Ikaros could be a key factor in the maintenance of "B-side" of B-1 cells.

G Model IMBIO-51339; No. of Pages 8

ARTICLE IN PRESS Immunobiology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Immunobiology journal homepage: www.elsevier.com/locate/imbio

Ikaros could be a key factor in the maintenance of “B-side” of B-1 cells Vivian Cristina Oliveira a,1 , Nilmar Silvo Moretti b,2 , Leonardo da Silva Augusto b,2 , Sergio Schenkman b,2 , Mario Mariano a,c,1,3 , Ana Flavia Popi a,∗,1 a b c

Disciplina de Imunologia, Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, Brazil Disciplina de Biologia Celular, Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, Brazil Programa de Pós-Graduação em Patologia Ambiental e Experimental–Instituto de Ciências da Saúde Universidade Paulista (UNIP), Brazil

a r t i c l e

i n f o

Article history: Received 22 December 2014 Received in revised form 14 April 2015 Accepted 5 June 2015 Available online xxx Keywords: Ikaros B-1 cells PU.1

a b s t r a c t Ikaros, a zinc finger transcription factor, is an important regulator of the hematopoietic system. Several studies have suggested the role of Ikaros in the development, maturation, activation and differentiation of lymphocytes. To elucidate this mechanism, it is important to understand how this transcription factor works in the dichotomy of the hematopoietic system, a topic that remains uncertain. Herein, we investigated the role of Ikaros in the control of the lymphomyeloid phenotype of B-1 lymphocytes. We found that Ikaros, as well as its target genes, are expressed in B-1 cells,. Moreover, Ikaros positively regulates the expression of Flt3, Gfi and Il7r, while it down-regulates PU.1. During the induction of differentiation of B-1 cells toward phagocytes, Ikaros transcription was reduced. Taken together, these data pointed to the relevance of Ikaros in the maintenance of the promiscuous gene profile of B-1 cells. It could be suggested that Ikaros functions as a guardian of B-1 lymphoid pattern, and that its absence directs the differentiation of B-1 cells into phagocytes. © 2015 Elsevier GmbH. All rights reserved.

1. Introduction The hematopoietic system is continuously formed by a population of multipotent stem cells in the adult bone marrow. In the hierarchical model, the hematopoietic stem cells branch early into myeloid and lymphoid progenitors (Kondo, 2010). There are many factors involved in this dichotomy of the hematopoietic system (Kondo, 2010; Georgopoulos, 2002). Most of them are transcription factors that regulate gene expression by inducing the activation or

Abbreviations: CEDEME, Centro de Desenvolvimento de Modelos Experimentais para Medicina e Biologia da Universidade Federal de São Paulo; ChIP, chromatin immunoprecipitation; CLL, chronic lymphocytic leukemia; CLPs, commom lymphoid progenitor; FBS, fetal bovine serum; GFP, green fluoresce protein; LMPPs, lymphoid-primed multipotent progenitors; pre-B-1CDP, pre-B-1-cellderived-phagocyte; siRNA, small interference RNA. ∗ Corresponding author at: Rua Botucatu, 862 – 4th floor – Edificio Ciencias Biomédicas, Vila Clementino, São Paulo, Brazil. Fax: +55 1155496073. E-mail addresses: vi [email protected] (V.C. Oliveira), [email protected] (N.S. Moretti), [email protected] (L.d.S. Augusto), [email protected] (S. Schenkman), [email protected] (M. Mariano), [email protected] (A.F. Popi). 1 Rua Botucatu, 862 – 4th floor – Edifício Ciências Biomédicas Vila Clementino, São Paulo, Brazil. 2 Rua Pedro de Toledo, 669 – 6th floor – Ed. Pesquisa II Vila Clementino, São Paulo, Brazil. 3 Av. José Maria Whitaker, 290 São Paulo, SP, Brazil.

silencing of lineage specific genes, thus driving the cell commitment to a definitive lineage (Georgopoulos, 2002; Krajewski, 2013). Among these transcription factors, Ikaros is an important regulator of lymphoid development and differentiation (Georgopoulos et al., 1992, 1994). The Ikzf1 gene encodes many Ikaros isoforms which are generated by alternative splicing and is widely expressed in the hematopoietic system (Molnar and Georgopoulos, 1994). The N-terminal domain of Ikaros mediates sequence-specific DNA binding, while the C-terminus is required for protein–protein interaction (Molnar and Georgopoulos, 1994). Many reports have shown the role of Ikaros in the development, maturation, activation and differentiation of lymphocytes (Georgopoulos et al., 1994; Reynaud et al., 2008; Kirstetter et al., 2002). Furthermore, it has been demonstrated that Ikaros is directly associated with some hematopoietic diseases and the deregulation of Ikaros promotes the development of many malignant disorders as multiple myeloma and leukemia (Nakayama et al., 1999; Olivero et al., 2000; Yagi et al., 2002; Orozco et al., 2013; Errico, 2014; Joshi et al., 2014; Li et al., 2011; Capece et al., 2013). It has been well documented that the loss of Ikaros completely blocks B cell development (Georgopoulos et al., 1994; Wang et al., 1996), with the formation of lymphoid-primed multipotent progenitors (LMPPs), despite the impairment in producing common lymphoid progenitors (CLPs) (Reynaud et al., 2008; Yoshida et al., 2006). One reasonable explanation for this LMPP blockade is that,

http://dx.doi.org/10.1016/j.imbio.2015.06.010 0171-2985/© 2015 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Oliveira, V.C., et al., Ikaros could be a key factor in the maintenance of “B-side” of B-1 cells. Immunobiology (2015), http://dx.doi.org/10.1016/j.imbio.2015.06.010


