for decaprenoxanthin production might be limiting, owing to the high activity of IdsA. To test this hypothesis, the IPP isomerase Idi was overproduced. Irrespective of idi overexpression, the wild-type-derived strains WT(pEKEx3) (pVWEx1-idi), WT(pEKEx3-crtE)(pVWEx1-idi), WT (pEKEx3-crtE)(pVWEx1), WT(pEKEx3-idsA)(pVWEx1) and WT(pEKEx3-idsA)(pVWEx1-idi) accumulated comparable amounts of decaprenoxanthin (Fig. 7). Thus, overexpression of idi in C. glutamicum DcrtEDidsA in addition to crtE did not affect decaprenoxanthin levels. However, when idi was expressed in addition to idsA in C. glutamicum DcrtEDidsA, there was an approximately five-fold increase in decaprenoxanthin production without accumulation of the intermediate lycopene (Fig. 7). Hence, there is a sufficient supply of DMAPP for enhanced C50 carotenoid production. Taken together, overexpression of idsA and idi in the absence of crtE allowed for the highest decaprenoxanthin titer (10 2 mgg1 DW) reported for recombinant C. glutamicum strains to date.

Discussion The isoprenoid pathway in industrial microorganisms such as C. glutamicum is a potential source for the production of bioactive molecules, including carotenoids and sesquiterpenes [24,25]. For optimal productivity, one needs to understand the enzymes that

4911



A

C

B

D

Fig. 5. SDS/PAGE for determination of CrtE (A) and IdsA protein purity (C), and gel filtration chromatography of purified CrtE (B) and IdsA (D). Lanes t0 in (A) and (C) show E. coli cells before induction, and lanes t5 show E. coli cells 5 h after induction. In lanes P, purified enzyme (1 lg) was applied. For gel filtration chromatography (B, D), 1 mgmL1 enzyme dissolved in 50 mM Tris/HCl (pH 7.5) with 1 mM MgCl2 was applied to a Superdex 200 column and eluted with the same buffer.

mediate the pathway. In this study, the enzymes of the isoprenoid pathway that lead to the formation of GGPP, the starting molecule for carotenogenesis, were explored (Fig. 1A). Surprisingly, it appears that the GGPP synthase gene crtE, which is part of the operon dedicated to carotenoid formation, is redundant, whereas another GGPP synthase gene, idsA, from an operon with a so far undefined role, is essential for pigmentation in C. glutamicum. In vitro analyses showed that IdsA is a much faster enzyme than CrtE, and could be a target for de-bottlenecking of the carotenoid pathway. Indeed, it appears that overexpression of idsA can result in the highest levels of carotenoids recorded so far, provided that the substrates IPP and DMAPP are present in the appropriate ratio. A number of other Gram-positive bacteria have two group I IPPSs (IdsA and CrtE), whereas most organisms contain only a single group I IPPS for short-chain isoprenoid precursors. For example, the carotenogenic bacterium M. luteus also possesses 4912

both CrtE and IdsA, but no further characterization of IdsA has been reported. IdsA from a moderate thermophile, the Gram-negative Methanobacterium thermoautotrophicum, has been identified as a mixed FPP/GGPP synthase [39]. However, neither in M. luteus nor in Me. thermoautotrophicum gene knockout studies have been performed to further characterize their function. The function of the operon in which idsA is encoded is not straightforward: The gene idsA is located ~ 1.63 Mbp downstream of crtE and is cotranscribed with mptA, a gene encoding a(1–6)-mannopyranosyltransferase involved in lipomannan biosynthesis in this bacterium [40] (Fig. 1B). The regulation of the idsA–mptA operon remains to be explored: it is transcribed in a sigma factor A-dependent manner [41], and an antisense RNA has been identified that may be involved in its regulation [42]. Clearly, in view of the importance of the IdsA protein for carotenogenesis, a more detailed analysis of the regulation of this operon would be of interest. FEBS Journal 281 (2014) 4906–4920 ª 2014 FEBS



A

B

Fig. 7. Improved decaprenoxanthin production resulting from combined overexpression of crtE or idsA with idi. Gray bars: C. glutamicum wild-type-derived strains. Black bars: C. glutamicum DcrtEDidsA-derived strains. White bar: the WT with the empty vector. Dark gray bar: the WT overexpressing idi.

Table 1. Biochemical properties of CrtE and IdsA. Fig. 6. Influence of magnesium chloride (A) or potassium chloride (B) on the activity of CrtE (light gray) and IdsA (dark gray). In vitro activities of purified enzymes were measured in a continuous spectrophotometric assay with different concentrations of MgCl2 or KCl, at 30 °C, in a total volume of 300 lL containing 50 mM Tris/ HCl (pH 7.5), 1 mM MgCl2, 0.2 mM 2-amino-6-mercapto-7methylpurine ribonucleoside, 1 U of PNP, 0.03 U of inorganic pyrophosphatase, 30 lM IPP, and 30 lM DMAPP. Representative results are shown. The specific activity of the respective GGPP synthase was considered to be 100% with 1 mM MgCl2 and 0 mM KCl, respectively.

