Fish & Shellfish Immunology 44 (2015) 265e271
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Immune gene expression for diverse haemocytes derived from pacific white shrimp, Litopenaeus vannamei Chih-Chiu Yang a, Chung-Lun Lu a, Sherwin Chen b, Wen-Liang Liao a, **, Shiu-nan Chen b, * a b
Institute of Fisheries Science, National Taiwan University, Taipei, Taiwan, ROC College of Life Science, National Taiwan University, Taipei, Taiwan, ROC
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 October 2014 Received in revised form 3 February 2015 Accepted 3 February 2015 Available online 11 February 2015
In this study, diverse haemocytes from Pacific white shrimp Litopenaeus vannamei were spread by flow cytometer sorting system. Using the two commonly flow cytometric parameters FSC and SSC, the haemocytes could be divided into three populations. Microscopy observation of L. vannamei haemocytes in anticoagulant buffer revealed three morphologically distinct cell types designated as granular cell, hyaline cell and semigranular cell. Immune genes, which includes prophenoloxidase (proPO), lipopolysaccharide-b-glucan binding protein (LGBP), peroxinectin, crustin, lysozyme, penaeid-3a and transglutaminase (TGase), expressed from different haemocyte were analysed by quantitative real time PCR (qPCR). Results from the mRNA expression was estimated by relative level of each gene to b-actin gene. Finally, the seven genes could be grouped by their dominant expression sites. ProPO, LGBP and peroxinectin were highly expressed in granular cells, while LGBP, crustin, lysozyme and P-3a were highly expressed in semigranular cells and TGase was highly expressed in hyaline cells. In this study, L. vannamei haemocytes were firstly grouped into three different types and the immune related genes expression in grouped haemocytes were estimated. © 2015 Elsevier Ltd. All rights reserved.
Keywords: L. vannamei Hyaline cell Semigranular cell Granular cell Immune gene
1. Introduction Crustacean haemocyte plays an important roles in phagocytosis, nodule formation, encapsulation, and cytotoxicity of crustacean. These primary defense responses induce the biological innate immune system and protect crustacean avoid from parasitic and pathogenic infection [1]. The innate immune system of shrimps consists mainly of prophenoloxidase (proPO) system, clotting system, phagocytosis, encapsulation and nodule formation, antimicrobial peptides (AMPs) formation and cell agglutination. The internal defense process is the recognition of invading microorganisms, which is mediated by the pattern recognition proteins (PRPs). After recognition by PRPs, signalling cascades start and haemocytes activated [2]. The haemocytes are involved in the synthesis, storage and, upon activation, discharge of proenzymes and substrates of the clotting and proPO system [3]. The activated haemocytes also release proteins that related to defense responses, such as AMPs and peroxidase [4]. which activates encapsulation, phagocytosis, and nodule form accordingly [3,5]. * Corresponding author. Tel.: þ886 33662797; fax: þ886 23687102. ** Corresponding author. Tel.: þ886 233662883. E-mail addresses: [email protected], [email protected] (W.-L. Liao), [email protected] (S.-n. Chen). http://dx.doi.org/10.1016/j.fsi.2015.02.001 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
A number of invertebrate PRPs have been isolated and characterized based on the molecules of which they recognize. These PRPs are b-1,3-glucan binding proteins (BGBP); lipopolysaccharidebinding proteins (LBP); LPS-and b-1,3-glucan-binding protein (LGBP) as well as peptidoglycan-binding proteins (PGBP) [6,7]. Crustacean LGBP with a molecular weight of approximately 30e45 kDa was identified in crayfish Pacifastacus leniusculus [8], blue shrimp Litopenaeus stylirostris [9], Litopenaeus vannamei [10] and black tiger shrimp Penaeus monodon [11]. After binding to the ligands, LGBP engages in the activation of the proPO system that plays a prominent role in non-self recognition, haemocyte communication and the production of melanin. Upon activation, the haemocytes become degranulated and at the same time ProPO is cinverted to its active from as phenoloxidase (PO) by a serine proteinase [3]. Clotting is an essential defense mechanism in crustaceans for entraps foreign material and prevents loss of haemolymph [12]. The protein that constitutes the clotting mechanism was the clotting protein [13] and transglutaminase (TGase). TGase also plays critical roles in other biochemical process including protein crosslinking and related super structures [14]. Two types of TGase, transglutaminase I and II were found in P. monodon and Penaeus japonicus and both of them are involved in coagulation [15e17].
266
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
Penaeidins, is isolated from the L. vannamei for the first time [18], and AMPs have also been detected in several penaeid shrimps [19e21]. The penaeidins react in vitro against gram positive bacteria and fungi with clear differences in potency among strains [22,23]. Isoforms of penaeidins are classified according to their similarity in amino acid sequence into penaeidin 2 (PEN2), penaeidin 3 (PEN3), and penaeidin 4 (PEN4) [24]. Among the subgroups, PEN3 is the most abundant expressed in L. vannamei haemocytes [18,22]. Another AMP found in penaeid shrimp is crustin, initially described in shore crab, Carcinus maenas [25]. Shrimp crustin appears in L. vannamei, Litopenaeus setiferus [26], spiny lobster Panulirus argus [27], P. monodon [28], P. japonicus [29] and European lobster, Homarus gammarus [30]. The crustins have been suggested to be members of the antibacterial WAP-domain containing proteins with their structural similarity [31]. Lysozyme is widely distributed among eukaryotes and prokaryotes. It catalyzes the hydrolysis of bacterial cell walls and acts as a non-specific innate immunity molecule against the invasion of bacterial pathogens [32]. The cDNA were cloned and characterized in L. vannamei and P. japonicus [33,34]. Cell adhesion is essential for cellular immune response in invertebrates in the presence of microorganisms [35]. A cell adhesion molecule, peroxinectin, is responsible of degranulation, encapsulation, enhancement, peroxinectin, and peroxidase [35,36]. The biological activity of peroxinectin is generated with a concomitant activation of the prophenoloxidase (proPO) system [37]. In this study, we applied the Flow cytometery sort system to isolate diverse haemocyte groups from L. vannamei. Subsequently, differential haemocyte morphologies were then identified by light microscopy, while the distribution of seven important immunerelated genes and relative expression level in different haemocytes were analyzed by conventional RT-PCR and quantitative real time PCR (qPCR). An overall view concerning the physiological expression levels of these genes in different haemocytes from L. vannamei was illustrated. 2. Materials and methods 2.1. Animals White shrimp L. vannamei (12e15 g) obtained from National Taiwan Ocean University in Keelung, Taiwan were stocked in recirculating water tanks system with water salinity and temperature maintained at 30‰ and 25 C, respectively. The shrimps were fed a commercial pelleted feed. The shrimp were screened for viral contamination and molting status. The viral inspection included white spot syndrome virus (WSSV), infectious hypodermal and haematopoietic necrosis virus (IHHNV) and Taura syndrome virus (TSV). Only those in the inter-molt or early pre-molt stage without any viral infections were used. 2.2. Haemolymph collection Haemolymph was collected from the ventral sinus with a 1-ml syringe and a 26-gauge needle with 0.1 ml pre-cooled anticoagulant buffer (0.45 M NaCl, 0.1 M glucose, 10 mM EDTA, 30 mM Sodium citrate, 26 mM citrate acid, pH 5.6, osmolality € derha €ll and Smith [38]. 900 mOsm kg1) which was modify from So The haemolymph was mixed immediately with an equal volume of EDTA as the anticoagulant buffer, which prevented degranulation and cell lysis in crustacean haemocytes. All chemicals were obtained from Sigma (St. Louis, USA). Cell counts and viabilities were determined by microscopy using a haemocytometer and trypan blue exclusion. Only cell preparations with viabilities higher than 90% were used for experiment.
