Published May 15, 2015

Impact of adding Saccharomyces strains on fermentation, aerobic stability, nutritive value, and select lactobacilli populations in corn silage1 L. Duniere,* L. Jin,* B. Smiley,† M. Qi,† W. Rutherford,† Y. Wang,* and T. McAllister*2 *Agriculture and Agri-Food Canada Research Centre, Lethbridge, Alberta, Canada; and †DuPont Pioneer, Forage Additive Research, Johnston, IA 5013

ABSTRACT: Bacterial inoculants can improve the conservation and nutritional quality of silages. Inclusion of the yeast Saccharomyces in the diet of dairy cattle has also been reported to be beneficial. The present study assessed the ability of silage to be used as a means of delivering Saccharomyces strains to ruminants. Two strains of Saccharomyces cerevisiae (strain 1 and 3) and 1 strain of Saccharomyces paradoxus (strain 2) were inoculated (103 cfu/g) individually onto corn forage that was ensiled in mini silos for 90 d. Fermentation characteristics, aerobic stability, and nutritive value of silages were determined and real-time quantitative PCR (RT-qPCR) was used to quantify S. cerevisiae, S. paradoxus, total Saccharomyces, fungal, and bacterial populations. Fermentation characteristics of silage inoculated with S1 were similar to control silage. Although strain 3 inoculation increased ash and decreased OM contents of silage (P = 0.017), no differences were observed

in nutrient composition or fermentation profiles after 90 d of ensiling. Inoculation with Saccharomyces had no detrimental effect on the aerobic stability of silage. In vitro DM disappearance, gas production, and microbial protein synthesis were not affected by yeast inoculation. Saccharomyces strain 1 was quantified throughout ensiling, whereas strain 2 was detected only immediately after inoculation. Saccharomyces cerevisiae strain 3 was quantified until d 7 and detectable 90 d after ensiling. All inoculants were detected and quantified during aerobic exposure. Inoculation with Saccharomyces did not alter lactobacilli populations. Saccharomycetales were detected by RT-qPCR throughout ensiling in all silages. Both S. cerevisiae and S. paradoxus populations increased during aerobic exposure, demonstrating that the density of these yeast strains would increase between the time that silage was removed from storage and the time it was fed.

Key words: corn silage, fermentation, nutritive value, real-time quantitative PCR, Saccharomyces, silage inoculants © 2015 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2015.93:2322–2335 doi:10.2527/jas2014-8287 INTRODUCTION Improving silage quality can enhance the efficiency and economic sustainability of ruminant production systems. Silage inoculants are one means 1Financial support for this study from DuPont Pioneer, Canada,

is gratefully acknowledged. The authors thank C. Barkley, Z. Madic, D. Vedres, F. Van Herk, R. Brandt, L. Schneider, S. Cook, C. Klima, and S. Shantappa for their invaluable technical assistance on this project and F. Owens for his help in reviewing this manuscript. We are also grateful to M. Anderson and staff at the Individual Feeding Barn for taking care of the animals. 2Corresponding author: [email protected] Received July 15, 2014. Accepted February 26, 2015.

of achieving this goal. The first generation inoculants, comprising homolactic bacteria, promoted a rapid decline in postensiling pH (Lesins and Schulz, 1968). Subsequently, Lactobacillus buchneri was developed as a second generation inoculant to produce acetic acid and improve the aerobic stability of silage by inhibiting spoilage microorganisms (Reich and Kung, 2010). Some L. buchneri strains are considered third generation inoculants based on their ability to produce fibrolytic enzymes with the potential to increase forage digestibility (Addah et al., 2012). Direct-fed microbials (DFM) can offer benefits to livestock nutrition and health by modifying the microbial ecology of the digestive tract (Brashears et al., 2005). Certain DFM enhance growth rate and milk production and can exclude zoonotic pathogens from

2322

Saccharomyces as a corn silage inoculant

the intestinal tract (McAllister et al., 2011). Although these responses mechanisms remain largely unknown, some microorganisms in silage inoculants may remain active in the rumen (Weinberg et al., 2003) and act synergistically when combined with other bacterial species (Lettat et al., 2012). Therefore, this fourth generation of silage inoculants, in addition to improving silage quality, digestibility, and aerobic stability, could alter the microbial ecology within the gastrointestinal tract of ruminants to benefit health and/or production efficiency. Yeasts are among the most extensively used DFM with Saccharomyces spp. improving feed efficiency, decreasing ruminal acidosis, and mitigating methane emissions (Chaucheyras-Durand et al., 2008; Desnoyers et al., 2009; McAllister et al., 2011). We hypothesized that the 3 Saccharomyces strains selected for their beneficial effect on ruminal pH would remain viable after ensiling and would not alter lactobacilli populations or the quality of corn silage. Therefore, the objective of this study was to investigate the impacts of these strains on ensiling fermentation characteristics and aerobic stability, silage quality, and lactobacilli populations within corn silage. MATERIAL AND METHODS Forage Corn (Zea mays; 39T67; Pioneer Inc., Johnston, IA) planted in May of 2012 at the Lethbridge Research Centre (Lethbridge, AB, Canada) was harvested in September at two-thirds milk line maturity (32 to 34% DM). The harvested forage was chopped to 9.5-mm theoretical length with a forage harvester (John Deere 6610; John Deere, Moline, IL) equipped with a kernel processor. Mini Silo Experiment The chopped, kernel-processed forage was divided into four 20-kg lots, spread on separate plastic sheets, and sprayed with either water, that is, uninoculated (control corn [CON]), or with Saccharomyces cerevisiae (strain 1), Saccharomyces paradoxus (strain 2), or S. cerevisiae (strain 3) at the rate of 1.0 × 103 cfu/g fresh weight. The 4 corners of the sheet were drawn together; the forage was tumbled inside the sheet for approximately 3 min and hand mixed for an additional minute to ensure uniform inoculation. Forages (2.5 to 3 kg) were packed into mini polyvinyl chloride silos with a hydraulic press to a density of approximately 240 kg/m3. Each silo, weighed before and immediately after filling and sealing, was stored at 22°C. Triplicate silos for each treatment (CON, S1, S2 or S3)

2323

and sampling date were prepared and opened after 7, 28, 60, and 90 d of ensiling. Before ensiling (Day 0), triplicate samples of forage were collected for chemical and microbial analyses. Silos were weighed before opening so DM loss could be calculated. The contents of each of the triplicate mini silos were mixed thoroughly after opening and samples from individual silos were subsampled for chemical, microbial, and molecular analyses. Aerobic Stability Triplicate silos from each treatment opened on the final day of ensiling were subsampled and the samples combined to obtain 400 g of silage (3 replicates per treatment). These samples were placed into separate 4-L insulated containers, covered with 2 layers of cheesecloth, and stored at 20°C for 21 d. Two Dallas Thermochron iButtons (Embedded Data Systems, Lawrenceburg, KY) were embedded in the lower and middle layers of the silage mass in each container and in the silo storage room to record temperature every 15 min. Ambient temperature and the temperature in each container were monitored simultaneously for 21 d. The contents of each container were thoroughly mixed and sampled after 3, 7, 14, and 21 d of aerobic exposure (AE) for chemical, microbial, and molecular analyses. Aerobic stability, defined by Teller et al. (2012) as the number of hours the temperature of silage exposed to air exceeded baseline room temperature by 2°C, was determined. Chemical Analysis Both the unfermented forage and the silage samples collected on d 90 from each mini silo were analyzed for water-soluble carbohydrates (WSC), ammonia nitrogen (NH3–N), and starch, as described by Zahiroddini et al. (2004). Volatile fatty acids and lactate were determined by the methods of Kudo et al. (1987) using a Hewlett-Packard model 5890A Series Plus II gas liquid chromatograph (column: 30-m nitrotereftalic ester of polyethylene glycol fused silica capillary, 0.32 mm i.d., and 1.0 m film thickness; Phenomenex, Torrance, CA). Total N was determined by elemental analysis (Dumas Nitrogen) using a NA1500 Nitrogen/Carbon analyzer (Carlo Erba Instruments, Milan, Italy). Crude protein was calculated as N × 6.25. The forage and silage samples were analyzed for DM by drying at 105°C in forceddraft oven for 24 h, for OM by ashing 1 g of dried sample in a muffle furnace at 550°C for 5 h, and for NDF and ADF using an Ankom 200 system (Ankom Technology Corporation, Fairport, NY) with the addition of sodium sulfite and α-amylase for NDF but

2324

Duniere et al.