The importance of IdsA for carotenoid formation is very apparent from the carotenoid analysis of idsA and crtE knockout mutants (Fig. 2): without IdsA, carotenoid production is hardly detectable, whereas crtE can be deleted without an effect on carotenogenesis. This may be understood from the biochemical properties of the enzymes (Table 1). The most striking difference between IdsA and CrtE is the difference in kcat with IPP and DMAPP as substrates: IdsA is 50 times faster at condensing these isoprene units. The presence of two GGPP synthases and the apparent redundancy of CrtE raise questions about the relevance of CrtE for C. glutamicum. Notably, CrtE showed the highest catalytic activity with GPP as the substrate (kcat/KM of ~ 1600 s1mM1), primarily because of its high affinity for GPP as the substrate. CrtE of Pantoea ananatis also prefers GPP as the substrate [43]. Possibly, CrtE may function by helping to shuttle possible pools of GPP towards carotenoids or FEBS Journal 281 (2014) 4906–4920 ª 2014 FEBS

Parameter Molecular mass (kDa) Temperature optimum (°C) Temperature stability (°C) Kinetics KM (lM) IPP DMAPP GPP FPP kcat (s1) IPP DMAPP GPP FPP kcat/KM (s1mM1) IPP DMAPP GPP FPP

IdsA

CrtE

39.6 (tetramer) 30–35 ≤ 50

41.8 (dimer) 25 < 40

8 8 8 20

1 1 1 2

5 7 0.1 6

1 1 0.04 1

1.1 1.1 0.1 0.4

0.2 0.2 0.04 0.04

0.02 0.02 0.2 0.1

0.004 0.004 0.04 0.04

140 140 9 34

30 30 1 6

3 3 1600 11

1 1 250 2

other products. However, under the conditions tested, this role was not reflected in differences in carotenoid quantities or composition. The apparent superior catalytic properties of IdsA suggest that it could be a strong tool for engineering high carotenoid production in C. glutamicum. However, overproduction of IdsA (or CrtE) in a wildtype background lead only to a two-fold increase in carotenoid production (Fig. 7). Strikingly, deletion of

4913


chromosomal copies of crtE and idsA in a CrtE-overexpression or IdsA-overexpression background leads to > 10-fold increases in decaprenoxanthin yield (Fig. 7; compare the wild-type WT and DcrtEDidsA strains). This observation was consistent over all experiments, but cannot be explained straightforwardly from the available data. Either it is important for only one type of IPPS (IdsA or CrtE) to be present when overproduced, or deletion of the genomic copies of idsA and crtE resulted in deregulation of carotenoid biosynthesis. Clearly, future work needs to address the regulation of idsA and crtE expression. The highest yields of decaprenoxanthin were indeed obtained when idsA was overexpressed. Apart from the DctrEDidsA background, overexpression of the idi gene was required for a high carotenoid yield. The need for an isopentenyl diphosphate isomerase was suggested from the observation that overexpression of idsA in a DidsA background led to accumulation of the intermediate lycopene. It has been suggested that lycopene elongase uses DMAPP as the substrate [22], and under conditions where there is high IdsA activity, a shortage of DMAPP may arise and result in a bottleneck in decaprenoxanthin biosynthesis. Indeed, by equilibrating IPP and DMAPP concentrations through overexpression of the IPP isomerase gene idi, the bottleneck in decaprenoxanthin overproduction was overcome. The combined overexpression of idi and idsA in the double deletion strain yielded an amount of decaprenoxanthin that was > 1% of the total DW, which is the highest titer reported for recombinant C. glutamicum so far. The different carotenoid biosynthetic pathways described for microbial systems are based on the synthesis of a carotenoid backbone, and diversity develops through various modification reactions present in the different species [44]. In this study, we have shown that backbone biosynthesis has several levels of complexity, in which enzyme properties are involved, but probably also gene regulation systems. By deletion of chromosomal copies, deregulation of carotenoid biosynthesis was achieved, leading to strongly elevated levels of carotenoid. Thus, the early reaction steps in a carotenoid biosynthetic pathway can influence the carotenoid yield and profile decisively [45]. Further improvements in yield may be achieved by overexpressing and deregulating IPP-producing operons. The further use of modifying enzymes from other sources might allow the generation of novel carotenoids not found in nature when the genes encoding these enzymes are coexpressed with other carotenogenic genes in heterologous hosts [45,46]. 4914


Experimental procedures Bacterial strains, media, and growth conditions The strains and plasmids used in this work are listed in Table 2. C. glutamicum ATCC 13032 was used as the WT. BHI or LB medium was used for preculture of C. glutamicum strains. The main cultivation was performed in CGXII medium with 100 mM glucose as the carbon and energy source [47]. Therefore, precultured cells were washed once with CGXII medium without a carbon source and inoculated to an initial D600 nm of 1. Standard culture of C. glutamicum was performed at 30 °C in a volume of 50 mL in 500-mL flasks with two baffles shaking at 120 r.p.m. Alternatively, culture was performed in a volume of 1 mL in microtiter plates at 1100 r.p.m. and 30 °C in a Biolector microfermenation system (m2p-labs; Baesweiler, Germany). The growth was followed by measuring the D600 nm with a Shimadzu UV-1202 spectrophotometer (Duisburg, Germany). Cloning was conducted with E. coli DH5a as host, cultured in LB medium at 37 °C. When appropriate, kanamycin, spectinomycin or ampicillin was added to concentrations of 25 lgmL1 and 100 lgmL1. IPTG at concentrations of 50 lM or 1 mM, for induction of gene expression, was added at the time of inoculation of the main culture.