2.3. Flow cytometry and cell-sorting All flow-cytometric analyses were carried in Aria III (BectoneDickinson, St. Jose, CA, USA) equipped with both sorting device and cell delivery robotics. Both flow-cytometric analysis and cellsorting were carried out with the 80-um nozzle. At least 100,000 events were collected and analyzed by Aria III for each flow cytometery. Hyaline cells are spherical with centrally placed nucleus and a prominent nucleolus. Semi-granular cells are typically spindleshaped with an expanded cytoplasm and multiple granules; the nucleus is usually central. Granular cells are usually oval or irregular in shape and of larger size than hyaline cells. For formaldehyde-fixed cells, semi-granular cells (small granule haemocytes) and granular cells (large granule haemocytes) contain granules but the latter possesses more [39]. Both relative cell sizes and granularity can conveniently be measured by the forward scatter (FSC) and side scatter (SSC). A pre-run on haemocytes was carried out to tune the system into the best scales for separating the various populations on screen. Three separate sorting runs were carried to generate the observed populations shown in this paper. The purity of sorted haemocytes was analyzed further microscopically. 2.4. Wright's stain Cell suspension was flooded an air-dried smear with Wright's satin and allow to stand for 1e3 min. Add an equal amount of Wright's buffer and mixed by gently blowing on the slide until a metallic green sheen forms on the surface. Allowed it to stand for 2e6 min (the exact time must be determined for each batch of stain) and gently rinse the stain from the slide using taps water or distilled water. Finally, prop up the slide and allow it to air-dry. 2.5. Total RNA isolation and reverse transcription Total RNA was extracted from the different haemocytes according to the Trizol protocols (Invitrogen). RNA was quantified at 260 and 280 nm using NanoDrop-1000 (Thermo Scientific). Only RNAs with absorbance ratios (A260:A280) range in 1.8e2.0 were used for further experiments. First strand cDNA was generated with 20ul reaction volume containing 2 mg total RNA, 1X RT buffer, 1 mM dNTP, 0.2 mM Oligo(dT15), 10U of RNase inhibitor and 50U MultiScribe Reverse Transcriptase (Applied Biosystems) and the reaction was conducted at 37 C for 2 h. 2.6. Quantitative real-time PCR analysis of gene expression Gene expression was analyzed by quantitative real-time PCR (qPCR) using Bio-Rad CFX384 (Bio-Rad Laboratories, Richmond, CA) using SYBR Green Supermix kits. The qPCR conditions were 95 C for 3 min and 50 cycles of 95 C for 10 s and 58 C for 30 s. Relative gene expression was calculated as 2DCt, where Ct is threshold cycle. The expression levels of the housekeeping gene b-actin were not altered with any of call population (data not shown). Table 1 displays the list of primer sequences. Data were analyzed by oneway ANOVA with post hoc LSD to adjust P values for multiple comparisons. P < 0.05 was considered statistically significant. 3. Result 3.1. Haemocyte sorting and identification Flow cytometric analysis was performed on haemocytes derived from pacific white shrimp, L. vannamei. Using the two commonly
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
267
Table 1 Seven immune-related genes of Pacific white shrimp, L. vannamei and their orresponding PCR primers used for quantitative real time PCR. Target gene
GenBank#
Forward sequence (50 to 30 )
Reverse sequence (50 to 30 )
Products (bp)
b-actin
AF300705 AY723296 AY723297 AY486425.1 AF430076 AY170126 Y14926 BE188522
CCACGAGACCACCTACAAC CGGTGACAAAGTTCCTCTTC ACCGCAGCATCAGTTATACC GAAGAAAGGAGACCGATAC ACGAGGCAACCATGAAGG GGACTACGGCATCTTCCAGA CACCCTTCGTGAGACCTTTG TTCACAAGCCTGACATCACC
AGCGAGGGCAGTGATTTC GCAGGTCGCCGTAGTAAG GTCATCGCCCTTCCAGTTG GCTGGACGGCTTGGATG AACCACCACCAACACCTAC ATCGGACATCAGATCGGAAC AATATCCCTTTCCCACGTGAC GCAGCAGTGGGATAGGGTTA
142 bp 122 bp 77 bp 137 bp 141 bp 97 bp 121 bp 99 bp
ProPO LGBP Peroxinectin Crustin Lysozyme PEN-3a TGase
used flow cytometric parameters FSC and SSC, the haemocytes could clearly be divided into three populations (Fig. 1). The FSC alone (linear scale) could distinguish a group of small cells, having FSC values less than half of those of the larger cells. The two groups of larger cells could be resolved further by SSC (exponential scale) with the upper group having a relative SSC value 10 times that of the lower group. The different groups were successfully sorted with the use of the two parameters. The “P1” group of larger cells with higher SSC was microscopically confirmed to be the granular cell; The “P2” group of cells with lower FSC values was microscopically confirmed to be the hyaline cells. While the “P3” group of larger cells with less SSC was microscopically confirmed to be the semigranular cell. Microscopy of L. vannamei haemocytes in anticoagulant buffer revealed three morphologically distinct cell types designated as granular cells (Fig. 2A), hyaline cells (Fig. 2B) and semigranular cells (Fig. 2C). Granular cells were identified by the conspicuous granules; granules in semigranular cells showed smaller and less than those in granular cells. Hyaline cells were believed with large nuclei and possessed different degrees of complexity and various shapes. 3.2. Haemocyte gene expression studied with quantitative real time PCR The abundances of mRNA transcripts from each gene were analyzed by quantitative real time PCR using ten shrimps. Results from the mRNA expression were estimated by relative level of each gene to beta-actin gene. As demonstrated, the seven genes could be grouped by their dominant expression sites. proPO, LGBP and
Fig. 1. An example of flow cytometric analysis of fresh circulating haemocytes from Litopenaeus vannamei analyzed by forward scatter (FSC), indicating cell size; and side scatter (SSC), indicating cell granularity and structure. Granular cell, hyaline cell and semigranular cell populations are designated P1 (G), P2 (H) and P3 (SG) respectively.
peroxinectin were highly expressed in granular cells (Figs. 3e5), while LGBP, crustin, lysozyme and P-3a were highly expressed in semigranular cells (Figs. 4, 6e8) and TGase was highly expressed in hyaline cells (Fig. 9). While mRNAs of proPO was present in granular cells, the levels of expression in granular cells were 5e10 times higher than other cells (Fig. 3). While mRNAs of LGBP was present in granular cells and semigranular cells, the levels of expression in granular cells and semigranular cells were two times higher than those of hyaline cells (Fig. 4). While mRNAs of peroxinectin was present in granular cells, there was no significant difference found in the semigranular cells (Fig. 5). While mRNAs of crustin was present in semigranular cells, the levels of expression in semigranular cells were five to ten times higher than other cells (Fig. 6). While mRNAs of lysozyme was present in semigranular cells, the levels of expression in semigranular cells were three times higher than other cells (Fig. 7). While mRNAs of P-3a was present in semigranular cells, the levels of expression in semigranular cells were four to twelve times higher than other cells (Fig. 8). While mRNAs of TGase was present in hyaline cells, the levels of expression in hyaline cells were ten to twenty times higher than other cells (Fig. 9).
4. Discussion Using phase-contrast microscopy, we're able to distinguish different types of granular, semigranular, and hyaline cells in crayfish, Astacus astacus [40]. Using oblique light microscopy, different types of haemocyte were identified from the crayfish P. zonangulus, P. japonicas [41] and Crassostrea virginica [42], Flow Cytometery analysis of live haemocytes in anticoagulation buffer delineated three subpopulations. The study of crayfish haemocytes in anticoagulation buffer facilitated the observation of distinct cell populations. The buffer prevents the activation of proPO and maintains cells in a quiescent state [38,43]. Microscopy and FSC results showed similar patterns of distributions among the cell types, although FSC values were approximately 10% lower for hyaline cells. Hyaline cells were the most abundant cell type in P. zonangulus (77e89%), as stated in previous reports of microscopic and FSC observations of Penaeus spp [44,45]. and oyster haemocytes [42,46]. By microscopy, A. astacus monolayers were composed of approximately 50% semigranular, 30% granular, and 20% hyaline cells. With the epidemic of shrimp diseases globally, studies of shrimp immune-related genes and their expressions has received accumulative attentions. Prior researches were performed based on results from the expression of genes after sensitizing with immunestimulants or pathogenic challenges to assess the immune responsiveness. However, the results were solely based on the expressions of selected genes from the semen without locating the exact gene that has been expressed in the associated haemocytes. In this present study, we have clearly demonstrated how the different immune-related genes were expressed in different haemocytes.
268
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
Fig. 2. L. vinnamei haemocytes in anticoagulant buffer imaged by light microscopy. (A) Granular cell with conspicuous large granules (arrow). (B) Hyaline cell with large nucleus (arrow) and fewer cytoplasmic vesicles. (C) Semigranular cells showing many cytoplasmic granules (arrow) characteristically smaller than those of granular cells. Bars are 10 mm.
In previous studies, proPO mRNA expression at various shrimp tissues was analyzed by RT-PCR and in situ hybridization. The results indicated that there are highly expressed proPO in haemocyte [47]. In other arthropods, including crayfish and P. monodon, results from Northern blot analysis indicate that haemocytes were the sole site for proPO synthesis [48,49]. In the present study, the qPCR analyses also showed that granular cells were the main producer of proPO transcript. Transglutaminases (TGase) are known to play critical roles in blood coagulation. TGase from Pacifastacus leniusculus, P. monodon and Marsupenaeus japonicus have been cloned and characterized
[15e17,50] but only partial sequence is available in L. vannamei. The partial sequence obtained in the present study belongs to type I TGase according to the nucleotide sequence, which indicated a similarity of 88% to the STG I of P. monodon (AY074924). Using Northern blotting, Wang et al. [50] showed that TGase was expressed almost exclusively in haemocytes with only very faint signals in the hepatopancreas and muscle tissues in P. leniusculus. In P. monodon, STG I mRNA is widespread except in the eyestalk when studied by RT-PCR [15]. Compared to these results, the expression level of STG I in L. vannamei haemocyte was firstly discovered dominant in hyaline cell and less in granular cell and semigranular cell.