ARTICLE IN PRESS V.C. Oliveira et al. / Immunobiology xxx (2015) xxx–xxx

2

in the absence of Ikaros, the hematopoietic precursors lack expression of Flt3 (Yoshida et al., 2006). Regarding LMPPs, the loss of myeloid potential en route to lymphoid specification is a more gradual process and is associated with increasing expression of Flt3 (Adolfsson et al., 2005, 2001; Månsson et al., 2007). Subsequently, the emergence of CLPs from LMPPs is delineated by the increased expression of the a chain of the receptor for interleukin 7 (IL-7R)(Kang and Der, 2004). Despite of this, IL-7R signaling is not absolutely required for the generation of these cells but is indispensable in their ability to differentiate into pre-pro-B lymphocytes and to undergo cytokine-induced expansion (Dias et al., 2005; Kikuchi et al., 2005). The impairment of LMPPS in producing B and T cells in the absence of Ikaros, could be related to reduced expression of lymphoid genes including Il7r and Rag1 (Nutt and Kee, 2007). Interestingly, mice lacking both Flt3- and IL-7R- derived signals fail to develop all B lymphocytes, confirming that these receptors are essential for B cell development (Nutt and Kee, 2007). Accordingly to Nutt and Kee (2007), the failure in the expression of Flt3 and IL-7R in the absence of Ikaros could suggest an overlap of functions for Ikaros and PU.1 in the earlier steps of lymphoid specification. In an antagonistic role, PU.1 and Gfi function in a graded manner to regulate macrophage versus B cell generation. A higher concentration of PU.1 favors a macrophage fate, while lower doses of PU.1 are accompanied by Gfi1 expression, promoting B cell fate choice at the expense of myeloid progeny (Spooner et al., 2009). It has also been proposed that, during B cell development, Ikaros enables the expression of EBF and PAX5, which are B cell signature determinants, and maintains the repressed state of alternative-lineage genes, such as myeloid genes (Ferreirós-Vidal et al., 2013). B-1 cells are a subtype of mature B lymphocytes found preferentially in serous cavities, such as the peritoneum and pleura (Hayakawa et al., 1983; Herzenberg and Kantor, 1993). Currently, it is assumed that B-1 and B-2 cells originate from different progenitors, and these progenitors are present in different developmental stages of the organism (Montecino-Rodriguez et al., 2006). Interestingly, several authors have found that B-1 cells have biphenotypic potential and can differentiate into phagocytes in vitro (Almeida et al., 2001). Moreover, these cells present a promiscuous gene profile, simultaneously expressing lymphoid and myeloid transcription factors (Popi et al., 2009; Mussalem et al., 2012; Borrello and Phipps, 1999). Considering that Ikaros is pivotal in hematopoiesis, we aimed to investigate its role in the promiscuous phenotype of B-1 cells. Our results show that B-1 cells express Ikaros. Despite of interaction with some target genes similarly to that in B-2 lymphocytes, our data suggested that PU.1 expression is negatively regulated by Ikaros in B-1 cells and that Ikaros silencing could be a key factor to guide the myeloid commitment of B-1 cells along their differentiation to phagocytes. 2. Methods 2.1. Mice BALB/c male mice (8–10 weeks old) were obtained from CEDEME (Centro de Desenvolvimento de Modelos Experimentais para Medicina e Biologia da Universidade Federal de São Paulo). All animals were maintained under specific pathogen free conditions. All procedures described herein were approved by the Ethical Committee of UNIFESP (2013/360870). 2.2. B-1 cell ex vivo enrichment B-1 cells were obtained from total peritoneal cells. Initially, the lymphocyte population was determined by size population in

FSC × SSC dot plots. Doublet exclusion was performed as described by Ghosn et al. (2008). Finally, cells were depleted of positive cells for CD117, CD11c, F4/80, Gr.1, CD3e and CD23 to exclude precursors, dendritic cells, monocytes/macrophages, granulocytes, T cells and conventional B cells as described by Montecino-Rodriguez et al. (2006). All antibodies used were from Becton Dickinson (BD Biosciences). The analysis of this negative population showed that 95% were B-1 cells (data not shown).

2.3. Peritoneal cells culture, flow cytometry analysis and cell population enrichment Peritoneal cells were cultured as previously described by Almeida et al. (2001). The non-adherent and adherent cell fractions were collected separately and submitted to flow cytometry analysis to quantify and sort B-1 cells (CD19+ F4/80− cells) and the pre-B-1CDP (B-1 cell derived phagocyte) (CD19+ /F4/80+ cells) population, respectively. Cell suspensions were preincubated with anti-CD16/CD32 monoclonal antibody (mAb) to block Fc␥RII/III and stained on ice for 15 min with the following fluorochromeconjugated mAb: phycoerythrin-labeled anti-CD19 and Pacific Orange-labeled anti F4/80. Antibodies were purchased from Invitrogen. Cells were analyzed on FACSCantoII system (BD Biosciences) or Attune Acoustic Focusing Cytometer (Applied Biosystems) and purified on FACSAriaIII cell sorters (BD Biosciences). Postacquisition analyses were performed with FlowJo software (version 9.7.6).

2.4. Gene expression analysis RNA was isolated by using the pure link kit RNA (Life Technologies) from purified B-1 cells, pre-B-1CDP, bone marrow, or transfected B-1 cells. cDNA was obtained using the Superscript III CellsDirect cDNA Synthesis kit (Invitrogen-Life Technologies). Expression levels were assessed by real-time PCR using a FAST Sybr Green Reagent (Applied Biosystems) on an Applied Biosystems 7500 Fast Real-Time PCR System. All primers used are shown in Table 1. The amplification efficiencies were determined by comparing the dilution series of reference and target genes from a reference cDNA template. The amplification efficiency was calculated using the following equation: E = 10(−1/slope) − 1, where E is the efficiency, and the slope is the value obtained by constructing a standard curve. A validation was performed to evaluate whether the efficiencies of the target and the reference gene were approximately equal (90% ≤ E ≤ 110%). If the target and the reference genes had comparable amplification efficiencies, relative quantification was determined according to the 2−DCt method (Schmittgen and Livak, 2008; Vandesompele et al., 2002). The reference gene used was ARBP or Ikaros. Each reaction was carried out in triplicate using at least three biological samples. The sample used for normalization is indicated in each experiment.