without α-amylase for ADF. Nitrogen in ADF residues (ADF insoluble nitrogen and ADIN) was measured by combustion as described above. For pH measurement, fresh forage or silage (15 g) from each mini silo at each sampling date was mixed with 135 mL of deionized water, blended for 30 s, and filtered through 2 layers of cheesecloth. The pH of the filtrate was measured with a Symphony pH meter (VWR International, Mississauga, ON). Microbial Analysis For microbial analyses, forage or silage (10 g) was added to 90 mL of sterile 70 mM potassium phosphate buffer (pH 7.0) and agitated for 60 s at 260 rpm in a Stomacher 400 Circulator (Seward Stomacher, London, UK). The suspension was serially diluted and spread in triplicate onto semiselective lactobacilli media amended with 200 mg/mL of cycloheximide (de Man, Rogosa, and Sharpe [MRS]; Dalynn Biologicals, Calgary, Canada) for enumeration of Lactic Acid bacteria (LAB), onto nutrient agar amended with 200 mg/ mL of cycloheximide (Dalynn Biologicals) for the enumeration of total bacteria, and onto Sabouraud’s dextrose agar (SDA; Dalynn Biologicals) with 100 mg/mL of tetracycline and chloramphenicol for the enumeration of yeasts and other fungi. Lactobacilli MRS agar and NA plates were incubated aerobically at 37°C for 48 h, and SDA plates were incubated at ambient temperature for 72 h. Colonies were counted from plates containing a minimum of 30 and a maximum of 300 colonies. Numbers of yeasts and filamentous fungi (i.e., molds) were differentiated based on colony appearance and morphology. In Situ Determination of Ruminal Degradability Samples of the 90-d silage (500 g) collected from silos of each treatment were pooled and frozen (–40°C). Frozen silage samples were freeze-dried, ground through a 4-mm screen, and weighed (5 g per bag) into monofilament polyester bags (8 to 10 cm and 51-μm pore size; Sefar America Inc., Depew, NY). Triplicate polyester bags for each sampling time point were incubated in the rumen of 3 ruminally fistulated cows for 2, 6, 12, 24, 48, 72, or 96 h (3 replicate bags per animal). Bags from each time point were placed into a large mesh retaining sack (20 to 30 cm and 3 to 5 mm pore size) to ease retrieval. These cows were fed a total mixed ration consisting of 85% barley silage, 12% dry-rolled barley, and 3% of a standard beef feedlot vitamin premix and mineral supplement (DM basis). Upon removal from the rumen, bags were washed as described by Zahiroddini et al. (2004). Bags that had not been incubated in the

rumen also were included in the washing procedure to estimate loss of soluble material from bags. This experiment was approved by the Animal Care Committee of Lethbridge Research Centre with the animals used in this study cared for and managed according to the guidelines of the Canadian Council on Animal Care (2009). In Vitro Measures of Ruminal Fermentation of Corn Silage Ruminal contents were collected 1 h before the morning feeding from 3 Jersey heifers fed the diet listed above. Anaerobic conditions were maintained during transport and processing of ruminal contents in the barn and in the laboratory. Ruminal fluid (2 L) and solids (500 g) were homogenized by three 15-s pulses in a blender continuously flushed with O2–free CO2. The homogenate was strained through 4 layers of cheesecloth, and the filtrate was mixed with prewarmed buffer at 39°C (McDougall, 1948) at 1:2 (vol/ vol). Microbial protein production was estimated on the basis of incorporation of 15N from 15N-enriched ammonium sulfate (98 atom % 15N; Sigma Chemical Co, St Louis, MO) included in the inoculum at 0.5 g/L. For measurement of gas production, each of the 4 silages (500 mg) ground through a 1-mm screen was weighed into 135-mL serum vials. All vials were warmed to 39°C and flushed with O2–free CO2 before addition of 40 mL of inocula. Vials were immediately sealed and placed on a rotary shaker platform (140 rpm) in an incubator at 39°C. Vials containing silage and blanks (containing only inoculum) were prepared in triplicate for each time point. The vials for the 0-h incubation were placed on ice immediately following addition of inoculum. The volume of gas produced from each vial was measured at 3, 6, 9, 12, 24, and 48 h, using a water displacement apparatus. Two runs with 3 replicate vials in each run were performed. Triplicate vials at 9 and 48 h of the incubation were retrieved and the whole culture in each vial was processed for 15N analysis to estimate microbial protein synthesis as described by Wang et al. (2000). Molecular Analysis Deoxyribonucleic Acid Extraction. From each sampling time, 30-g silage samples from each mini silo were frozen (–80°C), lyophilized, and ground through a 4-mm screen. Subsamples (5 g) were then ball milled and DNA was extracted according to Yu and Morrison (2004) with a slight modification to facilitate DNA extraction from fungi. Briefly, DNA was extracted from 0.3 g of the ball-milled corn silage using a bead-beating step (3 min at maximum speed); nucleic acids were precipitated with ammonium acetate and isopropanol,

Saccharomyces as a corn silage inoculant

2325

Table 1. Primers and real-time quantitative PCR conditions used PCR target (gene) Primer name Total bacterial popu- 16S F lation (16S) 16S R Lactobacillus buch- LBF2 neri (16S) LBR1 Lactobacillus planta- Lplan-vreg 1F rum (16S) Lplan-vreg 1R Lactobacillus brevis Lbrev F (16S) Lbrev R Total fungal popula- FR1 tion (18S) FF390 Yeasts population YQ 26S 1B (26S) YQ 26S 2C SC 1 Saccharomyces (ITS1) SC 2 SparF7 Saccharomyces paradoxus (Vas1) SparR7 Saccharomyces cere- Scer F2 visiae (YPL169C) Scer R2

Primer sequence Amplicon size PCR cycling conditions TCCTACGGGAGGCAGCAGT 466 bp 2 min at 98°C followed by 35 cycles of 5 s at 98°C and 30 s at 60°C GGACTACCAGGGTATCTAATCCTGTT GAAACAGGTGCTAATACCGTATAACAACCA 130 bp 2 min at 98°C followed by 35 cycles of 5 s at 98°C and 30 s at 59°C CGCCTTGGTAGGCCGTTACCTTACCAACA TTACATTTGAGTGAGTGGCGAACT 75 bp 2 min at 98°C followed by 35 cycles of 5 s at 98°C and 30 s at 59°C AGGTGTTATCCCCCGCTTCT TGCACTGATTTCAACAATGAAG 160 bp 2 min at 98°C followed by 35 cycles of 5 s at 98°C and 30 s at 56.5°C CCAGAAGTGATAGCCGAAGC AICCATTCAATC GGTAIT 390 bp 5 min at 98°C followed by 40 cycles of 15 s at 98°C, 30 s at 50°C, and 30 s at 72°C CGATAACGAACGAGACCT TCAGGATAGCAGAAGCTCGT 332 bp 5 min at 98°C followed by 40 cycles of 15 s at 98°C, 30 s at 64°C, and 30 s at 72°C GTTCATTCGGCCGGTGAGTT GAAAACTCCACAGTGTGTTG 124 bp 5 min at 98°C followed by 40 cycles of 15 s at 98°C, 30 s at 63°C, and 30 s at 72°C GCTTAAGTGCGCGGTCTTG CTTTCTACCCCTTCTCCATGTTGG 739 bp 5 min at 98°C followed by 40 cycles of 15 s at 98°C, 30 s at 60°C, and 30 s at 72°C CAATTTCAGGGCGTTGTCCAACAG GCGCTTTACATTCAGATCCCGAG 150 bp 5 min at 98°C followed by 40 cycles of 15 s at 98°C, 30 s at 60°C, and 30 s at 72°C TAAGTTGGTTGTCAGCAAGATTG

washed with ethanol, and resuspended in Tris-EDTA buffer. For isolation of fungal DNA, the suspension was treated with 1% (vol/vol) glycogen (Thermo Fisher Scientific Inc., Vilnius, Lithuania). All samples were purified through a QiaAmp DNA Stool kit column (Qiagen Sciences, Germantown, MD). Yield and purity of extracted DNA was measured using a NanoDrop 3300 (Invitrogen Canada Inc., Burlington, ON, Canada). Primer Design. Primers for the 16S rRNA gene of Lactobacillus brevis (Table 1) were designed by alignment of the bacterial 16S rRNA sequences with known sequences from bacteria within GenBank and selected based on a nucleotide–nucleotide homology search in the basic local alignment search tool (BLAST; Altschul et al., 1990), multiple sequence alignment using Multialign (Corpet, 1988), and Primers3Plus software (Untergasser et al., 2007). Chosen primers generated a 160-bp product with the upstream primer LbrevF corresponding to a 22-bp fragment from bases 92 to 113 (5′-TGCACTGATTTCAACAATGAAG-3′) and the reverse primer LbrevR corresponding to a 20bp fragment from bases 233 to 252 (5′-CCAGAAGT­ GATAGCCGAAGC-3′). Similarly, primers for yeast were designed to target conserved regions of about 600 Saccharomycetales yeast large subunit sequences from Genbank coded by the 26S ribosomal DNA (rDNA) gene and to obtain at least 2 mismatch bases with rDNA genes from filamentous fungi (Table 1). These primers were tested against a set of 40 strains from Saccharomycetales and 9 mold strains to ensure their specificity. Standard Curve Generation. Genomic DNA from L. buchneri LMG6892, Lactobacillus planta-