Recombinant DNA studies Gene amplification was performed with PCR (KOD; Novagen, Darmstadt, Germany). PCR products were purified with the PCR purification kit or MinElute PCR purification kit (Qiagen, Hilden, Germany). The oligonucleotides used in this study were obtained from Metabion (Martinsrid, Germany), and are listed in Table 3. Plasmids were constructed in E. coli DH5a and isolated with the QIAprep spin miniprep kit (Qiagen, Hilden, Germany). Plasmid construction was performed with standard restriction and ligation reactions. The Gibson assembly was also applied for the construction of plasmids [48]. The RbCl method was used for transformation of E. coli [49], and C. glutamicum was transformed via electroporation at 2.5 kV, 200 Ω, and 25 lF [47]. The correctness of the cloned DNA fragments was verified by sequencing.

Homologous overexpression of genes from C. glutamicum Plasmids harboring a putative prenyltransferase gene were constructed on the basis of pEKEx3 [50] or pVWEx1 [51], respectively, allowing IPTG-inducible overexpression. Genes were amplified from genomic DNA of C. glutamicum WT, which was prepared as described previously [52]. Amplification was carried out by PCR with the respective primers (Table 3).




Table 2. Strains and plasmids used in this study. Strain or plasmid E. coli strains DH5a BL21(DE3) C. glutamicum strains WT DcrtE DidsA DcrtEDidsA Plasmids pK19mobsacB pK19mobsacB-crtE pK19mobsacB-idsA pVWEx1 pVWEx1-idi pVWEx1-idsA pEKEx3 pEKEx3-crtEbY pEKEx3-crtE pEKEx3-idsA pEKEx3-ispB pEKEx3-crtE2YMl

pEKEx3-lbtABC pET16b pET16b-idsA pET16b-crtE

Relevant characteristics or sequence

Source or reference

F– thi-1 endA1 hsdR17(r– m–) supE44 DlacU169 (/80lacZDM15) recA1 gyrA96 relA1 F ompT hsdSB(rB mB) gal dcm (DE3)

[49]

ATCC 13032 crtE deletion mutant of C. glutamicum WT idsA deletion mutant of C. glutamicum WT crtE and idsA deletion mutant of C. glutamicum WT

[57] This work This work This work

KmR; E. coli/C. glutamicum shuttle vector for construction of insertion and deletion mutants in C. glutamicum (pK18 oriVEc sacB lacZa) pK19mobsacB with a crtE deletion construct pK19mobsacB with an idsA deletion construct KmR; E. coli/C. glutamicum shuttle vector for regulated gene expression (Ptac, lacIq, pCG1 oriVCg) pVWEx1 derivative for IPTG-inducible expression of idi from C. glutamicum, containing an artificial ribosome-binding site pVWEx1 derivative for IPTG-inducible expression of idsA from C. glutamicum containing an artificial ribosome-binding site SpecR; E. coli/C. glutamicum shuttle vector for regulated gene expression (Ptac, lacIq, pBL1 oriVCg) pEKEx3 derivative for IPTG-inducible expression of crtEb and crtY from C. glutamicum containing artificial ribosome-binding sites in front of each gene pEKEx3 derivative for IPTG-inducible expression of crtE from C. glutamicum containing an artificial ribosome-binding site pEKEx3 derivative for IPTG-inducible expression of idsA from C. glutamicum containing an artificial ribosome-binding site pEKEx3 derivative for IPTG-inducible expression of ispB from C. glutamicum containing an artificial ribosome-binding site pEKEx3 derivative for IPTG-inducible expression of crtE2 and crtYMl from Micrococcus luteus containing artificial ribosome-binding sites in front of each gene pEKEx3 derivative for IPTG-inducible expression of lbtABC from Dietzia sp. CQ4 containing artificial ribosome-binding sites in front of each gene Vector for His-tagged protein overproduction; AmpR; T7lac pET16b derivative for purification of His-tagged IdsA of C. glutamicum from E. coli BL21(DE3) pET16b derivative for purification of His-tagged CrtE of C. glutamicum from E. coli BL21(DE3)

[58]

Deletion of crtE and idsA in C. glutamicum WT Deletion of the idsA (cg2384) or crtE (cg0723) was carried out with the suicide vector pK19mobsacB [53]. Amplification of the genomic regions flanking the respective gene from genomic DNA of C. glutamicum WT was achieved by PCR with primer pairs A/B and C/D (Table 3), respectively. The PCR products were purified and linked by crossover PCR with the primer pair A/D (Table 3), SmaI-restricted, and subsequently cloned into pK19mobsacB, which resulted in the deletion vectors pK19mobsacB-crtE and pK19mobsacB-idsA (Table 2). Targeted gene deletion by two-step homologous recombi-


Novagen

This work This work [51] This work This work [50] [24] This work This work This work [24]

[24] Novagen This work This work

nation was performed as described previously, with the above-mentioned deletion vectors [54]. Integration of the vector into one of the gene-flanking regions, which represents the first recombination event, was selected via kanamycin resistance. Integration of the deletion vector into the genome triggers sucrose sensitivity, owing to the expression of sacB, encoding a levansucrase. In a second recombination event, the deletion vector is excised and clones can be selected via sucrose resistance. By PCR analysis of the selected mutant, with primer pair E/F, deletion of the respective gene could be verified (Table 3).