2.5. Immunoblotting Protein extracts were obtained from isolated cells (1 × 106 ) for Western blotting analysis. The reactions were performed with the following antibodies: anti-Ikaros (1:1000; Cell Signaling), antiGAPDH (1:10000; Sigma) and secondary antibody anti-rabbit IgG (1:1000; Sigma). The signals were visualized using Supersignal West Pico Chemiluminescent Substrate (GE Healthcare), and images were captured by UVITEC Cambridge software. The same software was used to calculate band intensities.


G Model

ARTICLE IN PRESS

IMBIO-51339; No. of Pages 8

V.C. Oliveira et al. / Immunobiology xxx (2015) xxx–xxx

3

Table 1 The nucleotides sequences of the primers used the reactions of real time PCR. Primer

Forward sequence

Reverse sequence

lkaros (ikzf1) Flt3 (CD135) Gfi ll7r PU.1 (sfpi1) E2A (tcf3) EBF (ebf1) M-CSFR (csfr1r) Promoter Flt3 Promoter Gfi Promoter PU.1 Promoter ll7r Pax-5 ARBP

CCACAACGAGATGGCAGAAGAC CGCGGCCTCTGGAGAGAGGTT AGAAGGCGCACAGCTATCAC GCGGACGATCACTCTTCTG ATGTTACAGGCGTGCAAAATGG CCATGCTAGGTGACGGCTCTTC GGTGGAAGTCACACTGTCGTAC TGTCATCGAGCCTAGTGGC GGAGGACTGCTGTGATGGAG GGAAGTCTCCAGGAGCCAAG TGGAGAAACCGGGAGAACTG AGTTCAGGAGCTTCAGGGAA TGACGCAGGTGTCATCGGTGAG AGCTGAAGCAAAGGAAGAGTCGG

GGCATGTCTGACAGGCACTTGT GGTGGCTCGCTGAAGGATGCG GGCTCCATTTTCGACTCGC AGCCCCACATATTTGAAATTCCA TGATCGCTATGGCTTTCTCCA GCGAGCCATTAACCTCAGATCC GTAACCTCTGGAAGCCGTAGTC CGGGAGATTCAGGGTCCAAG TTCCCGTGCATCAAGCTGAA GCAGCCCCCAATTTGTTTGT TCCAGACTTCTCAAGTGGGC TTGCTGCTGTAAGCAGAGGT ATTCGGCACTGGAGACTCCTGA ACTTGGTTGCTTTGGCGGGATTAG

2.6. Immunofluorescence Purified B-1 cells, transfected or not, were seeded on glass coverslips coated with poly-l-lysine and incubated for 30 min for attachment. Cells were then fixed with 4% p-formaldehyde in PBS, permeabilized with 0.1% Triton X-100 in PBS and incubated with polyclonal antibody anti-Ikaros (1:200; Santa Cruz), followed by incubation with fluorescein isothiocyanate (FITC) conjugated to anti-rabbit IgG (1:1000; Sigma) and 1 ␮M DAPI. The cells were observed in an Olympus (BX-61) microscope equipped with a ×100 plan apo-oil objective (NA 1.4). 2.7. Chromatin immunoprecipitation (ChIP) Ikaros binding was assayed by the Magnify Chromatin Immunoprecipitation System (Invitrogen – Life Technologies), following the manufacturer’s protocol. Dynabeads were previously incubated with anti-histone antibody (Sigma – positive control), anti-IgG (Invitrogen – Life Technologies – negative control) or anti-Ikaros (Santa Cruz) for 1 h at 4 ◦ C. The crosslinking of proteins was performed by 1% formaldehyde in PBS for 10 min. Thereafter, cells were lysed by sonication using Sonication Bioruptor Sonication System (Diagenode). The soluble chromatin was diluted as described by the manufacturer, and subsequently incubated with the Dynabeads previously coupled with antibody for 2 h at 4 ◦ C. Bound and input samples were collected, the crosslinking was reversed, and the DNA was purified by the Magnify Chromatin Immunoprecipitation System (Invitrogen – Life Technologies) and subjected to amplification using the thermocycler 7500 Fast Real-Time PCR System (Applied Biosystems). Samples were analyzed by real-time PCR using the FAST Sybr Green Reagent (Applied Biosystems) for the Flt3, Gfi, Il7r and PU.1. The threshold for the promoter under study was adjusted by that of input values and was represented as relative enrichment, calculated accordingly as follows: 2(−Ct) where Ct is calculated as [Ct (sample) – Ct (input)], and Ct is calculated as (Ct (sample) – Ct negative control) (Mukhopadhyay et al., 2008). The input represents the genomic DNA, and the negative control is the immunoprecipitated samples with the irrelevant antibody IgG. Anti-histone H3 was used as a positive control. The primers were designed according to the location of the binding region of Ikaros (GGGAAA) (Georgopoulos, 2002). The nucleotides sequences of the primers are shown in Table 1.

de FBS (fetal bovine serum) for 72–96 h at 37 ◦ C in 5% CO2 . After 48 h of culture, R10 medium was added. The silencing of Ikaros was analyzed by real-time PCR, Western blotting and immunofluorescence, as described above. Evaluation of the transduction efficiency with fluorescein-labeled siRNA revealed that nearly 85% of cells were positive to GFP (green fluoresce protein) (data not shown). 3. Results 3.1. B-1 cells express Ikaros and its target genes. Several reports have demonstrated that Ikaros modulates the expression of some genes involved in the hematopoietic system differentiation (Spooner et al., 2009; Yoshida et al., 2006; Nichogiannopoulou et al., 1999; Georgopoulos, 2002; Zarnegar and Rothenberg, 2012). To investigate the role of Ikaros in the maintenance of the biphenotypic potential of B-1 cells, we evaluated Ikaros expression by these cells. As shown in Fig. 1A, the protein expression levels of B-1 cells were similar to those of total spleen cells. Furthermore, it was possible to note that Ikaros distribution in B-1 cell nuclei was punctuate, similar to that in conventional B lymphocytes (Brown et al., 1997) (Fig. 1B). Ikaros and other transcription factors act within a network to regulate lymphoid or myeloid cell commitment, as proposed by (Spooner et al. (2009). It has been described that cells from Ik−/− mice lack the expression of Flt3 and show reduced expression of IL7R, suggesting that both factors are direct or indirectly regulated by Ikaros (Yoshida et al., 2006; Nichogiannopoulou et al., 1999). Additionally, Ikaros directly promotes Gfi expression in LMPPs (Spooner et al., 2009). In the model proposed by Spooner et al. (2009), the reduced concentration of PU.1 that promotes B lymphoid development is achieved by Ikaros, in part, through the induction of Gfi1. Ikaros and Gfi1 constrain the expression of PU.1 while they promote the expression of B lymphoid genes (Spooner et al., 2009). To elucidate the role of Ikaros in the lymphoid/myeloid commitment of B-1 cells, we analyzed the expression of Ikaros and its target genes by these cells. The level of Ikaros mRNA in B-1 cells was 3-fold higher than that in total bone marrow cells (Fig. 1C). Furthermore, PU.1 is highly expressed in B-1 cells compared to total bone marrow cells. Although IL7-R and Gfi1 were expressed, their level of expression was reduced in B-1 cells compared with total bone marrow cells. Flt3 was expressed by B-1 at a very low level compared with that in total bone marrow cells (data not shown).