Fig. 3. Haemocytes distribution of ProPO mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
Fig. 4. Haemocytes distribution of LGBP mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
Fig. 5. Haemocytes distribution of peroxinectin mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
269
Fig. 7. Haemocytes distribution of Lysosome mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
Crustins and crustin-like peptides have been identified from a variety of crustacean species. Their complete sequences or EST were all obtained from haemocyte cDNA library, which was derived from epithelial cell of the olfactory organ [27]. Another paper show that crustin was found to be constitutively expressed at high levels in haemocytes, lower levels in hearts, gills, intestines and lymphoid organs and none in hepatopancreas in P. monodon by RT-PCR [28]. In M. japonicus, crustin mRNA is only detected in haemocyte, not in heart, hepatopancreas, gill, foregut, midgut muscle and epidermis [29]. In situ hybridisation result from L. vannamei showed that crustin mRNA only expressed in haemocytes [51]. Our results indicated that high level L. vannamei crustins was detected by RTPCR in semigranular cells. Penaeidin mRNA has been shown to express strongly in many penaeid shrimp including Fenneropenaeus chinensis [21], L. vannamei [52], and P. monodon [53]. Penaeidin transcripts present in haemocyte, but not in heart, intestine, gill, subcuticular epithelium, lymphoid organ, hepatopancreas and muscle of P. monodon when studied by Northern blot analysis [20]. In
L. vannamei, penaeidin (PEN-3) mRNA was detected in all the tissues examined including haematopoietic nodules and testis but not in the brain when studied also by Northern blot analysis [54]. In F. chinensis, in addition to haemocytes, gill, heart and intestine detected using Northern blot technique, penaeidin transcript was also observed in hepatopancreas, eye, subcuticular epithelium, brain and stomach when RT-PCR analysis was used [21]. Using the RT-PCR, the present study found that penaeidin expressed in semigranular cells. In vertebrate, macrophages and the epithelial cell such as Paneth cells in the intestine crypt are the major producers of lysozyme [55]. In L. vannamei, lysozyme transcript present in tissues was infiltrated by haemocytes [56] when observed by in situ hybridization. Lysozyme transcripts also are widely distributed in haemocytes and other tissues of the Penaeus japonicus using RT-PCR analysis [34]. This result showed that lysozyme was express in semigranular cells. The functions of hyaline cells are phagocytosis, which was carried out by lysozyme, but in our study, the highest level of lysozyme expression was in semigranular cells.
Fig. 6. Haemocytes distribution of crustin mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
Fig. 8. Haemocytes distribution of penaeid-3a mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
270
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
Fig. 9. Haemocytes distribution of TGase mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
LGBP has been cloned from the haemocytes of the tiger shrimp P. monodon [11] and crayfish P. leniusculus [8], the hepatopancreas of the blue shrimp Litopenaeus stylirostris [9], or both haemocyte and hepatopancreas of the Pacific white shrimp L. vannamei [10,51]. However, we could not find apparent both in granular cells and semigranular cells. The RT-PCR and qPCR results also showed that the expression of LGBP in granular cells and semigranular cells were much higher than those of in hyaline cells. Peroxinectin is essential in the crustacean cellular defence reaction for the enhancement of encapsulation [57]. It is ubiquitous in invertebrates, including fruit fly Drosophila melanogastermeta [58], American oyster C. virginica (GenBank accession number CD647078), white shrimp L. vannamei [59], tiger shrimp P. monodon [60], crayfish P. leniusculus [37], and giant freshwater prawn Macrobrachium rosenbergii [61]. In L. vannamei, peroxinectin mRNA was detected in granular cells, and in the semigranular cells/hyaline cells band via RT-PCR [62]. In this study, granular cells express the highest level of peroxinectin. Shrimp haemocyte plays critical roles in shrimp's immune system which functions on an open circulation system. In this study, L. vannamei haemocytes were grouped into three types and the immune related genes expression in grouped haemocytes were estimated. By utilizing results from the current study, the shrimp farming industry can establish a new standard to survey the immune and physiological health of the cultured shrimps, which may provide additional references in diseases control and management in the modern aquaculture farming.
References € derha €ll K, Cerenius L. Crustacean immunity. Ann Rev Fish Dis 1992:3e23. [1] So [2] Vargas-Albores F, Yepiz-Plascencia G. Beta glucan binding protein and its role in shrimp immune response. Aquaculture 2000;191:13e21. €derha €ll K. The proPO and clotting system in crusta[3] Sritunyalucksana K, So ceans. Aquaculture 2000;191:53e69. €derha €ll K. The prophenoloxidase-activating system in in[4] Cerenius L, So vertebrates. Immunol Rev 2004;198:116e26. [5] Bachere E, Gueguen Y, Gonzalez M, de Lorgeril J, Garnier J, Romestand B. Insights into the anti-microbial defense of marine invertebrates: the penaeid shrimps and the oyster Crassostrea gigas. Immunol Rev 2004;198:149e68. €derh€ [6] Duvic B, So all K. Purification and characterization of a beta-1,3-glucan binding protein from plasma of the crayfish Pacifastacus leniusculus. J Biol Chem 1990;265:9327e32.
[7] Vargas-Albores F, Jimenez-Vega F, Yepiz-Plascencia GM. Purification and comparison of beta-1,3-glucan binding protein from white shrimp (Penaeus vannamei). Comp Biochem Physiol B Biochem Mol Biol 1997;116:453e8. €derha €ll K. A lipopolysaccharide- and beta-1,3-glucan[8] Lee SY, Wang R, So binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization, and cDNA cloning. J Biol Chem 2000;275:1337e43. [9] Roux MM, Pain A, Klimpel KR, Dhar AK. The lipopolysaccharide and beta-1,3glucan binding protein gene is upregulated in white spot virus-infected shrimp (Penaeus stylirostris). J Viro 2002;76:7140e9. [10] Cheng W, Liu CH, Tsai CH, Chen JC. Molecular cloning and characterisation of a pattern recognition molecule, lipopolysaccharide- and beta-1,3-glucan binding protein (LGBP) from the white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2005;18:297e310. €derh€ [11] Sritunyalucksana K, Lee SY, So all K. A beta-1,3-glucan binding protein from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2002;26:237e45. [12] Martin GG, Hose JE, Omori S, Chong C, Hoodbhoy T, Mckrell N. Localization and roles of coagulogen and transglutaminase in hemolymph coagulation in Decapod crustaceans. Comp Biochem Phys B 1991;100:517e22. €derha €ll K. Isolation and characterization of a [13] Kopacek P, Grubhoffer L, So hemagglutinin with affinity for lipopolysaccharides from plasma of the crayfish Pacifastacus leniusculus. Dev Comp Immunol 1993;17:407e18. [14] Lorand L, Graham RM. Transglutaminases: crosslinking enzymes with pleiotropic functions. Nat Rev Mol Cell Biol 2003;4:140e56. €derha €ll K, Song YL. Molecular cloning and [15] Huang CC, Sritunyalucksana K, So characterization of tiger shrimp (Penaeus monodon) transglutaminase. Dev Com Immunol 2004;28:279e94. [16] Yeh MS, Kao LR, Huang CJ, Tsai IH. Biochemical characterization and cloning of transglutaminases responsible for hemolymph clotting in Penaeus monodon and Marsupenaeus japonicus. Biochim Biophys Acta 2006;1764:1167e78. [17] Chen M-Y, Hu K-Y, Huang C-C, Song Y-L. More than one type of transglutaminase in invertebrates? A second type of transglutaminase is involved in shrimp coagulation. Dev Com Immunol 2005;29:1003e16. [18] Destoumieux D, Bulet P, Loew D, Van Dorsselaer A, Rodriguez J, Bachere E. Penaeidins, a new family of antimicrobial peptides isolated from the shrimp Penaeus vannamei (Decapoda). J Biol Chem 1997;272:28398e406. [19] Munoz M, Vandenbulcke F, Garnier J, Gueguen Y, Bulet P, Saulnier D, et al. Involvement of penaeidins in defense reactions of the shrimp Litopenaeus stylirostris to a pathogenic vibrio. Cell Mol Life Sci 2004;61:961e72. [20] Ho SH, Chao YC, Tsao HW, Sakai M, Chou HN, Song YL. Molecular cloning and recombinant expression of tiger shrimp Penaeus monodon penaeidin. Fish Pathol 2004;39:15e23. [21] Kang CJ, Wang JX, Zhao XF, Yang XM, Shao HL, Xiang JH. Molecular cloning and expression analysis of Ch-penaeidin, an antimicrobial peptide from Chinese shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2004;16:513e25. [22] Destoumieux D, Munoz M, Bulet P, Bachere E. Penaeidins, a family of antimicrobial peptides from penaeid shrimp (Crustacea, Decapoda). Cell Mol Life Sci 2000;57:1260e71. [23] Destoumieux D, Bulet P, Strub JM, Van Dorsselaer A, Bachere E. Recombinant expression and range of activity of penaeidins, antimicrobial peptides from penaeid shrimp. Eur J Biochem 1999;266:335e46. [24] Cuthbertson BJ, Shepard EF, Chapman RW, Gross PS. Diversity of the penaeidin antimicrobial peptides in two shrimp species. Immunogenetics 2002;54:442e5. [25] Relf JM, Chisholm