4915



Table 3. Oligonucleotides used in this study. Sequence in bold: artificial ribosome-binding site. Sequence in bold and italic: linker sequence for hybridization. Sequence in italic: restriction site.

Oligonucleotide

Sequence (50 - to 30 )

Underlined nucleotide (position in NC003450)

crtE_A crtE_B crtE_C crtE_D crtE_E crtE_F crtE_PstI-fw crtE_PstI-rv idsA_A idsA_B idsA_C idsA_D idsA_E idsA_F idsA_SalI-fw idsA_SalI-rv ispB_BamHI-fw ispB_BamHI-rv crtE_NdeI-fw crtE_BamHI-rv idsA_NdeI-fw idsA_XhoI-rv pVWEx-fw pVWEx-rv M13-fw M13-rv

AAAACCCGGGTAGCTCCATATAACGTGCCG CCCATCCACTAAACTTAAACAGATTGTCATGCCATTGTCCAT TGTTTAAGTTTAGTGGATGGGGCCAGCCGCAAATCTTAG AAAACCCGGGACTTCATCGGAAACTATGTCTA GTGACCATGAGGGCGAAAGC TCACATAGTCCGGCGTTTGC AAAACTGCAGGAAAGGAGGCCCTTCAGATGGACAATGGCATGACAATC AAAACTGCAGCTAAGATTTGCGGCTGGC AAAACCCGGGCTCTTCGCGAGTGTGGTTAAC CCCATCCACTAAACTTAAACAGGCATCGAAACTGCTCAA TGTTTAAGTTTAGTGGATGGGTCAACCGAACGTCGGATGTAG AAAACCCGGGAGAGACCTCAAGCAACATGG GCAGCTTCGCCAGAGTGTAT CAATGCGGACAATGCTCCAG AAAAGTCGACGAAAGGAGGCCCTTCAGTTGAGCAGTTTCGATGCC AAAAGTCGACCTACATCCGACGTTCGGTTG AAAAGGATCCGAAAGGAGGCCCTTCAGATGAGTAGCGGCCGAACC AAAAGGATCCTTATCCGACGCGCTTGACT AAAACATATGATGGACAATGGCATGACAATC AAAAGGATCCCTAAGATTTGCGGCTGGCTAG AAAACATATGATGAGCAGTTTCGATGCCCA AAAACTCGAGCTACATCCGACGTTCGGTTGA CATCATAACGGTTCTGGC ATCTTCTCTCATCCGCCA CACAGCGGGAGTGCCTATTGTTTTG CAGCGATGATCACTTCTGGCTC

– – – – – – 640 893 – – – – – – – 2 271 212 – 494 060 – – – – – – – – –

Extraction of carotenoids from bacterial cell cultures Extraction of carotenoids from C. glutamicum was performed as described previously [24], with 1-mL aliquots of the cell cultures. The pigments were extracted from the cell pellets with methanol/acetone (7 : 3) at 60 °C for 30 min, with thorough vortexing every 10 min. For some samples, several extraction cycles were needed to remove all visible colors from the cell pellet.

Analysis of carotenoids The extraction mixture was centrifuged for 5 min at 13 000 g. The clear supernatant was then transferred to a new tube and used for determination of the carotenoid content through absorbance at 470 nm by HPLC analysis (see below). HPLC analyses were performed on an Agilent 1200 series HPLC system (Agilent Technologies Sales & Services, Waldbronn, Germany), including a diode array detector for UV–visible spectrum recording for detection. Separation of the carotenoids was accomplished by application of a column system consisting of a precolumn (10 9 4-mm MultoHigh 100 RP18-5; CS Chromatographie Service,

4916

Langerwehe, Germany) and a main column (ProntoSIL 2005 C30, 250 9 4 mm; CS Chromatographie Service, Langerwehe, Germany). Concentrations were calculated by use of a standard curve and appropriate dilutions, as described previously [24]. Lycopene from tomato (Sigma, Steinheim, Germany) and b-carotene (Merck, Darmstadt, Germany) were used as standards. The carotenoids were dissolved in chloroform according to their solubilities, and diluted in methanol/acetone (7 : 3). Because of the lack of appropriate standards for decaprenoxanthin, the quantification was performed on the basis of a b-carotene standard and reported as b-carotene equivalents, by analogy with previous C50 carotenoid analyses [55]. In this study, strains producing only decaprenoxanthin diglucosides were analyzed, and are generalized as decaprenoxanthin. The separation of carotenoids by HPLC was conducted as described before [24], by the use of gradient elution with a mobile phase composition of (A) methanol and (B) methanol/methyl tert-butyl ether/ethyl acetate (5 : 4 : 1). The injection volume was 50 lL, and the flow rate was kept constant at 1.4 mLmin1. Lycopene eluted at 25.1 min, and showed absorption maxima at 446, 470 and 502 nm. Decaprenoxanthin eluted at 8.3 min, and decaprenoxanthin diglucoside eluted at 5.5 min. Both compounds showed absorption maxima at 414, 438 and 467 nm.