2.8. RNA interference assays Ikaros-specific siRNA (small interference RNA) from siRNA Accell SMART (Thermo Scientific Dharmacon) was used to silence the expression of Ikaros in B-1 cells. Purified B-1 cells (5 × 105 cells) were cultured in the 96-wells plates with 100 ␮l of siRNA plus 3%

3.2. Ikaros modulates the lymphoid and myeloid profiles of B-1 cells To investigate the function of Ikaros in regulating the expression of genes involved in B-1 cell development, we performed chromatin


G Model

ARTICLE IN PRESS



4

Fig. 1. Ikaros expression by B-1 cells. (A) Western blotting performed with 25 ␮g of total protein from B-1 cells (1) and total spleen cells (2). Immunoblotts were probed with anti-Ikaros (1:1000) and anti-GAPDH (1:10000). The relative expression was obtained from the quantification of Ikaros band intensities relative to GAPDH band intensities (n = 5). (B) Immunofluorescence of Ikaros in B-1 cells. Immunofluorescence images of DAPI and Ikaros are representative of two experiments. DAPI, anti-Ikaros antibody (1:50). Bars = 15 ␮m. (C) Ikaros and target genes expression by B-1 cells. The ARBP gene was used as a reference gene. The relative expression was defined using the 2−Ct method, considering bone marrow cells as a normalizer. N = 3 sample per experiment. Data shown are representative of 2 experiments.

Binding ratio IP/input

6

4

2

rP U

.1

r ot e om pr

om

ot e

r

Il7

rG fi ot e pr

om

pr

pr

om

ot er

Fl t3

0

B-1 cells were quite similar to those from LMPPs (Spooner et al., 2009). To evaluate the role of Ikaros in the expression of its target genes in B-1 cells, we performed Ikaros knockdown using a small interference RNA-specific sequence (Ikaros-siRNA). The knockdown of Ikaros by this strategy was confirmed by the reduction of its mRNA in transfected versus non-transfected B-1 cells (Fig. 3A). Furthermore, we observed a significant reduction in Ikaros protein levels in B-1 cells transfected with Ikaros-siRNA by Western blotting and immunofluorescence (Fig. 3B–E). Ikaros knockdown induced a reduction in the Flt3, Il7r and Gfi expression, and an increase in the expression of PU.1 (Fig. 4A). These data suggested that Ikaros positively regulates the expression of Flt3, Gfi and Il7r, while it down-regulates PU.1 expression by B-1 cells. Furthermore, the absence of Ikaros in B-1 cells lead to decrease in Pax-5 and EBF expression (Fig. 4B), suggesting suppression of B-1 cell commitment to the B-lymphoid lineage.

Fig. 2. Ikaros interaction with its target genes in B-1 cells. The enrichment of the promoter regions of target genes: Flt3, Gfi, Il7r and PU.1 in the samples after Ikaros ChIP relative to input samples. This value is obtained by calculation of 2(−Ct) where o Ct is [Ct (samples) – Ct (input)] and Ct is (Ct (sample) – Ct negative control) (Mukhopadhyay et al., 2008). Data shown are representative of 2 experiments.

immunoprecipitation (ChIP). The DNA-binding motif recognized by Ikaros (GGGAAA) is present in all promoter regions of the analyzed genes (Flt3, Gfi, Il7r and PU.1) (Georgopoulos, 2002). After immunoprecipitation with anti-Ikaros, the binding was determined by qPCR and compared with input samples. We observed enrichment in the amplification of promoter regions of all target genes, with the higher levels detected for PU.1 (Fig. 2). Ikaros ChIP results in

3.3. In the absence of Ikaros, PU.1 and MCSF-R expression by B-1 phagocytes increases As described previously (Almeida et al., 2001; Popi et al., 2009, 2012; Borrello and Phipps, 1999), B-1 cells can differentiate into phagocytes (B-1CDP). During this differentiation, the lymphoid program is shutt off, and the B-1CDP population assumes a myeloid profile (Popi et al., 2009; Mussalem et al., 2012). Our results suggested that the absence of Ikaros diminishes the lymphoid commitment of B-1 cells. Based on these data, we analyzed the expression of Ikaros and PU.1 in the pre-B-1CDP population (Popi et al., 2009; Mussalem et al., 2012). To perform this analysis, B-1 cells were cultivated as described previously (Almeida et al., 2001). After 24 and 72 h, adherent cells were collected, and the pre-B1CDP (CD19+ F4/80+ ) cell population was enriched by cell sorting.