JR, Kemp GD, Smith VJ. Purification and characterization of a cysteine-rich 11.5-kDa antibacterial protein from the granular haemocytes of the shore crab, Carcinus maenas. Eur J Biochem 1999;264:350e7. [26] Bartlett TC, Cuthbertson BJ, Shepard EF, Chapman RW, Gross PS, Warr GW. Crustins, homologues of an 11.5-kDa antibacterial peptide, from two species of penaeid shrimp, Litopenaeus vannamei and Litopenaeus setiferus. Mar Biotechnol (NY) 2002;4:278e93. [27] Stoss TD, Nickell MD, Hardin D, Derby CD, McClintock TS. Inducible transcript expressed by reactive epithelial cells at sites of olfactory sensory neuron proliferation. J Neurobiol 2004;58:355e68. [28] Supungul P, Klinbunga S, Pichyangkura R, Hirono I, Aoki T, Tassanakajon A. Antimicrobial peptides discovered in the black tiger shrimp Penaeus monodon using the EST approach. Dis Aquat Organ 2004;61:123e35. [29] Rattanachai A, Hirono I, Ohira T, Takahashi Y, Aoki T. Cloning of kuruma prawn Marsupenaeus japonicus crustin-like peptide cDNA and analysis of its expressiony. Fish Sci 2004;70:765e71. [30] Hauton C, Brockton V, Smith VJ. Cloning of a crustin-like, single whey-acidicdomain, antibacterial peptide from the haemocytes of the European lobster, Homarus gammarus, and its response to infection with bacteria. Mol Immunol 2006;43:1490e6. [31] Vargas-Albores F, Yepiz-Plascencia G, Jimenez-Vega F, Avila-Villa A. Structural and functional differences of Litopenaeus vannamei crustins. Comp Biochem Phys B 2004;138:415e22. [32] Jolles P, Jolles J. Whats new in lysozyme research e always a model system, today as yesterday. Mol Cell Biochem 1984;63:165e89. [33] Sotelo-Mundo RR, Islas-Osuna MA, de-la-Re-Vega E, Hernandez-Lopez J, Vargas-Albores F, Yepiz-Plascencia G. cDNA cloning of the lysozyme of the white shrimp Penaeus vannamei. Fish Shellfish Immunol 2003;15:325e31. [34] Hikima S, Hikima J, Rojtinnakorn J, Hirono I, Aoki T. Characterization and function of kuruma shrimp lysozyme possessing lytic activity against Vibrio species. Gene 2003;316:187e95.
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271 [35] Johansson MW. Cell adhesion molecules in invertebrate immunity. Dev Comp Immunol 1999;23:303e15. €derha €ll K. Invertebrate immunity. Dev Comp Immunol 1999;23:263e6. [36] So €derha €ll K. Perox[37] Johansson MW, Lind MI, Holmblad T, Thornqvist PO, So inectin, a novel cell adhesion protein from crayfish blood. Biochem Biophys Res Commun 1995;216:1079e87. €derha €ll K, Smith VJ. Separation of the haemocyte populations of Carcinus [38] So maenas and other marine decapods, and prophenoloxidase distribution. Dev Comp Immunol 1983;7:229e39. [39] Martin GG, Shapiro DJ. Regulation of rat liver cell 3-hydroxy-3-methylglutaryl coenzyme A reductase by methoxypolyoxyethylated cholesterol. Biochim Biophys Acta 1985;837:163e72. €derha €ll K. Induction of degranulation and lysis of haemocytes in [40] Smith VJ, So the freshwater crayfish, Astacus astacus by components of the prophenoloxidase activating system in vitro. Cell Tiss Res 1983;233:295e303. [41] Sequeira T, Vilanova M, Lobo-Da-Cunha A, Baldaia L, Arala-Chaves M. Flow cytometric analysis of molt-related changes in hemocyte type in male and female Penaeus japonicus. Biol Bull 1995;189:376e80. [42] Ashton-Alcox KA, Ford SE. Variability in molluscan hemocytes: a flow cytometric study. Tiss Cell 1998;30:195e204. [43] Rodriguez J, Boulo V, Mialhe E, Bachere E. Characterisation of shrimp haemocytes and plasma components by monoclonal antibodies. J Cell Sci 1995;108(Pt 3):1043e50. [44] Le Moullac G, Le Groumellec M, Ansquer D, Froissard S, Levy P, Aquacop. Haematological and phenoloxidase activity changes in the shrimp Penaeus stylirostris in relation with the moult cycle protection against vibriosis. Fish Shellfish Immunol 1997;7:227e34. [45] Owens L, O'Neill A. Use of a clinical cell flow cytometer for differential counts of prawn Penaeus monodon haemocytes. Dis Aquat Organ 1997;31: 147e53. [46] Ford SE, Ashtonalcox KA, Kanaley SA. Comparative cytometric and microscopic analyses of oyster hemocytes. J Invertebr Pathol 1994;64:114e22. [47] Wang YC, Chang PS, Chen HY. Tissue distribution of prophenoloxidase transcript in the Pacific white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2006;20:414e8. [48] Aspan A, Huang TS, Cerenius L, Soderhall K. cDNA cloning of prophenoloxidase from the freshwater crayfish Pacifastacus leniusculus and its activation. Proc Natl Acad Sci U S A 1995;92:939e43. €derha €ll K. Molecular cloning and charac[49] Sritunyalucksana K, Cerenius L, So terization of prophenoloxidase in the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 1999;23:179e86.
271
€derh€ [50] Wang R, Liang Z, Hal M, So all K. A transglutaminase involved in the coagulation system of the freshwater crayfish, Pacifastacus leniusculus. Tissue localisation and cDNA cloning. Fish Shellfish Immunol 2001;11:623e37. [51] Wang YC, Chang PS, Chen HY. Tissue expressions of nine genes important to immune defence of the Pacific white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2007;23:1161e77. [52] Munoz M, Vandenbulcke F, Saulnier D, Bachere E. Expression and distribution of penaeidin antimicrobial peptides are regulated by haemocyte reactions in microbial challenged shrimp. Eur J Biochem 2002;269:2678e89. [53] Cheng W, Tung YH, Liu CH, Chen JC. Molecular cloning and characterisation of cytosolic manganese superoxide dismutase (cytMn-SOD) from the giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol 2006;20:438e49. [54] Destoumieux D, Munoz M, Cosseau C, Rodriguez J, Bulet P, Comps M, et al. Penaeidins, antimicrobial peptides with chitin-binding activity, are produced and stored in shrimp granulocytes and released after microbial challenge. J Cell Sci 2000;113(Pt 3):461e9. [55] Chung LP, Keshav S, Gordon S. Cloning the human lysozyme cDNA: inverted Alu repeat in the mRNA and in situ hybridization for macrophages and paneth cells. Proc Natl Acad Sci U S A 1988;85:6227e31. [56] Burge EJ, Madigan DJ, Burnett LE, Burnett KG. Lysozyme gene expression by hemocytes of Pacific white shrimp, Litopenaeus vannamei, after injection with vibrio. Fish Shellfish Immunol 2007;22:327e39. € derha €ll K. Cellular immunity in crustaceans and the proPO [57] Johansson MW, So system. Parasitol Today 1989;5:171e6. [58] Vazquez M, Rodriguez R, Zurita M. A new peroxinectin-like gene preferentially expressed during oogenesis and early embryogenesis in Drosophila melanogaster. Dev Genes Evol 2002;212:526e9. [59] Liu CH, Cheng W, Kuo CM, Chen JC. Molecular cloning and characterisation of a cell adhesion molecule, peroxinectin from the white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2004;17:13e26. € derha €ll K. Perox[60] Sritunyalucksana K, Wongsuebsantati K, Johansson MW, So inectin, a cell adhesive protein associated with the proPO system from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2001;25:353e63. [61] Hsu PI, Liu CH, Tseng DY, Lee PP, Cheng W. Molecular cloning and characterisation of peroxinectin, a cell adhesion molecule, from the giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol 2006;21:1e10. [62] Liu CH, Cheng W, Chen JC. The peroxinectin of white shrimp Litopenaeus vannamei is synthesised in the semi-granular and granular cells, and its transcription is up-regulated with Vibrio alginolyticus infection. Fish Shellfish Immunol 2005;18:431e44.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Immune gene expression for diverse haemocytes derived from pacific white shrimp, Litopenaeus vannamei Chih-Chiu Yang a, Chung-Lun Lu a, Sherwin Chen b, Wen-Liang Liao a, **, Shiu-nan Chen b, * a b
Institute of Fisheries Science, National Taiwan University, Taipei, Taiwan, ROC College of Life Science, National Taiwan University, Taipei, Taiwan, ROC
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 October 2014 Received in revised form 3 February 2015 Accepted 3 February 2015 Available online 11 February 2015
In this study, diverse haemocytes from Pacific white shrimp Litopenaeus vannamei were spread by flow cytometer sorting system. Using the two commonly flow cytometric parameters FSC and SSC, the haemocytes could be divided into three populations. Microscopy observation of L. vannamei haemocytes in anticoagulant buffer revealed three morphologically distinct cell types designated as granular cell, hyaline cell and semigranular cell. Immune genes, which includes prophenoloxidase (proPO), lipopolysaccharide-b-glucan binding protein (LGBP), peroxinectin, crustin, lysozyme, penaeid-3a and transglutaminase (TGase), expressed from different haemocyte were analysed by quantitative real time PCR (qPCR). Results from the mRNA expression was estimated by relative level of each gene to b-actin gene. Finally, the seven genes could be grouped by their dominant expression sites. ProPO, LGBP and peroxinectin were highly expressed in granular cells, while LGBP, crustin, lysozyme and P-3a were highly expressed in semigranular cells and TGase was highly expressed in hyaline cells. In this study, L. vannamei haemocytes were firstly grouped into three different types and the immune related genes expression in grouped haemocytes were estimated. © 2015 Elsevier Ltd. All rights reserved.