Overproduction and purification of the prenyltransferases CrtE and IdsA E. coli BL21(DE3) cells carrying the plasmids pET16b-crtE and pET16b-idsA, respectively, were grown at 37 °C in 500 mL of 29 YT medium with 10 lgmL1 ampicillin to a D600 nm of 0.8–1 before addition of IPTG to a final concentration of 1 mM for induction of gene expression. After induction, cells were cultured at 20 °C for an additional 4–5 h. Cells were harvested by centrifugation (13000 g), and stored at 20 °C. For cell extract preparation, thawed cells were resuspended in TNI buffer [20 mM Tris/HCl, pH 7.9, 300 mM NaCl, 5% (v/v) glycerol] with 5 mM imidazole containing a proteinase inhibitor cocktail tablet (Complete Mini; Roche, Basel, Switzerland). Cells were lysed by ultrasonication with an Ultraschalldesintegrator Sonoplus GM200, Sonotrode M72 (Bandelin, Berlin), with an amplitude of 16 lm for 2 min. After ultracentrifugation (1.5 h, 45 000 g, 4 °C), the supernatant was filtered through a 0.2-lm filter and purified by nickel affinity chromatography with nickel-activated nitrilotriacetic acid–agarose (Novagen, San Diego, CA, USA). TNI buffer containing 5 mM and 100 mM imidazole, respectively, was used for sequential washing of the column. The prenyltransferases were eluted with TNI buffer containing 400 mM imidazole, and the fractions with the highest protein concentrations were pooled. The elution buffer was exchanged against reaction buffer (50 mM Tris/HCl, pH 7.5, 1 mM MgCl2) on PD10 columns (GE Healthcare, Chalfont St Giles, UK). The purified enzymes were applied in the enzyme assays without removal of the N-terminal His-tag. Protein concentrations were determined with the Bradford assay kit (Bio-Rad Laboratories, Hercules, Canada), with BSA as reference. Protein purity was ascertained by 12% SDSPAGE. The polymeric structures of the prenyltransferases were determined by gel filtration as described previously [56], with 1 mgmL1 enzyme dissolved in 50 mM Tris/HCl (pH 7.5) with 1 mM MgCl2.

Enzyme activity measurements The activity of the prenyltransferases was determined by the continuous measurement of the released pyrophosphate with a pyrophosphatase/purine nucleoside phosphorylase (PNP)-coupled spectrophotometric assay (EnzChek Pyrophosphate Assay Kit; Life Technologies, Darmstadt, Germany). All assays were carried out at 30 °C in a total volume of 300 lL containing 50 mM Tris/HCl (pH 7.5), 1 mM MgCl2, 0.2 mM 2-amino-6-mercapto-7-methylpurine ribonucleoside, 1 U of PNP, 0.03 U of inorganic pyrophosphatase, and different concentrations of prenylpyrophosphates. The reaction was started by addition of the purified enzymes. Continuous absorption measurements were carried out at 360 nm with a Shimadzu UV-1650 PC photometer (Shimadzu).



Acknowledgements S. A. E. Heider, P. Peters-Wendisch and V. F. Wendisch acknowledge support from EU project PROMYSE. S. A. E. Heider, P. Peters-Wendisch and V. F. Wendisch acknowledge S. Siwiora Brenke and A. Schemel for performing the gel filtration analyses.

Author contributions S. A. E. Heider planned and performed experiments, analyzed data, and wrote the paper. P. Peters-Wendisch analyzed data and wrote the paper. J. Beekwilder performed experiments, analyzed data, and wrote the paper. V. F. Wendisch designed and coordinated the study, analyzed data, and wrote the paper.