G Model

ARTICLE IN PRESS



5

Fig. 3. Analysis of Ikaros gene expression in B-1 cells after transfection with Ikaros siRNA. (A) The relative expression of Ikaros by transfected B-1 cells. Non-transfected cells (control) were used for normalization. The bar indicates the expression of Ikaros by non-transfected cells. This experiment was performed in triplicate. The results correspond to the mean of two independent experiments. (B) Fifteen micrograms of total protein of control B-1 cells (non-transfected cells) (1) and transfected B-1 cells (2) were submitted to SDS-PAGE and the immunoblotting was realized with anti-Ikaros and anti-GAPDH (as the uploaded control). (C) Quantification of Western blotting shows that Ikaros siRNA silenced Ikaros expression in B-1 cells. The result corresponds to the mean of two independent experiments. p < 0,001. (D) Transfected and nontransfected (control) B-1 cells were stained with DAPI (1 ␮M), anti-Ikaros antibody (1:50) and anti- IgG rabbit secondary antibody FITC-conjugated (1:1000). Bars = 15 ␮m. (E) Quantification of Ikaros fluorescence in relation to DAPI staining in control and transfected B-1 cells. Results correspond to the mean of two independent experiments, p < 0,001.

A

B 1.0

1.5

__________________

0.5

__________________

0.8 0.6 0.4 0.2

Pu .1

Il7 r

fi G

Fl t3

EB F

0.0

0.0

Pa x5

1.0

Relative expression

Relative expression

2.0

Fig. 4. Ikaros silencing diminishes the B cell profile of B-1 cells. (A) The graphic shows the relative expression of the target genes of transfected B-1 cells compared with those of control cells (non-transfected cells) using the ARBP gene for normalization. This experiment was performed in triplicate, and the data shown correspond to the mean of two independent experiments. (B) The graphic shows the relative expression of lymphoid and myeloid genes in transfected B-1 cells compared with that in control cells (non-transfected cells), using the ARBP gene for normalization. This experiment was conducted in duplicate, and the results shown are the means of two independent experiments.

In the pre-B-1CDP population, Ikaros expression decreased, while PU.1 expression increased (Fig. 5A). To confirm that, after Ikaros expression reduction, there is a myeloid tendency in B-1 cells, we analyzed the expression of lym-

phoid and myeloid genes in the pre B-1CDP. The expression levels of PU.1 and MCSF-R increase more than 150 and 50 fold, respectively, in the pre-B-1CDP population compared with those in B-1 cells (Fig. 5B). Considering this, we hypothesized that Ikaros could


G Model

ARTICLE IN PRESS



6

Relative expression

A

5 4 3 2

__________________

1

B

250

Relave Expression

ik a

PU .1

ro s

0

150

200 100 50 2.0 1.5 1.0

__________________

0.5

Pu .1 M C SF -R

5 Pa x-

EB F

E2 A

0.0

Fig. 5. Ikaros expression and lymphomyeloid profile of B-1 cells along with their differentiation into phagocytes. (A) The relative expression of Ikaros and PU.1 by the pre-B-1CDP population after 72 h in culture compared with that in pre-B-1CDP cells after 24 h in culture. (B) The relative expression of myeloid and lymphoid genes by pre-B-1CDP (CD19+ F4/80+ ) compared with that in B-1 cells. These experiments were performed in triplicate. The results shown are the means of two independent experiments. ARBP (A) or Ikaros (B) was used as a reference gene.

be important to maintain the lymphoid pattern of B-1 cells. Based on these results, we could suggest that, during the differentiation of B-1 cells into phagocytes, the decrease in Ikaros expression facilitates or mediates the silencing of B lymphoid factors, concomitantly allowing the expression of PU.1. One important question remains to be solved is whether Ikaros regulates PU.1 expression directly or via Gfi as described by Spooner (Spooner et al., 2009). Based on the results shown herein, we could hypothesize that, in the absence of Ikaros, Gfi expression is down-regulated and, thus, cannot constrain PU.1 expression, resulting in driving B-1 cells to a myeloid fate. 4. Discussion Previous studies have described Ikaros as a key regulator for lymphoid commitment (Lo et al., 1991). Ikaros expression was found to be critical in the hematopoietic system dichotomy and differentiation process, and it is highly expressed in precursor cells (Wang et al., 1996; Spooner et al., 2009; Ferreirós-Vidal et al., 2013; Westman et al., 2002). Herein, we demonstrated that Ikaros is expressed by B-1 cells, a subpopulation of B lymphocytes, and that its expression seems to be required to maintain the lymphocyte phenotype in this lineage (Brown et al., 1997). Although B-1 cells have been described as B lymphocytes, these cells have many peculiar characteristics, expressing simultaneously

lymphoid and myeloid transcription factors. In addition, B-1 cells can differentiate spontaneously into phagocytes in vitro (Almeida et al., 2001; Popi et al., 2009). More importantly, we also demonstrated that, in B-1 cells, Ikaros interacts with Flt3, Il7r, PU.1 and Gfi genes, key regulators of the hematopoietic system dichotomy, regulating their expression levels. These results could explain the different developmental pattern of B-1 and conventional B lymphocytes because Ikaros protein does not regulate PU.1 and Gfi in the latter one (Spooner et al., 2009; Ferreirós-Vidal et al., 2013), despite the presence of the sequence (GGGAAA) for its binding (Georgopoulos, 2002). Therefore, this finding could help us to understand the permissiveness of the myeloid pattern in B-1 cells, even after the expression of the B cell program. Our results are also in agreement with findings showing that, in the absence of Ikaros, the generation of CLPs (Common Lymphoid Progenitors) is impaired, despite of the normal development of LMPPs (Reynaud et al., 2008; Yoshida et al., 2006). Similarly to LMPPs, B-1 cells show lymphoid and myeloid characteristics (Capece et al., 2013; Popi et al., 2009; Stall et al., 1992; Tung et al., 2006). Moreover, LMPPs can assume a myeloid profile, losing the lymphoid one. The ability of B-1 cells to reassure the lymphoid commitment in the absence of of myeloid has not yet been described. We have also demonstrated that, in the absence of Ikaros, B-1 cells reduce the expression of important lymphoid transcription factors with the concomitant increase in PU.1 levels. Furthermore, after their differentiation into phagocytes, Ikaros expression is decreased followed by a reduction in lymphoid factors and increase in PU.1 levels. Corroborating data from LMPPs (DeKoter et al., 2002), we could suggested that to assume a myeloid profile, B-1 cells should constrain PU.1 expression, which could be achieved by direct interaction with Ikaros or by an indirect action via Gfi (Spooner et al., 2009). The interaction of these factors in B-1 cells needs to be investigated in detail. After the LMPPs stage, PU.1 levels rise in the myeloid progenitors, conversely to fall observed in pre pro B cells (Nutt et al., 2005; Back et al., 2005). Attenuation of PU.1 in B-cell specification versus myeloid is probably regulated by two transcription factors, Gfi and Ikaros (Spooner et al., 2009). As suggested by Zarnegar (REF), PU.1 and Ikaros factors could act as collaborators or antagonists based on their recruitment to different DNA binding sites in each cell subtype. The results shown herein indicated that Ikaros could interfere with PU.1 activity on B-1 cells, and the counterbalance of these two factors could be important to the lymphomyeloid ambiguity of these cells. How these both factors cooperate in the B-1 scenario remains to be solved. Data shown here allow us to suggest that Ikaros could drive the differentiation of B-1 into phagocytes. In this process, the abolition of Ikaros expression is followed by a sustained increase in PU.1 expression and diminished expression of IL7-R, Pax-5 and EBF. It is well established that IL7-R and these transcription factors guide the B cell development and assure the commitment of cells (Busslinger and Urbánek, 1995). As mentioned previously, some reports have shown that, in LMPPs, the absence of Ikaros blocks differentiation into lymphocytes, although an increase in gene expression associated with myeloid differentiation and, a consequent increase in the number of myeloid cells is observed (Francis et al., 2011). Herein, results indicated that B-1 could be positioned as LMPPs, where the definition between lymphoid or myeloid fate is not fully clarified, indicating that the orchestrated role of transcription factors guides the specification choice. However, additional experiments need to be performed to delineate the role of Ikaros in the B-1 cell phagocyte differentiation. Further studies should be undertaken to allow full understanding of how Ikaros works in the dichotomy of the hematopoietic system. Although it has been well documented that the lymphocytes express all isoforms of Ikaros, particularly Ik1 and Ik2