Keywords: L. vannamei Hyaline cell Semigranular cell Granular cell Immune gene
1. Introduction Crustacean haemocyte plays an important roles in phagocytosis, nodule formation, encapsulation, and cytotoxicity of crustacean. These primary defense responses induce the biological innate immune system and protect crustacean avoid from parasitic and pathogenic infection [1]. The innate immune system of shrimps consists mainly of prophenoloxidase (proPO) system, clotting system, phagocytosis, encapsulation and nodule formation, antimicrobial peptides (AMPs) formation and cell agglutination. The internal defense process is the recognition of invading microorganisms, which is mediated by the pattern recognition proteins (PRPs). After recognition by PRPs, signalling cascades start and haemocytes activated [2]. The haemocytes are involved in the synthesis, storage and, upon activation, discharge of proenzymes and substrates of the clotting and proPO system [3]. The activated haemocytes also release proteins that related to defense responses, such as AMPs and peroxidase [4]. which activates encapsulation, phagocytosis, and nodule form accordingly [3,5]. * Corresponding author. Tel.: þ886 33662797; fax: þ886 23687102. ** Corresponding author. Tel.: þ886 233662883. E-mail addresses: [email protected], [email protected] (W.-L. Liao), [email protected] (S.-n. Chen). http://dx.doi.org/10.1016/j.fsi.2015.02.001 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
A number of invertebrate PRPs have been isolated and characterized based on the molecules of which they recognize. These PRPs are b-1,3-glucan binding proteins (BGBP); lipopolysaccharidebinding proteins (LBP); LPS-and b-1,3-glucan-binding protein (LGBP) as well as peptidoglycan-binding proteins (PGBP) [6,7]. Crustacean LGBP with a molecular weight of approximately 30e45 kDa was identified in crayfish Pacifastacus leniusculus [8], blue shrimp Litopenaeus stylirostris [9], Litopenaeus vannamei [10] and black tiger shrimp Penaeus monodon [11]. After binding to the ligands, LGBP engages in the activation of the proPO system that plays a prominent role in non-self recognition, haemocyte communication and the production of melanin. Upon activation, the haemocytes become degranulated and at the same time ProPO is cinverted to its active from as phenoloxidase (PO) by a serine proteinase [3]. Clotting is an essential defense mechanism in crustaceans for entraps foreign material and prevents loss of haemolymph [12]. The protein that constitutes the clotting mechanism was the clotting protein [13] and transglutaminase (TGase). TGase also plays critical roles in other biochemical process including protein crosslinking and related super structures [14]. Two types of TGase, transglutaminase I and II were found in P. monodon and Penaeus japonicus and both of them are involved in coagulation [15e17].
266
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
Penaeidins, is isolated from the L. vannamei for the first time [18], and AMPs have also been detected in several penaeid shrimps [19e21]. The penaeidins react in vitro against gram positive bacteria and fungi with clear differences in potency among strains [22,23]. Isoforms of penaeidins are classified according to their similarity in amino acid sequence into penaeidin 2 (PEN2), penaeidin 3 (PEN3), and penaeidin 4 (PEN4) [24]. Among the subgroups, PEN3 is the most abundant expressed in L. vannamei haemocytes [18,22]. Another AMP found in penaeid shrimp is crustin, initially described in shore crab, Carcinus maenas [25]. Shrimp crustin appears in L. vannamei, Litopenaeus setiferus [26], spiny lobster Panulirus argus [27], P. monodon [28], P. japonicus [29] and European lobster, Homarus gammarus [30]. The crustins have been suggested to be members of the antibacterial WAP-domain containing proteins with their structural similarity [31]. Lysozyme is widely distributed among eukaryotes and prokaryotes. It catalyzes the hydrolysis of bacterial cell walls and acts as a non-specific innate immunity molecule against the invasion of bacterial pathogens [32]. The cDNA were cloned and characterized in L. vannamei and P. japonicus [33,34]. Cell adhesion is essential for cellular immune response in invertebrates in the presence of microorganisms [35]. A cell adhesion molecule, peroxinectin, is responsible of degranulation, encapsulation, enhancement, peroxinectin, and peroxidase [35,36]. The biological activity of peroxinectin is generated with a concomitant activation of the prophenoloxidase (proPO) system [37]. In this study, we applied the Flow cytometery sort system to isolate diverse haemocyte groups from L. vannamei. Subsequently, differential haemocyte morphologies were then identified by light microscopy, while the distribution of seven important immunerelated genes and relative expression level in different haemocytes were analyzed by conventional RT-PCR and quantitative real time PCR (qPCR). An overall view concerning the physiological expression levels of these genes in different haemocytes from L. vannamei was illustrated. 2. Materials and methods 2.1. Animals White shrimp L. vannamei (12e15 g) obtained from National Taiwan Ocean University in Keelung, Taiwan were stocked in recirculating water tanks system with water salinity and temperature maintained at 30‰ and 25 C, respectively. The shrimps were fed a commercial pelleted feed. The shrimp were screened for viral contamination and molting status. The viral inspection included white spot syndrome virus (WSSV), infectious hypodermal and haematopoietic necrosis virus (IHHNV) and Taura syndrome virus (TSV). Only those in the inter-molt or early pre-molt stage without any viral infections were used. 2.2. Haemolymph collection Haemolymph was collected from the ventral sinus with a 1-ml syringe and a 26-gauge needle with 0.1 ml pre-cooled anticoagulant buffer (0.45 M NaCl, 0.1 M glucose, 10 mM EDTA, 30 mM Sodium citrate, 26 mM citrate acid, pH 5.6, osmolality € derha €ll and Smith [38]. 900 mOsm kg1) which was modify from So The haemolymph was mixed immediately with an equal volume of EDTA as the anticoagulant buffer, which prevented degranulation and cell lysis in crustacean haemocytes. All chemicals were obtained from Sigma (St. Louis, USA). Cell counts and viabilities were determined by microscopy using a haemocytometer and trypan blue exclusion. Only cell preparations with viabilities higher than 90% were used for experiment.