References 1 Thulasiram HV, Erickson HK & Poulter CD (2007) Chimeras of two isoprenoid synthases catalyze all four coupling reactions in isoprenoid biosynthesis. Science 316, 73–76. 2 Liang PH (2009) Reaction kinetics, catalytic mechanisms, conformational changes, and inhibitor design for prenyltransferases. Biochemistry 48, 6562–6570. 3 Heider SA, Peters-Wendisch P, Wendisch VF, Beekwilder J & Brautaset T (2014) Metabolic engineering for the microbial production of carotenoids and related products with a focus on the rare C50 carotenoids. Appl Microbiol Biotechnol 98, 4355–4368. 4 Rohmer M, Knani M, Simonin P, Sutter B & Sahm H (1993) Isoprenoid biosynthesis in bacteria: a novel pathway for the early steps leading to isopentenyl diphosphate. Biochem J 295 (Pt 2), 517–524. 5 Ogura K & Koyama T (1998) Enzymatic aspects of isoprenoid chain elongation. Chem Rev 98, 1263–1276. 6 Liang PH, Ko TP & Wang AH (2002) Structure, mechanism and function of prenyltransferases. Eur J Biochem 269, 3339–3354. 7 Gershenzon J & Kreis W (1999) Biosynthesis of monoterpenes, sesquiterpenes, diterpenes, sterols, cardiac glycosides and steroid saponins. In Biochemistry of Plant Secondary Metabolism (Wink M, ed.), pp. 222–299. Sheffield Academic Press, Sheffield. 8 Burke CC, Wildung MR & Croteau R (1999) Geranyl diphosphate synthase: cloning, expression, and characterization of this prenyltransferase as a heterodimer. Proc Natl Acad Sci USA 96, 13062–13067. 9 Tholl D, Kish CM, Orlova I, Sherman D, Gershenzon J, Pichersky E & Dudareva N (2004) Formation of

4917


10

11

12

13

14

15

16

17

18

19

20

monoterpenes in Antirrhinum majus and Clarkia breweri flowers involves heterodimeric geranyl diphosphate synthases. Plant Cell 16, 977–992. Schmidt A, Wachtler B, Temp U, Krekling T, Seguin A & Gershenzon J (2010) A bifunctional geranyl and geranylgeranyl diphosphate synthase is involved in terpene oleoresin formation in Picea abies. Plant Physiol 152, 639–655. Cervantes-Cervantes M, Gallagher CE, Zhu C & Wurtzel ET (2006) Maize cDNAs expressed in endosperm encode functional farnesyl diphosphate synthase with geranylgeranyl diphosphate synthase activity. Plant Physiol 141, 220–231. Hsiao YY, Jeng MF, Tsai WC, Chuang YC, Li CY, Wu TS, Kuoh CS, Chen WH & Chen HH (2008) A novel homodimeric geranyl diphosphate synthase from the orchid Phalaenopsis bellina lacking a DD(X)2-4D motif. Plant J 55, 719–733. Ashby MN, Spear DH & Edwards PA (1990) Prenyltransferases from yeast to man. In Molecular Biology of Atherosclerosis (Attic AD, ed.), pp. 27–34. Elsevier Science Publishers, Amsterdam. Marrero PF, Poulter CD & Edwards PA (1992) Effects of site-directed mutagenesis of the highly conserved aspartate residues in domain II of farnesyl diphosphate synthase activity. J Biol Chem 267, 21873–21878. Joly A & Edwards PA (1993) Effect of site-directed mutagenesis of conserved aspartate and arginine residues upon farnesyl diphosphate synthase activity. J Biol Chem 268, 26983–26989. Song L & Poulter CD (1994) Yeast farnesyldiphosphate synthase: site-directed mutagenesis of residues in highly conserved prenyltransferase domains I and II. Proc Natl Acad Sci USA 91, 3044–3048. Koyama T, Tajima M, Sano H, Doi T, KoikeTakeshita A, Obata S, Nishino T & Ogura K (1996) Identification of significant residues in the substrate binding site of Bacillus stearothermophilus farnesyl diphosphate synthase. Biochemistry 35, 9533–9538. Ohnuma S, Hirooka K, Hemmi H, Ishida C, Ohto C & Nishino T (1996) Conversion of product specificity of archaebacterial geranylgeranyl-diphosphate synthase. Identification of essential amino acid residues for chain length determination of prenyltransferase reaction. J Biol Chem 271, 18831–18837. Stanley Fernandez SM, Kellogg BA & Poulter CD (2000) Farnesyl diphosphate synthase. Altering the catalytic site to select for geranyl diphosphate activity. Biochemistry 39, 15316–15321. Tarshis LC, Yan M, Poulter CD & Sacchettini JC (1994) Crystal structure of recombinant farnesyl resolution. Biochemistry diphosphate synthase at 2.6 A 33, 10871–10877.