isoforms, and the myeloid lineage selectively expresses the Ikx (Payne et al., 2003), the role of each isoform in the hematopoiesis is not completely understood. Our data show that B-1 cells express similar isoforms as splenic lymphocytes; however, which isoform is being expressed and how they interact in the B-1 cells must be clarified. Our results allow us to propose that B-1 cells conserve precursor cell potential and can maintain a gene expression program similar to that found in LMPPs cells. We postulate that, in B-1 cells, Ikaros regulates the expression of B cell guardian factors, such as IL7-R, Pax-5 and EBF, similar to that in conventional B cells. Conversely, in B-1 cells, Ikaros also interacts with PU.1 and maintains the expression of this gene at a level that is sufficient to induce also the expression of some myeloid genes, but not sufficiently high to silence the B program (Linderson et al., 2001). In summary, Ikaros could be indicated as a key factor in the promiscuous profile of B-1 cells, and could be a controller of myeloid differentiation in these cells. Further investigation should be taken to provide new insights concerning the role of Ikaros in B-1 cells. Considering that deregulation of Ikaros is involved in leukemic cells appearance and that B-1 cells are the main source of CLL (Chronic Lymphocytic Leukemia) cells, a detailed investigation regarding how this factor could be involved in B-1 cell proliferation and activation should be performed. Conflict of interest The authors have no conflict of interests to disclose. Acknowlegments We thank Daniela Teixeira for technical assistance in the cell sorting. This work was supported by FAPESP (2008/55526-9 and 2011/50256-6). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.imbio.2015.06. 010 References Adolfsson, J., Borge, O.J., Bryder, D., Theilgaard-Mönch, K., Astrand-Grundström, I., Sitnicka, E., Sasaki, Y., Jacobsen, S.E., 2001. Upregulation of Flt3 expression within the bone marrow Lin(−) Sca1(+) c-kit(+) stem cell compartment is accompanied by loss of self-renewal capacity. Immunity 15, 659. Adolfsson, J., Månsson, R., Buza-Vidas, N., Hultquist, A., Liuba, K., Jensen, C.T., Bryder, D., Yang, L., Borge, O.J., Thoren, L.A., Anderson, K., Sitnicka, E., Sasaki, Y., Sigvardsson, M., Jacobsen, S.E., 2005. Identification of Flt3+ lympho-myeloid stem cells lacking erythro-megakaryocytic potential a revised road map for adult blood lineage commitment. Cell 121, 295. Almeida, S.R., Aroeira, L.S., Frymuller, E., Dias, M.A., Bogsan, C.S., Lopes, J.D., Mariano, M., 2001. Mouse B-1 cell-derived mononuclear phagocyte, a novel cellular component of acute non-specific inflammatory exudate. Int. Immunol. 13, 1193. Back, J., Allman, D., Chan, S., Kastner, P., 2005. Visualizing PU. 1 activity during hematopoiesis. Exp Hematol 33, 3895. Borrello, M.A., Phipps, R.P., 1999. Fibroblast-secreted macrophage colony-stimulating factor is responsible for generation of biphenotypic B/macrophage cells from a subset of mouse B lymphocytes. J. Immunol. 163, 3605. Brown, K.E., Guest, S.S., Smale, S.T., Hahm, K., Merkenschlager, M., Fisher, A.G., 1997. Association of transcriptionally silent genes with Ikaros complexes at centromeric heterochromatin. Cell 91, 845. Busslinger, M., Urbánek, P., 1995. The role of BSAP (Pax-5) in B-cell development. Curr. Opin. Genet. Dev. 5, 595. Capece, D., Zazzeroni, F., Mancarelli, M.M., Verzella, D., Fischietti, M., Di Tommaso, A., Maccarone, R., Plebani, S., Di Ianni, M., Gulino, A., Alesse, E., 2013. A novel, non-canonical splice variant of the Ikaros gene is aberrantly expressed in B-cell lymphoproliferative disorders. PLoS One 8, e68080. DeKoter, R.P., Lee, H.J., Singh, H., 2002. PU. 1 regulates expression of the interleukin-7 receptor in lymphoid progenitors. Immunity 16, 297.