2.3. Flow cytometry and cell-sorting All flow-cytometric analyses were carried in Aria III (BectoneDickinson, St. Jose, CA, USA) equipped with both sorting device and cell delivery robotics. Both flow-cytometric analysis and cellsorting were carried out with the 80-um nozzle. At least 100,000 events were collected and analyzed by Aria III for each flow cytometery. Hyaline cells are spherical with centrally placed nucleus and a prominent nucleolus. Semi-granular cells are typically spindleshaped with an expanded cytoplasm and multiple granules; the nucleus is usually central. Granular cells are usually oval or irregular in shape and of larger size than hyaline cells. For formaldehyde-fixed cells, semi-granular cells (small granule haemocytes) and granular cells (large granule haemocytes) contain granules but the latter possesses more [39]. Both relative cell sizes and granularity can conveniently be measured by the forward scatter (FSC) and side scatter (SSC). A pre-run on haemocytes was carried out to tune the system into the best scales for separating the various populations on screen. Three separate sorting runs were carried to generate the observed populations shown in this paper. The purity of sorted haemocytes was analyzed further microscopically. 2.4. Wright's stain Cell suspension was flooded an air-dried smear with Wright's satin and allow to stand for 1e3 min. Add an equal amount of Wright's buffer and mixed by gently blowing on the slide until a metallic green sheen forms on the surface. Allowed it to stand for 2e6 min (the exact time must be determined for each batch of stain) and gently rinse the stain from the slide using taps water or distilled water. Finally, prop up the slide and allow it to air-dry. 2.5. Total RNA isolation and reverse transcription Total RNA was extracted from the different haemocytes according to the Trizol protocols (Invitrogen). RNA was quantified at 260 and 280 nm using NanoDrop-1000 (Thermo Scientific). Only RNAs with absorbance ratios (A260:A280) range in 1.8e2.0 were used for further experiments. First strand cDNA was generated with 20ul reaction volume containing 2 mg total RNA, 1X RT buffer, 1 mM dNTP, 0.2 mM Oligo(dT15), 10U of RNase inhibitor and 50U MultiScribe Reverse Transcriptase (Applied Biosystems) and the reaction was conducted at 37 C for 2 h. 2.6. Quantitative real-time PCR analysis of gene expression Gene expression was analyzed by quantitative real-time PCR (qPCR) using Bio-Rad CFX384 (Bio-Rad Laboratories, Richmond, CA) using SYBR Green Supermix kits. The qPCR conditions were 95 C for 3 min and 50 cycles of 95 C for 10 s and 58 C for 30 s. Relative gene expression was calculated as 2DCt, where Ct is threshold cycle. The expression levels of the housekeeping gene b-actin were not altered with any of call population (data not shown). Table 1 displays the list of primer sequences. Data were analyzed by oneway ANOVA with post hoc LSD to adjust P values for multiple comparisons. P < 0.05 was considered statistically significant. 3. Result 3.1. Haemocyte sorting and identification Flow cytometric analysis was performed on haemocytes derived from pacific white shrimp, L. vannamei. Using the two commonly
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
267
Table 1 Seven immune-related genes of Pacific white shrimp, L. vannamei and their orresponding PCR primers used for quantitative real time PCR. Target gene
GenBank#
Forward sequence (50 to 30 )
Reverse sequence (50 to 30 )
Products (bp)
b-actin
AF300705 AY723296 AY723297 AY486425.1 AF430076 AY170126 Y14926 BE188522
CCACGAGACCACCTACAAC CGGTGACAAAGTTCCTCTTC ACCGCAGCATCAGTTATACC GAAGAAAGGAGACCGATAC ACGAGGCAACCATGAAGG GGACTACGGCATCTTCCAGA CACCCTTCGTGAGACCTTTG TTCACAAGCCTGACATCACC
AGCGAGGGCAGTGATTTC GCAGGTCGCCGTAGTAAG GTCATCGCCCTTCCAGTTG GCTGGACGGCTTGGATG AACCACCACCAACACCTAC ATCGGACATCAGATCGGAAC AATATCCCTTTCCCACGTGAC GCAGCAGTGGGATAGGGTTA
142 bp 122 bp 77 bp 137 bp 141 bp 97 bp 121 bp 99 bp
ProPO LGBP Peroxinectin Crustin Lysozyme PEN-3a TGase
used flow cytometric parameters FSC and SSC, the haemocytes could clearly be divided into three populations (Fig. 1). The FSC alone (linear scale) could distinguish a group of small cells, having FSC values less than half of those of the larger cells. The two groups of larger cells could be resolved further by SSC (exponential scale) with the upper group having a relative SSC value 10 times that of the lower group. The different groups were successfully sorted with the use of the two parameters. The “P1” group of larger cells with higher SSC was microscopically confirmed to be the granular cell; The “P2” group of cells with lower FSC values was microscopically confirmed to be the hyaline cells. While the “P3” group of larger cells with less SSC was microscopically confirmed to be the semigranular cell. Microscopy of L. vannamei haemocytes in anticoagulant buffer revealed three morphologically distinct cell types designated as granular cells (Fig. 2A), hyaline cells (Fig. 2B) and semigranular cells (Fig. 2C). Granular cells were identified by the conspicuous granules; granules in semigranular cells showed smaller and less than those in granular cells. Hyaline cells were believed with large nuclei and possessed different degrees of complexity and various shapes. 3.2. Haemocyte gene expression studied with quantitative real time PCR The abundances of mRNA transcripts from each gene were analyzed by quantitative real time PCR using ten shrimps. Results from the mRNA expression were estimated by relative level of each gene to beta-actin gene. As demonstrated, the seven genes could be grouped by their dominant expression sites. proPO, LGBP and
Fig. 1. An example of flow cytometric analysis of fresh circulating haemocytes from Litopenaeus vannamei analyzed by forward scatter (FSC), indicating cell size; and side scatter (SSC), indicating cell granularity and structure. Granular cell, hyaline cell and semigranular cell populations are designated P1 (G), P2 (H) and P3 (SG) respectively.
peroxinectin were highly expressed in granular cells (Figs. 3e5), while LGBP, crustin, lysozyme and P-3a were highly expressed in semigranular cells (Figs. 4, 6e8) and TGase was highly expressed in hyaline cells (Fig. 9). While mRNAs of proPO was present in granular cells, the levels of expression in granular cells were 5e10 times higher than other cells (Fig. 3). While mRNAs of LGBP was present in granular cells and semigranular cells, the levels of expression in granular cells and semigranular cells were two times higher than those of hyaline cells (Fig. 4). While mRNAs of peroxinectin was present in granular cells, there was no significant difference found in the semigranular cells (Fig. 5). While mRNAs of crustin was present in semigranular cells, the levels of expression in semigranular cells were five to ten times higher than other cells (Fig. 6). While mRNAs of lysozyme was present in semigranular cells, the levels of expression in semigranular cells were three times higher than other cells (Fig. 7). While mRNAs of P-3a was present in semigranular cells, the levels of expression in semigranular cells were four to twelve times higher than other cells (Fig. 8). While mRNAs of TGase was present in hyaline cells, the levels of expression in hyaline cells were ten to twenty times higher than other cells (Fig. 9).
4. Discussion Using phase-contrast microscopy, we're able to distinguish different types of granular, semigranular, and hyaline cells in crayfish, Astacus astacus [40]. Using oblique light microscopy, different types of haemocyte were identified from the crayfish P. zonangulus, P. japonicas [41] and Crassostrea virginica [42], Flow Cytometery analysis of live haemocytes in anticoagulation buffer delineated three subpopulations. The study of crayfish haemocytes in anticoagulation buffer facilitated the observation of distinct cell populations. The buffer prevents the activation of proPO and maintains cells in a quiescent state [38,43]. Microscopy and FSC results showed similar patterns of distributions among the cell types, although FSC values were approximately 10% lower for hyaline cells. Hyaline cells were the most abundant cell type in P. zonangulus (77e89%), as stated in previous reports of microscopic and FSC observations of Penaeus spp [44,45]. and oyster haemocytes [42,46]. By microscopy, A. astacus monolayers were composed of approximately 50% semigranular, 30% granular, and 20% hyaline cells. With the epidemic of shrimp diseases globally, studies of shrimp immune-related genes and their expressions has received accumulative attentions. Prior researches were performed based on results from the expression of genes after sensitizing with immunestimulants or pathogenic challenges to assess the immune responsiveness. However, the results were solely based on the expressions of selected genes from the semen without locating the exact gene that has been expressed in the associated haemocytes. In this present study, we have clearly demonstrated how the different immune-related genes were expressed in different haemocytes.
268
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
Fig. 2. L. vinnamei haemocytes in anticoagulant buffer imaged by light microscopy. (A) Granular cell with conspicuous large granules (arrow). (B) Hyaline cell with large nucleus (arrow) and fewer cytoplasmic vesicles. (C) Semigranular cells showing many cytoplasmic granules (arrow) characteristically smaller than those of granular cells. Bars are 10 mm.
In previous studies, proPO mRNA expression at various shrimp tissues was analyzed by RT-PCR and in situ hybridization. The results indicated that there are highly expressed proPO in haemocyte [47]. In other arthropods, including crayfish and P. monodon, results from Northern blot analysis indicate that haemocytes were the sole site for proPO synthesis [48,49]. In the present study, the qPCR analyses also showed that granular cells were the main producer of proPO transcript. Transglutaminases (TGase) are known to play critical roles in blood coagulation. TGase from Pacifastacus leniusculus, P. monodon and Marsupenaeus japonicus have been cloned and characterized
[15e17,50] but only partial sequence is available in L. vannamei. The partial sequence obtained in the present study belongs to type I TGase according to the nucleotide sequence, which indicated a similarity of 88% to the STG I of P. monodon (AY074924). Using Northern blotting, Wang et al. [50] showed that TGase was expressed almost exclusively in haemocytes with only very faint signals in the hepatopancreas and muscle tissues in P. leniusculus. In P. monodon, STG I mRNA is widespread except in the eyestalk when studied by RT-PCR [15]. Compared to these results, the expression level of STG I in L. vannamei haemocyte was firstly discovered dominant in hyaline cell and less in granular cell and semigranular cell.