Reference Nadkarni et al. (2002) Schmidt et al. (2008) Klocke et al. (2006) This study Vainio and Hantula (2000) This study Zott et al., 2010 Muir et al. (2011) Muir et al. (2011)

rum ATCC14917, L. brevis LMG6906, S. cerevisiae 1, and S. paradoxus 2 was extracted as described above. Amplicons of each target gene (LBF2 and LBR1 and 16S F and 16S R for L. buchneri; Lplan-vreg 1F and Lplan-vreg 1R for L. plantarum; Lbrev F and Lbrev R for L. brevis; FR1 and FF390, YQ26S 1B and YQ26S 2C, SC1 and SC2, and Scer F2 and Scer R2 for S. cerevisiae; and Spar F7 and Spar R7 for S. paradoxus) were obtained by PCR using the amplification conditions described in Table 1. Polymerase chain reaction products were cloned into One Shot DH5α Escherichia coli competent cells through TOPO TA vector (Life Technologies, Carlsbad, CA) according to the manufacturer’s recommendations. Plasmid extraction was performed with the Qiaprep Spin mini prep kit (Qiagen Sciences) with DNA quantified using a NanoDrop 3300 (Invitrogen Canada Inc., Burlington, ON, Canada). Copy numbers were obtained using the equation n = (NA × c)/(660 g/mol × bp), in which NA is Avogadro’s constant, c is the DNA concentration in grams per microliter, and bp is the number of base pairs. Plasmid DNA was serially diluted 10-fold from 108 copies to 1 copy/μL and run in duplicate in a real-time quantitative PCR (RT-qPCR) assay. Amplification efficiency (E) was estimated by using the slope of the standard curve and the formula E = (10–1/slope) – 1. Real-Time Quantitative PCR. For bacteria, amplifications were performed in a final volume of 20 μL containing 1 to 10 ng of DNA template, 0.3 μM of each respective primer (Table 1), and 10 μL of SsoAdvanced SYBR Green SuperMix (Bio-Rad Laboratories Inc., Mississauga, ON, Canada). For fungi, gene quantification (20 μL) consisted of 1 to 10 ng of DNA template,

2326

Duniere et al.

0.3 μM of each respective primer, 0.25 μL of BSA (New England Biolabs Inc., Ipswich, MA), and 10 μL of iQ SYBR Green SuperMix (Bio-Rad Laboratories, Inc.). All amplifications were performed in optical-grade 96well plates on an Applied Biosystems 7500 Fast RealTime PCR machine (Applied Biosystems, Foster City, CA) as described in Table 1. Dissociation curves were examined for the presence of a single PCR product. The quantification limit was determined at 2.8 log10 copies/g DM silage. Smaller populations were quantified and the low copy numbers were analyzed only when the coefficient of the standard curve regression was higher than 0.98 and the run efficiency was higher than 90%. Data Calculations and Statistical Analysis Cultured microbial populations were estimated as number of cfu per gram of forage or silage DM; estimates were log transformed before statistical analysis. Least squares means of parameters that showed significant differences were separated by a pairwise Fisher’s LSD test at P > 0.05 with SAS software (SAS Inst. Inc., Cary, NC). For in situ assays, disappearance of DM at each sampling point was determined gravimetrically. In situ ruminal degradation parameters of DM were calculated as described by Orskov and McDonald (1979) as P = a + b[1 – exp–c(t – L) in which P = DM disappearance (%) at time t, a = the rapidly degraded fraction (%), b = the slowly degraded fraction (%), c = the rate at which b is degraded (h–1), t = incubation time (h), and L = lag time (h). The parameters a, b, t, and L were estimated by an iterative least squares procedure using NLIN (SAS Inst. Inc.). Kinetic parameters of gas accumulation were calculated using the following single-pool exponential model described by López et al. (1999): P = a[1 – exp– c(t – lag)], in which P is the gas accumulated (mL/g DM) at time t, a is the gas production asymptote, c is the fractional production rate (mL/h), t is the incubation time (h), and lag is the initial delay before gas production (h). All data were analyzed by ANOVA using the MIXED procedure of SAS. Ensiling fermentation and microbial data measured over time were assessed using a repeated measures analysis within each mini silo (n = 3) and with each 4-L insulated container (n = 3) serving as random factors for the ensiling and aerobic stability data, respectively, whereas treatment was considered a fixed factor. When the effects (i.e., time or time × treatment interaction) were significant, means of the treatments were compared at each time point. Differences among treatments were tested using LSMEANS with the PDIFF and adjusted by a Tukey’s test in SAS (SAS Inst. Inc.) with significance declared at P < 0.05.

RESULTS Silage Characteristics Silages possessed similar terminal pH (approximately 4) and DM with both being lower for fermented than for fresh forage (P = 0.56 and P = 0.916, respectively; Table 2). Ash, CP, NDF, and ADF content were greater, whereas starch and WSC were lower in fermented than in fresh forage. The S3 silage presented greater ash and lower OM contents than CON and S1 silages (P = 0.017). Although differences were not significant, the same trend was observed for starch and WSC levels. All silages exhibited similar levels of CP but levels of ADIN in S2 and S3 silages were numerically lower than other silages. Levels of NDF, ADF, and fermentation products did not differ (P > 0.05) among silages. Butyric acid was undetectable in all silages and only trace levels of propionic acid were detected in S3 silage. Aerobic stability was not altered by yeast inoculation (P = 0.354), but S2 and S3 were numerically more stable than CON silage (Table 2). Compared to fresh forage, numbers of yeasts and molds were lower for silage whereas total bacteria and LAB increased by 1.5 and 2 log10 cfu/g DM, respectively, during ensiling. Compared with CON silage, numbers of yeasts and molds were greater for inoculated silages with numbers of yeast being the greatest for S1 silage. Aerobic Exposure During AE, the pH of all silages progressively increased to above 8 by d 14 (Fig. 1a). The pH of S1 silage increased immediately after AE, but the increase in pH within other silages was delayed for up to 3 d. Increases in silage pH coincided with a sharp decline in the lactic acid content of all silages (Fig. 1a). Total VFA, most of which was acetic acid, remained stable in S2 and S3 silages for the first 3 d of AE, but concentrations in S1 silage immediately declined (Fig. 1a). The VFA content of all silages decreased to an undetectable level by 14 d of AE. Ethanol content declined sharply from d 7 to 14 of AE. A small increase was observed at d 21 of AE for CON and S1 silages whereas S2 and S3 silages remained at low levels (data not shown). Numbers of LAB remained relatively constant at 9 log10 cfu/g DM silage during AE in all silages (P > 0.05; Fig. 1b). In contrast, the numbers of yeast increased by about 4 log10 cfu/g silage DM after d 7 and reached 9 log10 cfu/g DM after 21 d of AE. Although yeast counts were numerically higher in S1 silage at silo opening, yeast populations in all yeast treatments were similar after 14 d of AE (P = 0.897 and P = 0.862

2327

Saccharomyces as a corn silage inoculant

Table 2. Chemical characteristics and microbial populations of fresh corn forage and control corn and inoculated corn silages ensiled for 90 d (n = 3) Treatment2 Item Fresh forage1 pH 6.11 DM 32.60 DM loss, % NA4 Nutrient composition, % DM basis OM 95.15 Ash 4.85 CP 9.10 NDF 46.66 ADF 25.71 ADIN, % total N NA Starch 27.90 WSC,5 mg/g DM 22.97 Fermentation products, mg/g DM Acetic acid NA Propionic acid NA Lactic acid NA Succinic acid NA 0.18 NH3–N Lactic:acetic ratio NA Ethanol NA Microbiology, log10 cfu/g DM Total bacteria 7.48 LAB7 6.97 Molds 5.53 Yeasts8 6.82 Aerobic stability9 NA