7

Dias, S., Silva, H., Cumano, A., Vieira, P., 2005. Interleukin-7 is necessary to maintain the B cell potential in common lymphoid progenitors. J. Exp. Med. 201, 971. Errico, A., 2014. Haematological cancer: Ikaros-not a myth for myeloma. Nat. Rev. Clin. Oncol. 11, 65. Ferreirós-Vidal, I., Carroll, T., Taylor, B., Terry, A., Liang, Z., Bruno, L., Dharmalingam, G., Khadayate, S., Cobb, B.S., Smale, S.T., Spivakov, M., Srivastava, P., Petretto, E., Fisher, A.G., Merkenschlager, M., 2013. Genome-wide identification of Ikaros targets elucidates its contribution to mouse B-cell lineage specification and pre-B-cell differentiation. Blood 121, 1769. Francis, O.L., Payne, J.L., Su, R.J., Payne, K.J., 2011. Regulator of myeloid differentiation and function: the secret life of Ikaros. World J. Biol. Chem. 2, 119. Georgopoulos, K., Moore, D.D., Derfler, B., 1992. Ikaros, an early lymphoid-specific transcription factor and a putative mediator for T cell commitment. Science 258, 808. Georgopoulos, K., Bigby, M., Wang, J.H., Molnar, A., Wu, P., Winandy, S., Sharpe, A., 1994. The Ikaros gene is required for the development of all lymphoid lineages. Cell 79, 143. Georgopoulos, K., 2002. Haematopoietic cell-fate decisions, chromatin regulation and ikaros. Nat. Rev. Immunol. 2, 162. Ghosn, E.E., Yang, Y., Tung, J., Herzenberg, L.A., 2008. CD11b expression distinguishes sequential stages of peritoneal B-1 development. Proc. Natl. Acad. Sci. U. S. A. 105, 5195. Hayakawa, K., Hardy, R.R., Parks, D.R., Herzenberg, L.A., 1983. The Ly-1 B cell subpopulation in normal immunodefective, and autoimmune mice. J. Exp. Med. 157, 202. Herzenberg, L.A., Kantor, A.B., 1993. B- lineages exist in the mouse. Cell, 79, England. Joshi, I., Yoshida, T., Jena, N., Qi, X., Zhang, J., Van Etten, R.A., Georgopoulos, K., 2014. Loss of Ikaros DNA-binding function confers integrin-dependent survival on pre-B cells and progression to acute lymphoblastic leukemia. Nat. Immunol. 15, 294. Kang, J., Der, S.D., 2004. Cytokine functions in the formative stages of a lymphocyte’s life. Curr Opin. Immunol. 16, 180. Kikuchi, K., Lai, A.Y., Hsu, C.L., Kondo, M., 2005. IL-7 receptor signaling is necessary for stage transition in adult B cell development through up-regulation of EBF. J. Exp. Med. 201, 1197. Kirstetter, P., Thomas, M., Dierich, A., Kastner, P., Chan, S., 2002. Ikaros is critical for B differentiation and function, Germany. Cell, 720. Kondo, M., 2010. Lymphoid and myeloid lineage commitment in multipotent hematopoietic progenitors. Immunol. Rev. 238, 37. Krajewski, W.A., 2013. Comparison of the Isw1a, Isw1b, and Isw2 nucleosome disrupting activities. Biochemistry 52, 6940. Li, Z., Perez-Casellas, L.A., Savic, A., Song, C., Dovat, S., 2011. Ikaros isoforms: The saga continues. World J. Biol. Chem. 2, 140. Linderson, Y., French, N.S., Neurath, M.F., Pettersson, S., 2001. Context-dependent Pax-5 repression of a PU.1/NF-kappaB regulated reporter gene in B lineage cells. Gene 262, 107. Lo, K., Landau, N.R., Smale, S.T., 1991. LyF-1, a transcriptional regulator that interacts with a novel class of promoters for lymphocyte-specific genes. Mol. Cell. Biol. 11, 5229. Månsson, R., Hultquist, Luc, A., Yang, S., Anderson, L., Kharazi, K., Al-Hashmi, S., Liuba, S., Thorén, K., Adolfsson, L., Buza-Vidas, J., Qian, N., Soneji, H., Enver, S., Sigvardsson, T., Jacobsen, M., SE, 2007. Molecular evidence for hierarchical transcriptional lineage priming in fetal and adult stem cells and multipotent progenitors. Immunity 26, 407. Molnar, A., Georgopoulos, K., 1994. The Ikaros gene encodes a family of functionally diverse zinc finger DNA-binding proteins. Mol. Cell. Biol. 14, 8292. Montecino-Rodriguez, E., Leathers, H., Dorshkind, K., 2006. Identification of a B-1 B cell-specified progenitor. Nat. Immunol. 7, 293. Mukhopadhyay, A., Deplancke, B., Walhout, A.J., Tissenbaum, H.A., 2008. Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans. Nat. Protoc. 3, 698. Mussalem, J.S., Squaiella-Baptistão, C.C., Teixeira, D., Yendo, T.M., Thies, F.G., Popi, A.F., Mariano, M., Longo-Maugéri, I., 2012. Adjuvant effect of killed Propionibacterium acnes on mouse peritoneal B-1 lymphocytes and their early phagocyte differentiation. PLoS One 7, e33955. Nakayama, H., Ishimaru, F., Avitahl, N., Sezaki, N., Fujii, N., Nakase, K., Ninomiya, Y., Harashima, A., Minowada, J., Tsuchiyama, J., Imajoh, K., Tsubota, T., Fukuda, S., Sezaki, T., Kojima, K., Hara, M., Takimoto, H., Yorimitsu, S., Takahashi, I., Miyata, A., Taniguchi, S., Tokunaga, Y., Gondo, H., Niho, Y., Harada, M., 1999. Decreases in Ikaros activity correlate with blast crisis in patients with chronic myelogenous leukemia. Cancer Res. 59, 3931. Nichogiannopoulou, A., Trevisan, M., Neben, S., Friedrich, C., Georgopoulos, K., 1999. Defects in hemopoietic stem cell activity in Ikaros mutant mice. J. Exp. Med. 190, 1201. Nutt, S.L., Kee, B.L., 2007. The transcriptional regulation of B cell lineage commitment. Immunity 26, 715. Nutt, S.L., Metcalf, D., D’Amico, A., Pollim, M., Wu, L., 2005. Dynamic regulation of PU. 1 expression in multipotent hematopoietic progenitors. J. Exp. Med. 202, 221. Olivero, S., Maroc, C., Beillard, E., Gabert, J., Nietfeld, W., Chabannon, C., Tonnelle, C., 2000. Detection of different Ikaros isoforms in human leukaemias using real-time quantitative polymerase chain reaction. Br. J. Haematol. 110, 826.