Fig. 3. Haemocytes distribution of ProPO mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
Fig. 4. Haemocytes distribution of LGBP mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
Fig. 5. Haemocytes distribution of peroxinectin mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
269
Fig. 7. Haemocytes distribution of Lysosome mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
Crustins and crustin-like peptides have been identified from a variety of crustacean species. Their complete sequences or EST were all obtained from haemocyte cDNA library, which was derived from epithelial cell of the olfactory organ [27]. Another paper show that crustin was found to be constitutively expressed at high levels in haemocytes, lower levels in hearts, gills, intestines and lymphoid organs and none in hepatopancreas in P. monodon by RT-PCR [28]. In M. japonicus, crustin mRNA is only detected in haemocyte, not in heart, hepatopancreas, gill, foregut, midgut muscle and epidermis [29]. In situ hybridisation result from L. vannamei showed that crustin mRNA only expressed in haemocytes [51]. Our results indicated that high level L. vannamei crustins was detected by RTPCR in semigranular cells. Penaeidin mRNA has been shown to express strongly in many penaeid shrimp including Fenneropenaeus chinensis [21], L. vannamei [52], and P. monodon [53]. Penaeidin transcripts present in haemocyte, but not in heart, intestine, gill, subcuticular epithelium, lymphoid organ, hepatopancreas and muscle of P. monodon when studied by Northern blot analysis [20]. In
L. vannamei, penaeidin (PEN-3) mRNA was detected in all the tissues examined including haematopoietic nodules and testis but not in the brain when studied also by Northern blot analysis [54]. In F. chinensis, in addition to haemocytes, gill, heart and intestine detected using Northern blot technique, penaeidin transcript was also observed in hepatopancreas, eye, subcuticular epithelium, brain and stomach when RT-PCR analysis was used [21]. Using the RT-PCR, the present study found that penaeidin expressed in semigranular cells. In vertebrate, macrophages and the epithelial cell such as Paneth cells in the intestine crypt are the major producers of lysozyme [55]. In L. vannamei, lysozyme transcript present in tissues was infiltrated by haemocytes [56] when observed by in situ hybridization. Lysozyme transcripts also are widely distributed in haemocytes and other tissues of the Penaeus japonicus using RT-PCR analysis [34]. This result showed that lysozyme was express in semigranular cells. The functions of hyaline cells are phagocytosis, which was carried out by lysozyme, but in our study, the highest level of lysozyme expression was in semigranular cells.
Fig. 6. Haemocytes distribution of crustin mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
Fig. 8. Haemocytes distribution of penaeid-3a mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
270
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271
Fig. 9. Haemocytes distribution of TGase mRNA in Pacific white shrimp Litopenaeus vannamei by quantitative real-time PCR analyses. The result of mRNA expression was presented relative to b-actin expressions. Total RNA from different haemocyte was used for preparation of cDNA that was applied as template in real time PCR using ProPO specific primer. Error bars represent standard error of mean (n ¼ 16).
LGBP has been cloned from the haemocytes of the tiger shrimp P. monodon [11] and crayfish P. leniusculus [8], the hepatopancreas of the blue shrimp Litopenaeus stylirostris [9], or both haemocyte and hepatopancreas of the Pacific white shrimp L. vannamei [10,51]. However, we could not find apparent both in granular cells and semigranular cells. The RT-PCR and qPCR results also showed that the expression of LGBP in granular cells and semigranular cells were much higher than those of in hyaline cells. Peroxinectin is essential in the crustacean cellular defence reaction for the enhancement of encapsulation [57]. It is ubiquitous in invertebrates, including fruit fly Drosophila melanogastermeta [58], American oyster C. virginica (GenBank accession number CD647078), white shrimp L. vannamei [59], tiger shrimp P. monodon [60], crayfish P. leniusculus [37], and giant freshwater prawn Macrobrachium rosenbergii [61]. In L. vannamei, peroxinectin mRNA was detected in granular cells, and in the semigranular cells/hyaline cells band via RT-PCR [62]. In this study, granular cells express the highest level of peroxinectin. Shrimp haemocyte plays critical roles in shrimp's immune system which functions on an open circulation system. In this study, L. vannamei haemocytes were grouped into three types and the immune related genes expression in grouped haemocytes were estimated. By utilizing results from the current study, the shrimp farming industry can establish a new standard to survey the immune and physiological health of the cultured shrimps, which may provide additional references in diseases control and management in the modern aquaculture farming.
References € derha €ll K, Cerenius L. Crustacean immunity. Ann Rev Fish Dis 1992:3e23. [1] So [2] Vargas-Albores F, Yepiz-Plascencia G. Beta glucan binding protein and its role in shrimp immune response. Aquaculture 2000;191:13e21. €derha €ll K. The proPO and clotting system in crusta[3] Sritunyalucksana K, So ceans. Aquaculture 2000;191:53e69. €derha €ll K. The prophenoloxidase-activating system in in[4] Cerenius L, So vertebrates. Immunol Rev 2004;198:116e26. [5] Bachere E, Gueguen Y, Gonzalez M, de Lorgeril J, Garnier J, Romestand B. Insights into the anti-microbial defense of marine invertebrates: the penaeid shrimps and the oyster Crassostrea gigas. Immunol Rev 2004;198:149e68. €derh€ [6] Duvic B, So all K. Purification and characterization of a beta-1,3-glucan binding protein from plasma of the crayfish Pacifastacus leniusculus. J Biol Chem 1990;265:9327e32.
[7] Vargas-Albores F, Jimenez-Vega F, Yepiz-Plascencia GM. Purification and comparison of beta-1,3-glucan binding protein from white shrimp (Penaeus vannamei). Comp Biochem Physiol B Biochem Mol Biol 1997;116:453e8. €derha €ll K. A lipopolysaccharide- and beta-1,3-glucan[8] Lee SY, Wang R, So binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization, and cDNA cloning. J Biol Chem 2000;275:1337e43. [9] Roux MM, Pain A, Klimpel KR, Dhar AK. The lipopolysaccharide and beta-1,3glucan binding protein gene is upregulated in white spot virus-infected shrimp (Penaeus stylirostris). J Viro 2002;76:7140e9. [10] Cheng W, Liu CH, Tsai CH, Chen JC. Molecular cloning and characterisation of a pattern recognition molecule, lipopolysaccharide- and beta-1,3-glucan binding protein (LGBP) from the white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2005;18:297e310. €derh€ [11] Sritunyalucksana K, Lee SY, So all K. A beta-1,3-glucan binding protein from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2002;26:237e45. [12] Martin GG, Hose JE, Omori S, Chong C, Hoodbhoy T, Mckrell N. Localization and roles of coagulogen and transglutaminase in hemolymph coagulation in Decapod crustaceans. Comp Biochem Phys B 1991;100:517e22. €derha €ll K. Isolation and characterization of a [13] Kopacek P, Grubhoffer L, So hemagglutinin with affinity for lipopolysaccharides from plasma of the crayfish Pacifastacus leniusculus. Dev Comp Immunol 1993;17:407e18. [14] Lorand L, Graham RM. Transglutaminases: crosslinking enzymes with pleiotropic functions. Nat Rev Mol Cell Biol 2003;4:140e56. €derha €ll K, Song YL. Molecular cloning and [15] Huang CC, Sritunyalucksana K, So characterization of tiger shrimp (Penaeus monodon) transglutaminase. Dev Com Immunol 2004;28:279e94. [16] Yeh MS, Kao LR, Huang CJ, Tsai IH. Biochemical characterization and cloning of transglutaminases responsible for hemolymph clotting in Penaeus monodon and Marsupenaeus japonicus. Biochim Biophys Acta 2006;1764:1167e78. [17] Chen M-Y, Hu K-Y, Huang C-C, Song Y-L. More than one type of transglutaminase in invertebrates? A second type of transglutaminase is involved in shrimp coagulation. Dev Com Immunol 2005;29:1003e16. [18] Destoumieux D, Bulet P, Loew D, Van Dorsselaer A, Rodriguez J, Bachere E. Penaeidins, a new family of antimicrobial peptides isolated from the shrimp Penaeus vannamei (Decapoda). J Biol Chem 1997;272:28398e406. [19] Munoz M, Vandenbulcke F, Garnier J, Gueguen Y, Bulet P, Saulnier D, et al. Involvement of penaeidins