Control 3.96 31.00 1.62

S1 3.91 31.40 1.66

S2 4.07 31.00 1.86

S3 4.08 30.60 1.94

SEM 0.097 0.790 0.067

P-value3 0.56 0.916 0.288

94.86ab 5.14ab 9.79 49.27 28.10 7.63 24.72 5.67

95.05a 4.95a 9.71 47.69 27.23 7.94 26.30 4.31

94.64bc 5.36bc 9.93 48.98 26.82 5.90 23.81 3.03

94.56c 5.44c 9.91 49.72 27.33 6.69 23.44 1.80

0.088 0.090 0.210 1.451 1.042 0.740 2.057 1.621

0.017 0.017 0.865 0.783 0.851 0.264 0.767 0.422

14.17 ND6 46.66 1.26 1.10 3.69 3.10

17.64 ND 38.39 1.11 1.03 2.37 2.94

25.00 ND 53.82 1.62 1.10 2.44 3.32

22.92 0.01 58.97 1.71 1.08 3.49 4.55

4.350 0.001 11.522 0.446 0.036 1.179 0.812

0.343 NA 0.632 0.747 0.485 0.797 0.524

0.498 0.485 1.574 0.414 1.461

0.961 0.949 0.806 0.052 0.354

8.94 8.89 0.78 3.76a 4.42

8.94 8.97 2.12 5.66b 2.98

9.26 9.26 2.69 4.14a 6.58

9.10 9.11 2.68 4.67ab 6.05

1Values

for fresh forage were not included in statistical analysis. silage inoculated with Saccharomyces cerevisiae strain1; S2 = silage inoculated with Saccharomyces paradoxus strain 2: S3 = silage inoculated with S. cerevisiae strain 3. 3Within a row, means without a common superscript differ (P < 0.05). 4NA = not applicable. 5WSC = water-soluble carbohydrates. 6ND = not detectable: below the detection limit of 0.05; Table 3). In vitro microbial protein synthesis in CON and yeast-inoculated silages did not differ (P = 0.738 and P = 0.886 at 9 and 48 h of incubation, respectively).

Molecular Analysis Bacteria. The mean 16S rDNA gene copy number of the 3 LAB species increased 2 to 3 log10 copies/g DM from d 0 to 90 of ensiling (Fig. 2), but this increase did not differ among treatments (P > 0.05; data not shown). Copy numbers of L. brevis and L. plantarum decreased from d 7 until 90 whereas L. buchneri slowly increased to 7.66 log10 copies/g DM silage. During AE, the copy number of L. buchneri, L. brevis, and L. plantarum 16S rDNA gene initially increased by 0.79, 1.27, and 0.43 log10 copies/g DM silage, respectively, but after 7 d, copy numbers tended to decline. Copy numbers for total bacteria did not change during ensiling, but it increased to 8.70 log10 copies/g DM after 3 d of AE, where it remained until the end of the AE period.

2328

Duniere et al.

Figure 1. Chemical (a) and microbial (b) characteristics of corn silage during aerobic exposure (n = 3). S1 = silage inoculated with Saccharomyces cerevisiae strain 1; S2 = silage inoculated with Saccharomyces paradoxus strain 2; S3 = silage inouclated with S. cerevisiae strain 3. LAB = actic acid bacteria.

Populations of Fungi, Saccharomyces cerevisiae strain 1 and 3 and Saccharomyces paradoxus strain 2. Only a slight decline in 18S rDNA gene copies was detected after 7 d of ensiling as measured by RT-qPCR, but with plate counts, molds were not detectable on SDA after 7 and 28 d of ensiling in any of the silages (data not shown). Copies of the fungal 18S rDNA gene remained high throughout ensiling, ranging from 8.5 log10 copies/g DM silage at d 0 to 6 log10 copies/g DM silage at d 90 in control silage (Fig. 3a). For inoculated silages, after 28 d of fermentation, the fungal population increased slightly within S1 silage (Fig. 3b) and remained stable within S2 silage (Fig. 3c) but decreased within S3 silage (Fig. 3d). Saccharomycetales accounted for only 1 to 10% of the total fungal population and this order decreased slightly during fermentation (Fig. 3). Saccharomyces represented a larger (P < 0.05) portion of the yeast population in inoculated than in control silages. However, other yeast genera still accounted for a sub-

stantial proportion, as Saccharomyces accounted for only about 0.1% of the total yeast population. Both inoculated S. cerevisiae and S. paradoxus were present at approximately 3 log10 copies/g DM at d 0 in inoculated silages. The quantity of S. cerevisiae decreased during fermentation in S1 silage (Fig. 3b) but remained greater (P < 0.05) than in CON silage until d 7. A similar decrease was observed in S3 silage, although S. cerevisiae was not detectable after 28 and 60 d of ensiling (Fig. 3d). Saccharomyces paradoxus was undetectable during ensiling after d 0 in S2 silage (Fig. 3c) but was detected on d 90 in S1 silage. Epiphytic populations of S. cerevisiae were detected in both CON and S2 silages. Fungal populations increased after the silages were exposed to air and reached a plateau between d 7 and 14 of exposure within all silages (Fig. 4). The population of Saccharomyces in S1 silage at d 3 and 7 and in S2 silage at d 7 was higher (P < 0.05) than in CON silage. During the first 7 d of AE, species-specific quantification of S. cerevisiae and S. paradoxus indicated that populations increased (Fig. 4). Inoculated populations increased by 2.69, 4.65, and 1.44 log10 copies/g DM silage for S1, S2, and S3 silages, respectively. In contrast, after 14 d of AE in CON silage, S. paradoxus was not detected, even though S. cerevisiae slightly increased. As observed for Saccharomyces, S1 silage had greater (P = 0.041) levels of S. cerevisiae than CON silage after 3 and 7 d of AE. DISCUSSION To be considered a component of a fourth generation inoculant, yeast strains should not interfere with the ensiling process, alter populations of lactobacilli, or negatively impact the nutritional quality or aerobic stability of silage. Their presence also should not promote the growth of undesirable microorganisms such as molds. Finally, inoculated yeast with probiotic properties should survive in corn silage during ensiling and ideally multiply during fermentation or on exposure to oxygen before feeding. The 3 Saccharomyces strains assessed in this study were selected through an in vitro screening of 1,700 environmental yeast isolates from DuPont Pioneer’s microbial culture collection, based on the yeast’s ability to persist during ensiling, enhance digestion, improve fermentation end product profiles, and increase ruminal pH in vivo. Yeast strains were patented for use as silage inoculants under U.S. patent US20130330439 A1 (Owens and Smiley, 2013). The 2 specific S. cerevisiae strains tested were isolated in 1998 from whole plant corn silage from Polk City, IA (S1), and from whole plant corn silage from Quebec, Canada (S3), in 2001, respectively. The S. paradoxus strain was isolated in 1998 from European forage.

2329

Saccharomyces as a corn silage inoculant

Table 3. In situ DM disappearance, in vitro gas production kinetics, and microbial protein synthesis in corn silage either uninoculated (control corn) or inoculated with yeast Treatment1 Item DM disappearance in situ Rapidly degraded fraction, % Slowly degraded fraction, % Degradation rate of b, h Lag time, h

Parameters

Control

S1

S2

S3

SEM

P-value

a b c lag

26.69 48.20 0.035 2.14 74.89

28.64 48.80 0.027 5.51 77.44

28.44 44.79 0.024 2.38 73.22

27.77 47.89 0.021 1.33 75.66

1.123 3.605 0.005 1.387 3.646

0.616 0.862 0.262 0.092 0.823

a+b Gas production Asymptotic gas production, mL/g DM silage Fractional gas production fermentation rate, mL/h lag time, h Microbial protein synthesis, time, h mg/g DM silage

a

199.10

198.50

187.75

184.99

5.971

0.241

c

8.83

8.92

8.48

8.16

0.519

0.718

lag

1.00

1.06

1.02

0.96

0.291

0.996

9 48

134.96 128.84

158.46 112.18

152.02 106.82

156.68 106.28

10.112 10.856

0.738 0.886

1S1

= silage inoculated with Saccharomyces cerevisiae strain1; S2 = silage inoculated with Saccharomyces paradoxus strain 2; S3 = silage inoculated with S. cerevisiae strain 3.

After 90 d of fermentation, the pH and DM content of all silages fell within a range associated with high quality corn silage, with both being lower than fresh forage. Lower OM was observed at the end of ensiling with S3, but inoculation with yeasts did not affect the nutrient composition or fermentation products in corn silage. This result is consistent with the observation that the inoculants tested did not affect bacteria, yeast, or mold numbers during the 90-d ensiling period. In the absence of oxygen, Saccharomyces can convert WSC into CO2 and ethanol, which can be toxic to cattle and is an undesirable end product of ensiling (Pedroso et al., 2005). Ethanol levels were low within all corn silages and were not increased as result of inoculation with Saccharomyces spp.