G Model IMBIO-51339; No. of Pages 8 8


Orozco, C.A., Acevedo, A., Cortina, L., Cuellar, G.E., Duarte, M., Martín, L., Mesa, N.M., ˜ J., Portilla, C.A., Quijano, S.M., Quintero, G., Rodriguez, M., Saavedra, Munoz, C.E., Groot, H., Torres, M.M., López-Segura, V., 2013. The combined expression patterns of Ikaros isoforms characterize different hematological tumor subtypes. PLoS One 8, e82411. Payne, K.J., Huang, G., Sahakian, E., Zhu, J.Y., Barteneva, N.S., Barsky, L.W., Payne, M.A., Crooks, G.M., 2003. Ikaros isoform x is selectively expressed in myeloid differentiation. J. Immunol. 170, 3091. Popi, A.F., Motta, F.L., Mortara, R.A., Schenkman, S., Lopes, J.D., Mariano, M., 2009. Co-ordinated expression of lymphoid and myeloid specific transcription factors during B -1b differentiation into mononuclear phagocytes in vitro, England. Cell, 114. Popi, A.F., Osugui, L., Perez, K.R., Longo-Maugéri, I.M., Mariano, M., 2012. Could a B-1 cell derived phagocyte be one of the peritoneal macrophages during LPS-driven inflammation? PLoS One 7, e34570. Reynaud, D., Demarco, I.A., Reddy, K.L., Schjerven, H., Bertolino, E., Chen, Z., Smale, S.T., Winandy, S., Singh, H., 2008. Regulation of B fate commitment and immunoglobulin heavy-chain gene rearrangements by Ikaros, United States. Cell, 927. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101. Spooner, C.J., Cheng, J.X., Pujadas, E., Laslo, P., Singh, H., 2009. A recurrent network involving the transcription factors PU. 1 and Gfi1 orchestrates innate and adaptive immune cell fates. Immunity 31, 576. Stall, A.M., Adams, S., Herzenberg, L.A., Kantor, A.B., 1992. Characteristics and development of the murine B-1b (Ly-1 B sister) cell population. Ann. N. Y. Acad. Sci. 651, 33.

Tung, J.W., Mrazek, M.D., Yang, Y., Herzenberg, L.A., 2006. Phenotypically distinct B cell development pathways map to the three B cell lineages in the mouse. Proc. Natl. Acad. Sci. U. S. A. 103, 6293. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, RESEARCH0034. Wang, J.H., Nichogiannopoulou, A., Wu, L., Sun, L., Sharpe, A.H., Bigby, M., Georgopoulos, K., 1996. Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation, United States. Immunity, 537 pp. Westman, B.J., Mackay, J.P., Gell, D., 2002. Ikaros: A Key Regulator of Haematopoiesis. Elsevier Science Ltd., England, 1304 pp. Yagi, T., Hibi, S., Takanashi, M., Kano, G., Tabata, Y., Imamura, T., Inaba, T., Morimoto, A., Todo, S., Imashuku, S., 2002. High frequency of Ikaros isoform 6 expression in acute myelomonocytic and monocytic leukemias: implications for up-regulation of the antiapoptotic protein Bcl-XL in leukemogenesis. Blood 99, 1350. Yoshida, T., Ng, S.Y., Zuniga-Pflucker, J.C., Georgopoulos, K., 2006. Early hematopoietic lineage restrictions directed by Ikaros. Nat. Immunol. 7, 382. Zarnegar, M.A., Rothenberg, E.V., 2012. Ikaros represses and activates PU. 1 cell-type-specifically through the multifunctional Sfpi1 URE and a myeloid specific enhancer. Oncogene 31, 4647.


Transcription could be the key to the selection advantage of mitochondrial deletion mutants in aging.

What could be the key elements to determine the optimal number of lymph nodes sampled?

Enhancing the transdermal penetration of nanoconstructs: could hyaluronic acid be the key?

TLS mutants in ALS.

Ikaros Is a Negative Regulator of B1 Cell Development and Function.

Can a bacterial endotoxin be a key factor in the kinetics of amyloid fibril formation?

G-CSF is a key modulator of MDSC and could be a potential therapeutic target in colitis-associated colorectal cancers.

Imagination: innovating the could be.

Career motivation and burnout among medical students in Hungary - could altruism be a protection factor?

Could midbrain "resting" tremor be caused by postural maintenance at rest?

Denosumab could be a Potential Inhibitor of Valvular Interstitial Cells Calcification in vitro.

Homeostasis of redox status derived from glucose metabolic pathway could be the key to understanding the Warburg effect.

A Hypothesis: Could Portable Natural Grass be a Risk Factor for Knee Injuries?

'Throne project' could be a life-changer.

Could microRNAs contribute to the maintenance of β cell identity?

Targeting "bad" B cells in multiple sclerosis: Could laquinimod be part of the armamentarium?

Symptom outcome in early-onset bipolar disorder: could be better, could be worse.

Could the organ shortage ever be met?

Could this be another story of montage?

The proliferation of malignant melanoma cells could be inhibited by ranibizumab via antagonizing VEGF through VEGFR1.

Host CD8α+ dendritic cells may be a key factor for separating graft-versus-host disease from graft-versus-leukemia.

Could Spinal Canal Compression be a Cause of Polyneuropathy?

The Cytosolic pH of Individual Saccharomyces cerevisiae Cells Is a Key Factor in Acetic Acid Tolerance.

Could lamotrigine be useful in status epilepticus? A case report.