4918


21 Krubasik P, Takaichi S, Maoka T, Kobayashi M, Masamoto K & Sandmann G (2001) Detailed biosynthetic pathway to decaprenoxanthin diglucoside in Corynebacterium glutamicum and identification of novel intermediates. Arch Microbiol 176, 217–223. 22 Krubasik P, Kobayashi M & Sandmann G (2001) Expression and functional analysis of a gene cluster involved in the synthesis of decaprenoxanthin reveals the mechanisms for C50 carotenoid formation. Eur J Biochem 268, 3702–3708. 23 Heider SA, Peters-Wendisch P & Wendisch VF (2012) Carotenoid biosynthesis and overproduction in Corynebacterium glutamicum. BMC Microbiol 12, 198. 24 Heider SA, Peters-Wendisch P, Netzer R, Stafnes M, Brautaset T & Wendisch VF (2014) Production and glucosylation of C50 and C40 carotenoids by metabolically engineered Corynebacterium glutamicum. Appl Microbiol Biotechnol 98, 1223–1235. 25 Frohwitter J, Heider SA, Peters-Wendisch P, Beekwilder J & Wendisch VF (2014) Production of the sesquiterpene (+)-valencene by metabolically engineered Corynebacterium glutamicum. J Biotechnol doi: 10.1016/ j.jbiotec.2014.05.032. 26 Sandmann G & Yukawa H (2005) Vitamin synthesis: carotenoids, biotin and pantothenate. In Handbook of Corynebacterium glutamicum (Eggeling L & Bott M, eds), pp. 399–417. CRC Press, Boca Raton, USA. 27 Grover S, Alderwick LJ, Mishra AK, Krumbach K, Marienhagen J, Eggeling L, Bhatt A & Besra GS (2014) Benzothiazinones mediate killing of Corynebacterineae by blocking decaprenyl phosphate recycling involved in cell wall biosynthesis. J Biol Chem 289, 6177–6187. 28 Huang H, Berg S, Spencer JS, Vereecke D, D’Haeze W, Holsters M & McNeil MR (2008) Identification of amino acids and domains required for catalytic activity of DPPR synthase, a cell wall biosynthetic enzyme of Mycobacterium tuberculosis. Microbiology 154, 736–743. 29 Bott M & Niebisch A (2005) Respiratory energy metabolism. In Handbook of Corynebacterium glutamicum (Eggeling L & Bott M, eds), pp. 305–332. CRC Press, Boca Raton, USA. 30 Collins MD, Goodfellow M & Minnikin DE (1979) Isoprenoid quinones in the classification of coryneform and related bacteria. J Gen Microbiol 110, 127–136. 31 Kanzaki T, Sugiyama Y, Kitano K, Ashida Y & Imada I (1974) Quinones of Brevibacterium. Biochim Biophys Acta 348, 162–165. 32 Saiki K, Mogi T & Anraku Y (1992) Heme O biosynthesis in Escherichia coli: the cyoE gene in the cytochrome bo operon encodes a protoheme IX farnesyltransferase. Biochem Biophys Res Commun 189, 1491–1497.



33 Saiki K, Mogi T, Hori H, Tsubaki M & Anraku Y (1993) Identification of the functional domains in heme O synthase. Site-directed mutagenesis studies on the cyoE gene of the cytochrome bo operon in Escherichia coli. J Biol Chem 268, 26927–26934. 34 Seif E & Hallberg BM (2009) RNA-protein mutually induced fit: structure of Escherichia coli isopentenyltRNA transferase in complex with tRNA(Phe). J Biol Chem 284, 6600–6604. 35 Okada K, Minehira M, Zhu X, Suzuki K, Nakagawa T, Matsuda H & Kawamukai M (1997) The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli. J Bacteriol 179, 3058–3060. 36 Sagami H & Ogura K (1985) Geranylpyrophosphate synthetase-geranylgeranylpyrophosphate synthetase from Micrococcus luteus. Methods Enzymol 110, 188–192. 37 Chang TH, Guo RT, Ko TP, Wang AH & Liang PH (2006) Crystal structure of type-III geranylgeranyl pyrophosphate synthase from Saccharomyces cerevisiae and the mechanism of product chain length determination. J Biol Chem 281, 14991–15000. 38 Kavanagh KL, Dunford JE, Bunkoczi G, Russell RG & Oppermann U (2006) The crystal structure of human geranylgeranyl pyrophosphate synthase reveals a novel hexameric arrangement and inhibitory product binding. J Biol Chem 281, 22004–22012. 39 Chen A & Poulter CD (1994) Isolation and characterization of idsA: the gene for the short chain isoprenyl diphosphate synthase from Methanobacterium thermoautotrophicum. Arch Biochem Biophys 314, 399– 404. 40 Mishra AK, Alderwick LJ, Rittmann D, Tatituri RV, Nigou J, Gilleron M, Eggeling L & Besra GS (2007) Identification of an alpha(1,6) mannopyranosyltransferase (MptA), involved in Corynebacterium glutamicum lipomanann biosynthesis, and identification of its orthologue in Mycobacterium tuberculosis. Mol Microbiol 65, 1503–1517. 41 Pfeifer-Sancar K, Mentz A, Ruckert C & Kalinowski J (2013) Comprehensive analysis of the Corynebacterium glutamicum transcriptome using an improved RNAseq technique. BMC Genomics 14, 888. 42 Mentz A, Neshat A, Pfeifer-Sancar K, Puhler A, Ruckert C & Kalinowski J (2013) Comprehensive discovery and characterization of small RNAs in Corynebacterium glutamicum ATCC 13032. BMC Genomics 14, 714. 43 Wiedemann M, Misawa N & Sandmann G (1993) Purification and enzymatic characterization of the geranylgeranyl pyrophosphate synthase from Erwinia uredovora after expression in Escherichia coli. Arch Biochem Biophys 306, 152–157.