Figure 2. Copy numbers of 16S ribosomal DNA gene of bacterial populations in silages during ensiling and aerobic exposure as quantified using real-time quantitative PCR (n = 12). S1 = silage inoculated with Saccharomyces cerevisiae strain 1; S2 = silage inoculated with Saccharomyces paradoxus strain 2; S3 = silage inoculated with S. cerevisiae strain 3.

Exposure to oxygen promotes yeast growth and lactic acid consumption, increasing silage pH and enabling less acid-tolerant microbes such as molds to proliferate (Dunière et al., 2013). Because of this correlation, yeasts often are considered to contribute to the aerobic spoilage of silage (Woolford, 1990) either during the aerobic phase before ensiling or during feed out (Driehuis and Oude Elferink, 2000). However, the main lactic acid–utilizing yeasts found in silage are members of the genera Pichia and Candida (Jonsson and Pahlow, 1984). Saccharomyces are not known to play a significant role in aerobic deterioration (Middelhoven and van Baalen, 1988; Rossi and Dellaglio, 2007). Indeed, the similar characteristics among different silages observed during the AE period indicated that yeast inoculants did not increase silage spoilage or alter the aerobic stability of corn silage. After 90 d of fermentation, S3 silage had lower OM concentrations than CON and S1 silages. This might be explained by the numerically lower level of both starch and WSC observed in this silage, although the difference between S3 and other treatments was not significant. Sugar consumption during ensiling may have been enhanced indirectly by S. cerevisiae S3 through stimulation of epiphytic microorganisms in silage or directly if the amylolytic activity of this strain was higher than other yeasts used in this study. During AE, silages inoculated with S. cerevisiae S1 exhibited a more rapid decline in lactate and increase in pH, although yeast numbers remained stable in all silages. This suggests that S. cerevisiae S1 may have assimilated lactate more readily than the other yeast strains examined.

2330

Duniere et al.

Figure 3. Copy numbers of targeted genes from fungal populations during ensiling as using real-time quantitative PCR (n = 3) in control silages (a), S1 silage inouclated with Saccharomyces cerevisiae strain 1 (b); S2 silage inoculated with Saccharomyces paradoxus strain 2 (c); S3 silage inoculated with S. cerevisiae strain 3 (d). Populations quantified were total fungi ( ), yeast ( ), Saccharomyces genus ( ), Saccharomyces cerevisiae ( ), and Saccharomyces paradoxus ( ). *Copy number quantification statistically different from control (P < 0.05).

Averaged across yeast strains, inoculation tended to increase the rapidly degraded fraction but decrease the rate of DM degradation. As a consequence, a greater size of the ruminally degraded fraction (a + b) was observed in S. cerevisiae–inoculated silages. Although the total degraded DM fraction was within the range reported by Kang et al. (2009) for 2 varieties of corn silage, degradation rates were lower in our study. This difference probably related to differences in the diets fed to the donor cows between experiments. Variation may have also resulted as result of differences in the varieties of corn used between studies, as previously noted (Kang et al., 2009). Yeasts used as DFM have enhanced fiber digestion in cattle fed both corn grain and corn silage–based diets (Beauchemin et al., 2003; Guedes et al., 2008). In vitro DM disappearance did not differ among treatments, suggesting that inoculation with Saccharomyces spp. did not adversely impact digestibility. The impact of yeast strains on DM digestibility in the rumen likely depends on their enzymatic

activities and ruminal persistence. Differences among strains of Saccharomyces in both in vitro and in vivo ruminal fermentation have been reported elsewhere (Newbold et al., 1995). Added yeasts did not alter in situ DM disappearance, lag time, or rate of or total gas production in vitro at 48 h, suggesting that they did not influence the microbial populations in ruminal inoculum. This point is supported by a lack of difference in in vitro microbial protein synthesis among treatments. All silages exhibited the characteristics of being well preserved. Among Lactobacillus species, L. buchneri accounted for the majority of the population followed by L. brevis and L. plantarum, an observation supported by Holzer et al. (2003). Lactobacilli were quantified using quantitative PCR (qPCR) to determine if the Saccharomyces spp. impacted their growth as well as to determine if Saccharomyces remained viable in the presence of these LAB. Lactobacillus plantarum is homofermentative and enhances the rate of pH decline during ensiling, whereas L. brevis and L. buchneri are

Saccharomyces as a corn silage inoculant

2331

Figure 4. Copy numbers of targeted genes from fungal populations during aerobic exposure as quantified using real-time quantitative PCR (n = 3) in control silages (a), S1 = silage inoculated with Saccharomyces cerevisiae strain 1; S2 = silage inoculated with Saccharomyces paradoxus strain 2; S3 = silage inoculated with S. cerevisiae strain 3. Populations quantified were total fungi ( ), yeast ( ), Saccharomyces genus ( ), Saccharomyces cerevisiae ( ), and Saccharomyces paradoxus ( ). *Copy number quantification statistically different from control (P < 0.05).

heterofermentative and improve the aerobic stability of silage (Dunière et al., 2013). The greater estimation of LAB in silage by direct enumeration as compared to RT-qPCR likely arises from the fact that only L. buchneri, L. brevis, and L. plantarum were measured with RT-qPCR whereas MRS media favors the growth of other LAB species including Lactobacillus acidophilus, Lactobacillus casei, and Lactobacillus fermentum (De Man et al., 1960). The L. plantarum primers (Lplanvreg 1F and Lplan-vreg 1R) were slightly modified from those of Chagnaud et al. (2001) but have been used in several silage studies (Klocke and Mundt, 2004; Klocke et al., 2006). The L. buchneri primers (LBF2 and LBR1) were originally designed by Schmidt et al. (2008) and proposed to be species specific (Lynch et al., 2012). However, copy numbers for both L. plantarum and L. buchneri were likely overestimated as we found that these primer sets also amplified the 16S rRNA gene of L. brevis strain LMG6906 (data not shown). The

number of copies of the 16S rRNA gene within the genomes of lactobacilli varies among species (Case et al., 2007) and no direct correction for copy numbers can be made for L. buchneri and L. brevis as primer affinities were unknown. Numbers of L. buchneri increase during ensiling (Lynch et al., 2012) as this species often outcompetes other LAB in silage (Schmidt et al., 2008). In properly ensiled forage, LAB are the predominant bacterial genera at terminal ensiling (Holzer et al., 2003). Consequently, one would expect copy numbers of 16S rDNA for L. buchneri to dominate terminal bacterial populations but be slightly lower than the copy numbers of 16S rDNA associated with the total bacterial population. However, mean copy numbers of 16S rRNA for L. buchneri were slightly greater than those for the total bacteria on d 60 and 90 but still within the SD measured for both populations. This may be due to the large size of the 16S rRNA amplicon used for total bacteria quantification (466 bp) with the SYBR Green chemistry used in

2332

Duniere et al.

RT-qPCR (Ginzinger, 2002). This may also partially account the lower estimates of total bacteria based on 16S rDNA as compared to that measured with total bacterial plate counts. We are presently designing universal primers for total bacteria that will work more favorably with SYBR Green chemistry in future studies. The decline in fungal populations immediately after ensiling was less pronounced when measured using RTqPCR than by direct plate counts. This difference may arise from the fact that the primers for measuring total fungi also would have targeted yeasts, a population that was excluded based on morphology during plate counts. Several studies have shown that lactic acid produced by LAB lowers silage pH and depresses fungal populations (Filya and Sucu, 2007; Addah et al., 2011). This decline was less pronounced when measured by RT-qPCR, presumably reflecting the fact that fungi may contain multiple copies of 18S rRNA (Maleszka and Clark-Walker, 1993; Herrera et al., 2009) and, as a result, copy numbers do not correlate directly with fungal plate counts. This issue was discussed by Kembel et al. (2012), for bacterial populations, who proposed using both 16S rDNA copy number and sequencing to estimate microbial diversity and abundance in environmental samples. However, no similar analysis presently exists for fungal populations. Real-time qPCR techniques also detect both viable and nonviable fungi (Treimo et al., 2006) in addition to members of the fungal population that were viable but not culturable on SDA. Studies focusing on human pathogenic fungi have shown that growth of yeasts and filamentous fungi is affected by the nature of selective media used (Brun et al., 2001; Scognamiglio et al., 2010). Filamentous fungi are also difficult to enumerate using plating due to their fastidious growth requirements, slow growth rates, and the nature of colony formation from hyphal biomass (King et al., 1979). Molecular techniques have been shown to overcome culturing issues for fungi identification and quantification in the rumen (McSweeney et al., 2007) and silage (Mansfield and Kuldau, 2007; Richard et al., 2009). Real-time qPCR has also been used to quantify fungal populations of interest in soil (Atkins et al., 2005) as well as those associated with potatoes (Böhm et al., 1999) and barley (Bates et al., 2001). To our knowledge, this study is the first to use RT-qPCR to quantify fungal populations in corn silage. Quantifications obtained through RT-qPCR for populations of fungi, yeasts, and Saccharomyces can be compared as the primers used were located in the same operon coding region of rDNA genes, targeting the small subunit 18S gene, the large subunit 26S gene, and the internal transcribed spacer region ITS, respectively. At ensiling, total yeast populations were similar among treatments, but populations of Saccharomyces were greater in inoculated silages during later ensiling. Primers YQ26S 1B and