in defense reactions of the shrimp Litopenaeus stylirostris to a pathogenic vibrio. Cell Mol Life Sci 2004;61:961e72. [20] Ho SH, Chao YC, Tsao HW, Sakai M, Chou HN, Song YL. Molecular cloning and recombinant expression of tiger shrimp Penaeus monodon penaeidin. Fish Pathol 2004;39:15e23. [21] Kang CJ, Wang JX, Zhao XF, Yang XM, Shao HL, Xiang JH. Molecular cloning and expression analysis of Ch-penaeidin, an antimicrobial peptide from Chinese shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2004;16:513e25. [22] Destoumieux D, Munoz M, Bulet P, Bachere E. Penaeidins, a family of antimicrobial peptides from penaeid shrimp (Crustacea, Decapoda). Cell Mol Life Sci 2000;57:1260e71. [23] Destoumieux D, Bulet P, Strub JM, Van Dorsselaer A, Bachere E. Recombinant expression and range of activity of penaeidins, antimicrobial peptides from penaeid shrimp. Eur J Biochem 1999;266:335e46. [24] Cuthbertson BJ, Shepard EF, Chapman RW, Gross PS. Diversity of the penaeidin antimicrobial peptides in two shrimp species. Immunogenetics 2002;54:442e5. [25] Relf JM, Chisholm JR, Kemp GD, Smith VJ. Purification and characterization of a cysteine-rich 11.5-kDa antibacterial protein from the granular haemocytes of the shore crab, Carcinus maenas. Eur J Biochem 1999;264:350e7. [26] Bartlett TC, Cuthbertson BJ, Shepard EF, Chapman RW, Gross PS, Warr GW. Crustins, homologues of an 11.5-kDa antibacterial peptide, from two species of penaeid shrimp, Litopenaeus vannamei and Litopenaeus setiferus. Mar Biotechnol (NY) 2002;4:278e93. [27] Stoss TD, Nickell MD, Hardin D, Derby CD, McClintock TS. Inducible transcript expressed by reactive epithelial cells at sites of olfactory sensory neuron proliferation. J Neurobiol 2004;58:355e68. [28] Supungul P, Klinbunga S, Pichyangkura R, Hirono I, Aoki T, Tassanakajon A. Antimicrobial peptides discovered in the black tiger shrimp Penaeus monodon using the EST approach. Dis Aquat Organ 2004;61:123e35. [29] Rattanachai A, Hirono I, Ohira T, Takahashi Y, Aoki T. Cloning of kuruma prawn Marsupenaeus japonicus crustin-like peptide cDNA and analysis of its expressiony. Fish Sci 2004;70:765e71. [30] Hauton C, Brockton V, Smith VJ. Cloning of a crustin-like, single whey-acidicdomain, antibacterial peptide from the haemocytes of the European lobster, Homarus gammarus, and its response to infection with bacteria. Mol Immunol 2006;43:1490e6. [31] Vargas-Albores F, Yepiz-Plascencia G, Jimenez-Vega F, Avila-Villa A. Structural and functional differences of Litopenaeus vannamei crustins. Comp Biochem Phys B 2004;138:415e22. [32] Jolles P, Jolles J. Whats new in lysozyme research e always a model system, today as yesterday. Mol Cell Biochem 1984;63:165e89. [33] Sotelo-Mundo RR, Islas-Osuna MA, de-la-Re-Vega E, Hernandez-Lopez J, Vargas-Albores F, Yepiz-Plascencia G. cDNA cloning of the lysozyme of the white shrimp Penaeus vannamei. Fish Shellfish Immunol 2003;15:325e31. [34] Hikima S, Hikima J, Rojtinnakorn J, Hirono I, Aoki T. Characterization and function of kuruma shrimp lysozyme possessing lytic activity against Vibrio species. Gene 2003;316:187e95.
C.-C. Yang et al. / Fish & Shellfish Immunology 44 (2015) 265e271 [35] Johansson MW. Cell adhesion molecules in invertebrate immunity. Dev Comp Immunol 1999;23:303e15. €derha €ll K. Invertebrate immunity. Dev Comp Immunol 1999;23:263e6. [36] So €derha €ll K. Perox[37] Johansson MW, Lind MI, Holmblad T, Thornqvist PO, So inectin, a novel cell adhesion protein from crayfish blood. Biochem Biophys Res Commun 1995;216:1079e87. €derha €ll K, Smith VJ. Separation of the haemocyte populations of Carcinus [38] So maenas and other marine decapods, and prophenoloxidase distribution. Dev Comp Immunol 1983;7:229e39. [39] Martin GG, Shapiro DJ. Regulation of rat liver cell 3-hydroxy-3-methylglutaryl coenzyme A reductase by methoxypolyoxyethylated cholesterol. Biochim Biophys Acta 1985;837:163e72. €derha €ll K. Induction of degranulation and lysis of haemocytes in [40] Smith VJ, So the freshwater crayfish, Astacus astacus by components of the prophenoloxidase activating system in vitro. Cell Tiss Res 1983;233:295e303. [41] Sequeira T, Vilanova M, Lobo-Da-Cunha A, Baldaia L, Arala-Chaves M. Flow cytometric analysis of molt-related changes in hemocyte type in male and female Penaeus japonicus. Biol Bull 1995;189:376e80. [42] Ashton-Alcox KA, Ford SE. Variability in molluscan hemocytes: a flow cytometric study. Tiss Cell 1998;30:195e204. [43] Rodriguez J, Boulo V, Mialhe E, Bachere E. Characterisation of shrimp haemocytes and plasma components by monoclonal antibodies. J Cell Sci 1995;108(Pt 3):1043e50. [44] Le Moullac G, Le Groumellec M, Ansquer D, Froissard S, Levy P, Aquacop. Haematological and phenoloxidase activity changes in the shrimp Penaeus stylirostris in relation with the moult cycle protection against vibriosis. Fish Shellfish Immunol 1997;7:227e34. [45] Owens L, O'Neill A. Use of a clinical cell flow cytometer for differential counts of prawn Penaeus monodon haemocytes. Dis Aquat Organ 1997;31: 147e53. [46] Ford SE, Ashtonalcox KA, Kanaley SA. Comparative cytometric and microscopic analyses of oyster hemocytes. J Invertebr Pathol 1994;64:114e22. [47] Wang YC, Chang PS, Chen HY. Tissue distribution of prophenoloxidase transcript in the Pacific white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2006;20:414e8. [48] Aspan A, Huang TS, Cerenius L, Soderhall K. cDNA cloning of prophenoloxidase from the freshwater crayfish Pacifastacus leniusculus and its activation. Proc Natl Acad Sci U S A 1995;92:939e43. €derha €ll K. Molecular cloning and charac[49] Sritunyalucksana K, Cerenius L, So terization of prophenoloxidase in the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 1999;23:179e86.
271
€derh€ [50] Wang R, Liang Z, Hal M, So all K. A transglutaminase involved in the coagulation system of the freshwater crayfish, Pacifastacus leniusculus. Tissue localisation and cDNA cloning. Fish Shellfish Immunol 2001;11:623e37. [51] Wang YC, Chang PS, Chen HY. Tissue expressions of nine genes important to immune defence of the Pacific white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2007;23:1161e77. [52] Munoz M, Vandenbulcke F, Saulnier D, Bachere E. Expression and distribution of penaeidin antimicrobial peptides are regulated by haemocyte reactions in microbial challenged shrimp. Eur J Biochem 2002;269:2678e89. [53] Cheng W, Tung YH, Liu CH, Chen JC. Molecular cloning and characterisation of cytosolic manganese superoxide dismutase (cytMn-SOD) from the giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol 2006;20:438e49. [54] Destoumieux D, Munoz M, Cosseau C, Rodriguez J, Bulet P, Comps M, et al. Penaeidins, antimicrobial peptides with chitin-binding activity, are produced and stored in shrimp granulocytes and released after microbial challenge. J Cell Sci 2000;113(Pt 3):461e9. [55] Chung LP, Keshav S, Gordon S. Cloning the human lysozyme cDNA: inverted Alu repeat in the mRNA and in situ hybridization for macrophages and paneth cells. Proc Natl Acad Sci U S A 1988;85:6227e31. [56] Burge EJ, Madigan DJ, Burnett LE, Burnett KG. Lysozyme gene expression by hemocytes of Pacific white shrimp, Litopenaeus vannamei, after injection with vibrio. Fish Shellfish Immunol 2007;22:327e39. € derha €ll K. Cellular immunity in crustaceans and the proPO [57] Johansson MW, So system. Parasitol Today 1989;5:171e6. [58] Vazquez M, Rodriguez R, Zurita M. A new peroxinectin-like gene preferentially expressed during oogenesis and early embryogenesis in Drosophila melanogaster. Dev Genes Evol 2002;212:526e9. [59] Liu CH, Cheng W, Kuo CM, Chen JC. Molecular cloning and characterisation of a cell adhesion molecule, peroxinectin from the white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2004;17:13e26. € derha €ll K. Perox[60] Sritunyalucksana K, Wongsuebsantati K, Johansson MW, So inectin, a cell adhesive protein associated with the proPO system from the black tiger shrimp, Penaeus monodon. Dev Comp Immunol 2001;25:353e63. [61] Hsu PI, Liu CH, Tseng DY, Lee PP, Cheng W. Molecular cloning and characterisation of peroxinectin, a cell adhesion molecule, from the giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol 2006;21:1e10. [62] Liu CH, Cheng W, Chen JC. The peroxinectin of white shrimp Litopenaeus vannamei is synthesised in the semi-granular and granular cells, and its transcription is up-regulated with Vibrio alginolyticus infection. Fish Shellfish Immunol 2005;18:431e44.