44 Umeno D, Tobias AV & Arnold FH (2005) Diversifying carotenoid biosynthetic pathways by directed evolution. Microbiol Mol Biol Rev 69, 51–78. 45 Song GH, Kim SH, Choi BH, Han SJ & Lee PC (2013) Heterologous carotenoid-biosynthetic enzymes: functional complementation and effects on carotenoid profiles in Escherichia coli. Appl Environ Microbiol 79, 610–618. 46 Tobias AV & Arnold FH (2006) Biosynthesis of novel carotenoid families based on unnatural carbon backbones: a model for diversification of natural product pathways. Biochim Biophys Acta 1761, 235–246. 47 Eggeling L & Reyes O (2005) Experiments. In Handbook of Corynebacterium glutamicum (Eggeling L & Bott M, eds), pp. 3535–3566. CRC Press, Boca Raton, USA. 48 Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA III & Smith HO (2009) Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6, 343–345. 49 Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557–580. 50 Stansen C, Uy D, Delaunay S, Eggeling L, Goergen JL & Wendisch VF (2005) Characterization of a Corynebacterium glutamicum lactate utilization operon induced during temperature-triggered glutamate production. Appl Environ Microbiol 71, 5920–5928. 51 Peters-Wendisch PG, Schiel B, Wendisch VF, Katsoulidis E, Mockel B, Sahm H & Eikmanns BJ (2001) Pyruvate carboxylase is a major bottleneck for glutamate and lysine production by Corynebacterium glutamicum. J Mol Microbiol Biotechnol 3, 295–300. 52 Eikmanns BJ, Rittmann D & Sahm H (1995) Cloning, sequence analysis, expression, and inactivation of the Corynebacterium glutamicum icd gene encoding isocitrate dehydrogenase and biochemical characterization of the enzyme. J Bacteriol 177, 774–782. 53 Sch€afer A, Tauch A, J€ager W, Kalinowski J, Thierbach G & Puhler A (1994) Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69–73. 54 Eggeling L & Bott M (2005) Handbook of Corynebacterium glutamicum. CRC Press, Boca Raton, FL. 55 Netzer R, Stafsnes MH, Andreassen T, Goksoyr A, Bruheim P & Brautaset T (2010) Biosynthetic pathway for gamma-cyclic sarcinaxanthin in Micrococcus luteus: heterologous expression and evidence for diverse and multiple catalytic functions of C(50) carotenoid cyclases. J Bacteriol 192, 5688–5699.

4919


56 Lindner SN, Vidaurre D, Willbold S, Schoberth SM & Wendisch VF (2007) NCgl2620 encodes a class II polyphosphate kinase in Corynebacterium glutamicum. Appl Environ Microbiol 73, 5026–5033. 57 Abe S, Takayarna K & Kinoshita S (1967) Taxonomical studies on glutamic acid

4920


producing bacteria. J Gen Appl Microbiol 13, 279–301. 58 Sch€afer T, Selig M & Sch€ onheit P (1993) Acetyl-CoA synthetase (ADP forming) in archaea, a novle enzyme involved in acetate formation and ATP synthesis. Arch Microbiol 159, 72–83.


Isoprenoid Pyrophosphate-Dependent Transcriptional Regulation of Carotenogenesis in Corynebacterium glutamicum.

Functional characterization of the Xanthophyllomyces dendrorhous farnesyl pyrophosphate synthase and geranylgeranyl pyrophosphate synthase encoding genes that are involved in the synthesis of isoprenoid precursors.

The small 6C RNA of Corynebacterium glutamicum is involved in the SOS response.

Silencing of cryptic prophages in Corynebacterium glutamicum.

Lysine uptake and exchange in Corynebacterium glutamicum.

A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana.

The crtE gene in Erwinia herbicola encodes geranylgeranyl diphosphate synthase.

Corynebacterium glutamicum possesses β-N-acetylglucosaminidase.

Ciprofloxacin triggered glutamate production by Corynebacterium glutamicum.

Identification and functional analysis of the geranylgeranyl pyrophosphate synthase gene (crtE) and phytoene synthase gene (crtB) for carotenoid biosynthesis in Euglena gracilis.

Artificial oxidative stress-tolerant Corynebacterium glutamicum.

Engineering Corynebacterium glutamicum for violacein hyper production.

Free (S,S)-diaminopimelate is not an obligatory intermediate in lysine biosynthesis in Corynebacterium glutamicum.

tRNA-dependent alanylation of diacylglycerol and phosphatidylglycerol in Corynebacterium glutamicum.

Genetic characterization of 4-cresol catabolism in Corynebacterium glutamicum.

Identification of essential tryptophan in amylomaltase from Corynebacterium glutamicum.

A third glucose uptake bypass in Corynebacterium glutamicum ATCC 31833.

Pupylated proteins in Corynebacterium glutamicum revealed by MudPIT analysis.

Functional Characterization of Corynebacterium alkanolyticum β-Xylosidase and Xyloside ABC Transporter in Corynebacterium glutamicum.

Structural organization of the Corynebacterium glutamicum plasmid pCG100.

Engineering Corynebacterium glutamicum for the production of 2,3-butanediol.

Nucleotide sequence of the dapA gene from Corynebacterium glutamicum.

Alternative photophosphorylation, inorganic pyrophosphate synthase and inorganic pyrophosphate.

Engineering Corynebacterium glutamicum to produce 5-aminolevulinic acid from glucose.