YQ26S 2C are Saccharomycetales specific and quantify multiple genera including Saccharomyces, Torulaspora, or Kluyveromyces (Suh et al., 2006) as well as spoilage-related genera including Candida and Pichia (Middelhoven and Franzen, 1986; Middelhoven and van Baalen, 1988). Genera other than Saccharomyces, therefore, contribute to the high proportion of the yeasts quantified in control silage. Yeast inoculation may have stimulated the growth of endogenous Saccharomyces at ensiling and enhanced their survival during the ensiling period. Certain “killer” strains of S. cerevisiae secrete a protein toxin that kills sensitive strains of the same species and other yeasts (Kitamoto et al., 1993). The higher Saccharomyces population observed in inoculated silages during ensiling likely reflects the growth of the inoculated yeasts. However, competition for substrates as well as presence of end products produced by the inoculated yeasts also may have inhibited competitors, leading to a greater proportion of Saccharomyces in inoculated silages. Species-specific primers were used in corn silage to quantify S. cerevisiae, and S. paradoxus. The decrease observed during the ensiling period presumably was linked to the fermentation process, specifically anaerobicity, high lactic acid concentrations, and low pH. As far as we are aware, this study is the first to investigate selected yeast strains for inclusion in a fourth generation silage inoculant. Direct comparison of bacterial inoculation rates to those of yeast may not be relevant as yeast are intended to act as a DFM as opposed to having a direct positive impact on the ensiling process. Bacterial inoculants are typically added to silage at 105 to 106 cfu/g silage (Weinberg and Muck, 1996), an amount considerably greater than the rate at which yeast were added to corn forage in this study. Further studies to evaluate greater inoculation rates are now needed to confirm the potential use of these Saccharomyces strains as components of fourth generation inoculants and if they elicit positive DFM responses in ruminants once consumed. Although primer sets used to quantify the inoculants were species specific, differentiation between the endogenous population and the inoculated strains was not possible. The S. cerevisiae was detected in control and S2 silages indicating that epiphytic S. cerevisiae was present in corn silage. Few studies have identified S. paradoxus in silages (Mansfield and Kuldau, 2007), probably because this species is closely phylogenetically related to S. cerevisiae (James et al., 1997). The S. paradoxus was detected in silages inoculated with S. cerevisiae but not in control silage. This may be due to the lower survival rate and small population size of this epiphytic species in corn silage. As the amplicon size chosen for RT-qPCR for S. paradoxus was larger (740 bp) than the amplicon for S. cerevisiae, sensitivity may also have been lower.

Saccharomyces as a corn silage inoculant

During AE, total fungal populations exhibited exponential growth up to 7 d based on qPCR quantification. The Saccharomyces population was greater during AE in treated silages than the control, whereas total yeast populations remained relatively constant. This suggests that genera other than Saccharomyces may have accounted for more of the yeast in control corn silage. Inoculation with Saccharomyces did not promote the growth of spoilage microorganisms during ensiling. Quantifications of molds through plating showed low populations at opening and delayed mold growth during AE of corn silage. It is known that growth of filamentous fungi during AE of cereal silage frequently follows the growth of yeasts (McAllister et al., 1995). In control corn silage, the slower growth of molds was not linked to lower yeast populations as both plating and qPCR showed that populations of total fungi and yeast were similar among treatments. The observation that numbers of S. cerevisiae and S. paradoxus increased during AE but were undetectable at terminal ensiling indicates that they survived the ensiling process and multiplied once aerobic conditions were reestablished. This raises the possibility that DFM populations increase during AE, possibly increasing the likelihood of eliciting biological responses when the silage is fed to cattle. Quantification of S. paradoxus and S. cerevisiae used the single copy genes vas1 and YPL169C, respectively, and allowed copy numbers to be directly extrapolated to number of cfu. Estimated number of cfu obtained during AE ranged from undetectable at silo opening to a maximum of 4.65 ± 0.92 log10 cfu/g DM silage after 14 d for S. paradoxus. Saccharomycesbased DFM are often administrated to cattle at 107 to 109 cfu/hd per d, with 2.0 × 109 cfu/hd per d of the strains selected in this study increasing ruminal pH (Owens and Smiley, 2013). With a daily intake of 20 kg of DM composed of a diet with 60% of DM coming from corn silage, a dairy cow would consume about 12 kg DM silage/d. Ingestion of silage containing 4.65 log10 cfu/g would provide 5.4 × 108 cfu. The effect of Saccharomyces DFM on ruminal fermentation and milk production are both strain and dose dependent (Desnoyers et al., 2009) and some strains may elicit positive biological responses when administered to cattle at levels less than 109 cfu/d. Increasing the level of Saccharomyces inoculated onto corn forage at ensiling or optimizing their growth during AE may provide a means of further increasing the daily number of cfu of selected strains delivered to cattle. At the very least, inclusion of these strains within silage would reduce the quantity that would need to be added to the diet to achieve targeted responses. Numbers of viable yeast were likely overestimated by RT-qPCR, as copy numbers would have been measured in both live and dead cells as well as in

2333

epiphytic S. cerevisiae or S. paradoxus. Furthermore, the degree that the yeast population would increase during exposure to air would vary with exposure time of the silo face, ambient temperature, and silage handling practices. Most DFM contain live microorganisms that may differ substantially with regard to their postconsumption viability (Duarte et al., 2012) and some products may contain extracts that provide growth factors that limit microbial activity in the rumen (Callaway and Martin, 1997). Yeast administered through silage may not provide these growth factors. Of course, further whole-animal metabolism and growth studies would have to be conducted with each strain of Saccharomyces that was being considered for inclusion in a fourth generation inoculant to confirm the occurrence of DFM-mediated responses in vivo. Conclusion Inoculation with Saccharomyces strain 1, 2 or 3 did not affect the nutritional quality or aerobic stability of corn silage. Inoculation had no negative or positive impact on the microbial populations quantified or silage quality. Although yeast populations did not increase during the silage fermentation process, the inoculants survived the ensiling period to multiply during AE so that the number of cfu present were markedly greater than that in terminal silage. Inoculating ensiled forage with yeast may be an effective strategy for on-farm production of selected DFM as a component of a silage production system. Although strains of Saccharomyces alone would not constitute a fourth generation inoculant, combining them with Lactobacillus spp. that enhance ensiling, improve aerobic stability, and increase fiber digestion could generate a true fourth generation inoculant. LITERATURE CITED Addah, W., J. Baah, P. Groenewegen, E. K. Okine, and T. A. McAllister. 2011. Comparison of the fermentation characteristics, aerobic stability and nutritive value of barley and corn silages ensiled with or without a mixed bacterial inoculant. Can. J. Anim. Sci. 91:133–146. doi:10.4141/CJAS10071. Addah, W., J. Baah, E. K. Okine, and T. A. McAllister. 2012. A third-generation esterase inoculant alters fermentation pattern and improves aerobic stability of barley silage and the efficiency of body weight gain of growing feedlot cattle. J. Anim. Sci. 90:1541–1552. doi:10.2527/jas.2011-4085. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403–410. doi:10.1016/S0022-2836(05)80360-2. Atkins, S. D., I. M. Clark, S. Pande, P. R. Hirsch, and B. R. Kerry. 2005. The use of real-time PCR and species-specific primers for the identification and monitoring of Paecilomyces lilacinus. FEMS Microbiol. Ecol. 51:257–264. doi:10.1016/j. femsec.2004.09.002.

2334

Duniere et al.

Bates, J. A., E. J. A. Taylor, D. M. Kenyon, and J. E. Thomas. 2001. The application of real-time PCR to the identification, detection and quantification of Pyrenophora species in barley seed. Mol. Plant Pathol. 2:49–57. doi:10.1046/j.13643703.2001.00049.x. Beauchemin, K. A., W. Z. Yang, D. P. Morgavi, G. R. Ghorbani, W. Kautz, and J. A. Z. Leedle. 2003. Effects of bacterial direct-fed microbials and yeast on site and extent of digestion, blood chemistry, and subclinical ruminal acidosis in feedlot cattle. J. Anim. Sci. 81:1628–1640. Böhm, J., A. Hahn, R. Schubert, G. Bahnweg, N. Adler, J. Nechwatal, R. Oehlmann, and W. Obszwald. 1999. Realtime quantitative PCR: DNA determination in isolated spores of the mycorrhizal fungus Glomus mosseae and monitoring of Phytophthora infestans and Phytophthora citricola in their respective host plants. J. Phytopathol. 147:409–416. doi:10.1111/j.1439-0434.1999.tb03842.x. Brashears, M. M., A. Amezquita, and D. Jaroni. 2005. Lactic acid bacteria and their uses in animal feeding to improve food safety. Adv. Food Nutr. Res. 50:1–31. doi:10.1016/S10434526(05)50001-9. Brun, S., J. P. Bouchara, A. Bocquel, A. M. Basile, N. ContetAudonneau, and D. Chabasse. 2001. Evaluation of five commercial Sabouraud gentamicin-chloramphenicol agar media. Eur. J. Clin. Microbiol. Infect. Dis. 20:718–723. doi:10.1007/ s100960100577. Callaway, E. S., and S. A. Martin. 1997. Effects of a Saccharomyces cerevisiae culture on ruminal bacteria that utilize lactate and digest cellulose. J. Dairy Sci. 80:2035–2044. doi:10.3168/jds. S0022-0302(97)76148-4. Canadian Council on Animal Care. 2009. CCAC guidelines on: The care and use of farm animals in research, teaching and testing http://www.ccac.ca/Documents/Standards/ Guidelines/Farm_Animals.pdf. (Accessed July 10 2014.) Case, R. J., Y. Boucher, I. Dahllöf, C. Holmström, W. F. Doolittle, and S. Kjelleberg. 2007. Use of 16S rRNA and rpoB genes as molecular markers for microbial ecology studies. Appl. Environ. Microbiol. 73:278–288. doi:10.1128/AEM.01177-06. Chagnaud, P., K. Machinis, L. A. Coutte, A. Marecat, and A. Mercenier. 2001. Rapid PCR-based procedure to identify lactic acid bacteria: Application to six common Lactobacillus species. J. Microbiol. Methods 44:139–148. doi:10.1016/S0167-7012(00)00244-X. Chaucheyras-Durand, F., N. D. Walker, and A. Bach. 2008. Effects of active dry yeasts on the rumen microbial ecosystem: Past, present and future. Anim. Feed Sci. Technol. 145:5–26. doi:10.1016/j.anifeedsci.2007.04.019. Corpet, F. 1988. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16:10881–10890. doi:10.1093/ nar/16.22.10881. De Man, J. C., M. Rogosa, and M. E. Sharpe. 1960. A medium for the cultivation of Lactobacilli. J. Appl. Bacteriol. 23:130– 135. doi:10.1111/j.1365-2672.1960.tb00188.x. Desnoyers, M., S. Giger-Reverdin, G. Bertin, C. Duvaux-Ponter, and D. Sauvant. 2009. Meta-analysis of the influence of Saccharomyces cerevisiae supplementation on ruminal parameters and milk production of ruminants. J. Dairy Sci. 92:1620–1632. doi:10.3168/jds.2008-1414. Driehuis, F., and S. J. Oude Elferink. 2000. The impact of the quality of silage on animal health and food safety: A review. Vet. Q. 22:212–216. doi:10.1080/01652176.2000.9695061. Duarte, K. M. R., L. H. Gomes, A. C. K. Sampaio, J. Issakowicz, F. Rocha, T. P. Granato, and S. R. Terra. 2012. Saccharomyces cerevisiae used as probiotic: Strains characterization and cell viability. IOSR J. Agric. Vet. Sci. 1:17–19. doi:10.9790/2380-0121719.

Dunière, L., J. Sindou, F. Chaucheyras-Durand, I. Chevallier, and D. Thévenot-Sergentet. 2013. Silage processing and strategies to prevent persistence of undesirable microorganisms. Anim. Feed Sci. Technol. 182:1–15. doi:10.1016/j.anifeedsci.2013.04.006. Filya, I., and E. Sucu. 2007. The effect of bacterial inoculants and a chemical preservative on the fermentation and aerobic stability of whole-crop cereal silages. Asian-Australas. J. Anim. Sci. 20:378–384. Ginzinger, D. G. 2002. Gene quantification using real-time quantitative PCR: An emerging technology hits the mainstream. Exp. Hematol. 30:503–512. doi:10.1016/S0301-472X(02)00806-8. Guedes, C. M., D. Gonçalves, M. A. M. Rodrigues, and A. Dias-daSilva. 2008. Effects of a Saccharomyces cerevisiae yeast on ruminal fermentation and fibre degradation of maize silages in cows. Anim. Feed Sci. Technol. 145:27–40. doi:10.1016/j. anifeedsci.2007.06.037. Herrera, M. L., A. C. Vallor, J. A. Gelfond, T. F. Patterson, and B. L. Wickes. 2009. Strain-dependent variation in 18S ribosomal DNA Copy numbers in Aspergillus fumigatus. J. Clin. Microbiol. 47:1325–1332. doi:10.1128/JCM.02073-08. Holzer, M., E. Mayrhuber, H. Danner, and R. Braun. 2003. The role of Lactobacillus buchneri in forage preservation. Trends Biotechnol. 21:282–287. doi:10.1016/S0167-7799(03)00106-9. James, S. A., J. Cai, I. N. Roberts, and M. D. Collins. 1997. A phylogenetic analysis of the genus Saccharomyces based on 18S rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov. Int. J. Syst. Bacteriol. 47:453–460. doi:10.1099/00207713-47-2-453. Jonsson, A., and G. Pahlow. 1984. Systematic classification and biochemical characterization of yeasts growing in grass silage inoculated with Lactobacillus cultures. Anim. Res. Develop. 20:7–22. Kang, T. W., A. T. Adesogan, S. C. Kim, and S. S. Lee. 2009. Effects of an esterase-producing inoculant on fermentation, aerobic stability, and neutral detergent fiber digestibility of corn silage. J. Dairy Sci. 92:732–738. doi:10.3168/jds.2007-0780. Kembel, S. W., M. Wu, J. A. Eisen, and J. L. Green. 2012. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Comput. Biol. 8:e1002743. doi:10.1371/journal.pcbi.1002743. King, A. D., Jr., A. D. Hocking, and J. I. Pitt. 1979. Dichloran-rose bengal medium for enumeration and isolation of molds from foods. Appl. Environ. Microbiol. 37:959–964. Kitamoto, K., S. Ohmomo, and T. Nakahara. 1993. Selection of killer yeasts (Kluyveromyces lactis) to prevent aerobic deterioration in silage making. J. Dairy Sci. 76:803–811. doi:10.3168/jds.S0022-0302(93)77404-4. Klocke, M., and K. Mundt. 2004. Development of a 16S rDNA-targeted PCR assay for monitoring of Lactobacillus plantarum and Lact. rhamnosus during co-cultivation for production of inoculants for silages. Lett. Appl. Microbiol. 39:267–273. doi:10.1111/j.1472-765X.2004.01575.x. Klocke, M., K. Mundt, C. Idler, J. McEniry, P. O’Kiely, and S. Barth. 2006. Monitoring Lactobacillus plantarum in grass silages with the aid of 16S rDNA-based quantitative real-time PCR assays. Syst. Appl. Microbiol. 29:49–58. doi:10.1016/j. syapm.2005.06.001. Kudo, H., K. J. Cheng, and J. W. Costerton. 1987. Interactions between Treponema bryantii and cellulolytic bacteria in the in vitro degradation of straw cellulose. Can. J. Microbiol. 33:244–248. doi:10.1139/m87-041. Lesins, K., and F. H. Schulz. 1968. Some effects of bacterial inoculation on silage making. Can. J. Anim. Sci. 48:15–25. doi:10.4141/cjas68-003.

Saccharomyces as a corn silage inoculant Lettat, A., P. Nozière, M. Silberberg, D. P. Morgavi, C. Berger, and C. Martin. 2012. Rumen microbial and fermentation characteristics are affected differently by bacterial probiotic supplementation during induced lactic and subacute acidosis in sheep. BMC Microbiol. 12:142. doi:10.1186/1471-2180-12-142. López, S., J. France, M. S. Dhanoa, F. Mould, and J. Dijkstra. 1999. Comparison of mathematical models to describe disappearance curves obtained using the polyester bag technique for incubating feeds in the rumen. J. Anim. Sci. 77:1875–1888. Lynch, J. P., P. O’Kiely, S. M. Waters, and E. M. Doyle. 2012. Conservation characteristics of corn ears and stover ensiled with the addition of Lactobacillus plantarum MTD-1, Lactobacillus plantarum 30114, or Lactobacillus buchneri 11A44. J. Dairy Sci. 95:2070–2080. doi:10.3168/jds.2011-5013. Maleszka, R., and G. D. Clark-Walker. 1993. Yeasts have a 4-fold variation in ribosomal DNA copy number. Yeast 9:53–58. doi:10.1002/yea.320090107. Mansfield, M. A., and G. A. Kuldau. 2007. Microbiological and molecular determination of mycobiota in fresh and ensiled maize silage. Mycologia 99:269–278. doi:10.3852/mycologia.99.2.269. McAllister, T. A., K. A. Beauchemin, A. Y. Alazzeh, J. Baah, R. M. Teather, and K. Stanford. 2011. Review: The use of direct fed microbials to mitigate pathogens and enhance production in cattle. Can. J. Anim. Sci. 91:193–211. doi:10.4141/cjas10047. McAllister, T. A., L. B. Selinger, L. R. McMahon, H. D. Bae, T. J. Lysyk, S. J. Oosting, and K. J. Cheng. 1995. Intake, digestibility and aerobic stability of barley silage inoculated with mixture of Lactobacillus plantarum and Enterococcus faecium. Can. J. Anim. Sci. 75:425–432. doi:10.4141/cjas95-062. McDougall, E. I. 1948. Studies on ruminant saliva. 1. The composition and output of sheep’s saliva. Biochem. J. 43:99–109. McSweeney, C. S., S. E. Denman, A. D. G. Wright, and Z. Yu. 2007. Application of recent DNA/RNA-based techniques in rumen ecology. Asian-Australas. J. Anim. Sci. 20:283–294. Middelhoven, W. J., and M. M. Franzen. 1986. The yeast flora of ensiled whole-crop maize. J. Sci. Food Agric. 37:855–861. doi:10.1002/jsfa.2740370906. Middelhoven, W. J., and A. H. M. van Baalen. 1988. Development of the yeast flora of whole-crop maize during ensiling and during subsequent aerobiosis. J. Sci. Food Agric. 42:199– 207. doi:10.1002/jsfa.2740420303. Muir, A., E. Harrison, and A. Wheals. 2011. A multiplex set of species-specific primers for rapid identification of members of the genus Saccharomyces. FEMS Yeast Res. 11:552–563. doi:10.1111/j.1567-1364.2011.00745.x. Nadkarni, M. A., F. E. Martin, N. A. Jacques, and N. Hunter. 2002. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 148:257–266. Newbold, J. C., R. J. Wallace, X. B. Chen, and F. M. McIntosh. 1995. Different strains of Saccharomyces cerevisiae differ in their effects on ruminal bacterial numbers in vitro and in sheep. J. Anim. Sci. 73:1811–1818. Orskov, E. R., and I. McDonald. 1979. The estimation of protein degradability in the rumen from incubation measurements weighted according to rate of passage. J. Agric. Sci. 92:499– 503. doi:10.1017/S0021859600063048. Owens, F., and B. Smiley. 2013. Yeast-containing silage inoculants for the enhancement of silage digestion and fermentation in the rumen. U.S. Patent US Patent US20130330439, filed July 12, 2012, issued January 9, 2014. Pedroso, A. F., L. G. Nussio, S. F. Paziani, D. R. S. Loures, M. S. Igarasi, R. M. Coelho, I. H. Packer, J. Horii, and L. H. Gomes. 2005. Fermentation and epiphytic microflora dynamics in sugar cane silage. Sci. Agric. (Piracicaba, Braz.) 62:427–432. doi:10.1590/S0103-90162005000500003.

2335

Reich, L. J., and L. Kung Jr. 2010. Effects of combining Lactobacillus buchneri 40788 with various lactic acid bacteria on the fermentation and aerobic stability of corn silage. Anim. Feed Sci. Technol. 159:105–109. doi:10.1016/j.anifeedsci.2010.06.002. Richard, E., N. Heutte, V. Bouchart, and D. Garon. 2009. Evaluation of fungal contamination and mycotoxin production in maize silage. Anim. Feed Sci. Technol. 148:309–320. doi:10.1016/j.anifeedsci.2008.02.004. Rossi, F., and F. Dellaglio. 2007. Quality of silages from Italian farms as attested by number and identity of microbial indicators. J. Appl. Microbiol. 103:1707–1715. doi:10.1111/j.13652672.2007.03416.x. Schmidt, R. J., M. G. Emara, and L. Kung Jr. 2008. The use of a quantitative real-time polymerase chain reaction assay for identification and enumeration of Lactobacillus buchneri in silage. J. Appl. Microbiol. 105:920–929. doi:10.1111/j.1365-2672.2008.03834.x. Scognamiglio, T., R. Zinchuk, P. Gumpeni, and D. H. Larone. 2010. Comparison of inhibitory mold agar to Sabouraud dextrose agar as a primary medium for isolation of fungi. J. Clin. Microbiol. 48:1924–1925. doi:10.1128/JCM.01814-09. Suh, S.-O., M. Blackwell, C. P. Kurtzman, and M.-A. Lachance. 2006. Phylogenetics of Saccharomycetales, the ascomycete yeasts. Mycologia 98:1006–1017. doi:10.3852/mycologia.98.6.1006. Teller, R. S., R. J. Schmidt, L. W. Whitlow, and L. Kung Jr. 2012. Effect of physical damage to ears of corn before harvest and treatment with various additives on the concentration of mycotoxins, silage fermentation, and aerobic stability of corn silage. J. Dairy Sci. 95:1428–1436. doi:10.3168/jds.2011-4610. Treimo, J., G. Vegarud, T. Langsrud, S. Marki, and K. Rudi. 2006. Total bacterial and species-specific 16S rDNA microarray quantification of complex samples. J. Appl. Microbiol. 100:985–998. doi:10.1111/j.1365-2672.2006.02805.x. Untergasser, A., H. Nijveen, X. Rao, T. Bisseling, R. Geurts, and J. A. Leunissen. 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 35:W71–74. doi:10.1093/nar/ gkm306. Vainio, E. J., and J. Hantula. 2000. Direct analysis of wood inhabiting fungi using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Mycol. Res. 104:927–936. doi:10.1017/S0953756200002471. Wang, Y., T. A. McAllister, L. J. Yanke, Z. J. Xu, P. R. Cheeke, and K.-J. Cheng. 2000. In vitro effects of steroidal saponins from Yucca schidigera extract on rumen microbial protein synthesis and ruminal fermentation. J. Sci. Food Agric. 80:2114– 2122. doi:10.1002/1097-0010(200011)80:143.0.CO;2-0. Weinberg, Z. G., and R. E. Muck. 1996. New trends in development and use of inoculants for silage. FEMS Microbiol. Rev. 19:53–68. doi:10.1111/j.1574-6976.1996.tb00253.x. Weinberg, Z. G., R. E. Muck, and P. J. Weimer. 2003. The survival of silage inoculant lactic acid bacteria in rumen fluid. J. Appl. Microbiol. 94:1066–1071. doi:10.1046/j.1365-2672.2003.01942.x. Woolford, M. K. 1990. The detrimental effects of air on silage. J. Appl. Bacteriol. 68:101–116. doi:10.1111/j.1365-2672.1990.tb02554.x. Yu, Z., and M. Morrison. 2004. Improved extraction of PCRquality community DNA from digesta and fecal samples. BioTechniques 36:808–812. Zahiroddini, H., J. Baah, W. Absalom, and T. A. McAllister. 2004. Effect of an inoculant and hydrolytic enzymes on fermentation and nutritive value of whole crop barley silage. Anim. Feed Sci. Technol. 117:317–330. doi:10.1016/j.anifeedsci.2004.08.013. Zott, K., O. Claisse, P. Lucas, J. Coulon, A. Lonvaud-Funel, and I. Masneuf-Pomarede. 2010. Characterization of the yeast ecosystem in grape must and wine using real-time PCR. Food Microbiol. 27:559–567. doi:10.1016/j.fm.2010.01.006.