e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 365–370
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/etap
Impact of long term Fe3+ toxicity on expression of glutathione system in rat liver Harun Budak a,∗, Nurdan Gonul a, Hamid Ceylan a, Enver Fehim Kocpinar b a b
Ataturk University, Science Faculty, Department of Molecular Biology and Genetics, 25240 Erzurum, Turkey Ataturk University, Science Faculty, Department of Chemistry, 25240 Erzurum, Turkey
a r t i c l e
i n f o
a b s t r a c t
Article history:
The free radicals within the body, produced by metabolic activities or derived from envi-
Received 12 July 2013
ronmental sources are relatively related to hepatoxicity. Since heavy metals including iron
Received in revised form
have the ability to produce free radicals, the liver glutathione system neutralizes them
9 December 2013
to protect cells against any damage. The objective of this study is to indicate the toxic
Accepted 13 December 2013
effects of iron on the glutathione system at the enzymatic and molecular level. Thus, any
Available online 22 December 2013
possible correlation between enzymatic and molecular levels can be determined. According to our results, while mRNA expression of glutathione reductase (Gsr) and glutathione
Keywords:
S-transferases (Gsta5) genes were not affected by long-term exposure to various concentra-
Iron
tions of iron (Fe3+ ), transcription level of glutathione peroxidase (Gpx2) was influenced in
Toxic effects
the presence of toxic iron. Whereas the enzyme activites of GSR (GR), GPX and GST were
Glutathione system
significantly affected in rat liver.
mRNA expression
© 2013 Elsevier B.V. All rights reserved.
Enzyme activity
1.
Introduction
The liver performs many functions that are vital to life such as digestion, assimilation, storage for many essential vitamins and minerals including iron, copper, and vitamins that are needed for carrying oxygen around the body (Aisen et al., 2001; Cazzola et al., 1990; Lieu et al., 2001; Munoz et al., 2011). All body cells need a certain amount of iron to perform their metabolic requirements such as cell growth, oxygen utilization, various enzymatic activities, and responses of immune systems (Lieu et al., 2001; Munoz et al., 2011; Stoltzfus, 2001; Valko et al., 2005). Although iron is an essential element for all living organisms, accumulation of iron in the body has ability to produce reactive oxygen species (ROS) which causes genotoxic damage, protein sulfhydryls depletion and other effects in liver (Andrews, 1999; Huang, 2003; Lee et al., 2006; Munoz et al., 2011).
∗
Corresponding author. Tel.: +90 442 2314454; fax: +90 442 2360948. E-mail address: [email protected] (H. Budak). 1382-6689/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.etap.2013.12.007
The detoxification of a wide spectrum of compounds that are produced internally or those coming from the environment are neutralized by the glutathione system (Valko et al., 2005; Weinbaum et al., 2008). In liver, ferric iron (Fe3+ ) is converted into ferrous iron (Fe2+ ) and produce the superoxide radical (Ganz, 2003; Huang, 2003; Jomova and Valko, 2011; Valko et al., 2005), in addition, Fe2+ interacts with hydrogen peroxide and generates the free hydroxyl radical (Fenton reaction) which can react with various biomolecules such as DNA, lipids and proteins. This reaction is an essential event preventing iron-mediated oxidative stress. Breakdown of this reaction causes various biological diseases such as anemia (Ganz and Nemeth, 2012; Liu et al., 2012), cardiovascular diseases (Kruszewski, 2004; Zhao et al., 2010), respiratory diseases (Golovin and Konvai, 1991; Hedlund et al., 2004), cancers (Durigova et al., 2012; Fonseca and Jakszyn, 2013; Lalefar and Ozeran, 2012; Liu et al., 2012), neurodegenerative disorder (Bush and Curtain, 2008; Graham et al., 2006; Ross and
366
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 365–370
Poirier, 2004). Therefore, the amount of iron entering the body and released from storage sites is firmly regulated by liver (Anderson and Shah, 2013; Finberg, 2013). The pancreas and endocrine organs are also sensitive to the toxic effects of iron, but liver is the major target (Anderson, 2007; O’Neil and Powell, 2005; Ramm and Ruddell, 2005). The glutathione system regulates GSH/GSSG ratio which is indispensable for cell survival (Akkemik et al., 2012; Economopoulos and Sergentanis, 2010; Jiao et al., 2007). Glutathione reductase (EC 1.8.1.7) is the key enzyme of glutathione system which is essential for reduction of glutathione disulfide (GSSG) to the reduced form glutathione (GSH) (Aksakal et al., 2011; Karaman et al., 2012). Although oxygen consumption generates reactive oxygen species (ROS), which are active forms of oxygen metabolites and peroxidized molecules, dangerous for the cell (Leonard et al., 2004), oxygen is essential for aerobic organisms. GPX is the main cellular scavenger of H2 O2 whose main biological role is to protect the cell from oxidative damage at the expense of GSH with peroxidase activity in almost all mammalian tissues (Powers and Jackson, 2008). The glutathione S-transferases (EC 2.5.1.18) are a group of multifunctional enzyme that play an important role in the metabolism, especially for the detoxification of environmental pollutants such as chemical toxins, drugs, and metal ions. GSTs are composed of many cytosolic, mitochondrial, and microsomal proteins in eukaryotic and prokaryotic species (Akkemik et al., 2012; Atkinson and Babbitt, 2009; Hayes et al., 2005). Although heavy metals are essential to the control of various metabolic and signaling pathways, toxic and carcinogenic effects of heavy metals have been reported in many studies. Heavy metal accumulation is becoming a serious worldwide problem because of the industrial, commercial, and human activity wastes. Thus, their toxic effects on living organisms have been intensively studied by researchers (Akkemik et al., 2012; Krewski et al., 2007; Yokel et al., 2008). Living organisms might be influenced by iron toxicity in two ways. Primary (genetic) iron overload causes genetic disorders, secondary (acquired) iron overload causes breakdown of homeostasis, which may lead to the metal binding to protein sites (Shander et al., 2012; Shander and Sazama, 2010). The aim of this study was to answer these questions. Does iron effect the glutathione system at the enzymatic or molecular level? And, is there any possible correlation between enzymatic and molecular levels?
2.
Materials and methods
2.1.
Iron preparation
One hour before the experiment, Iron(III) chloride hexahydrate (Sigma) was dissolved in deionized water (mpMinipure DEST UP, MES) for a final concentration of 0.87, 3, 30 and 300 ppm elemental iron, respectively.
2.2.
Animals and experimental design
Male Sprague-Dawley rats (110–130 g) were housed in an animal room with a controlled temperature (22 ± 2 ◦ C), humidity
(40–60%), and a regular 12-h light–dark cycle. Food and deionized water were allowed ad libitum. Before initiating the experiments, a period of acclimation of at least 1 week with deionized water was allowed. Animals were exposed daily to the mixture of metals with drinking water (deionized) for 100 days. 15 Male Sprague-Dawley rats were used in this study. They were randomly divided into five groups. First group, served as control, was given only deionized water. The baseline dose group (1X; 3 ppm) was given mode concentration of iron. Other two groups were given 10 (30 ppm) and 100-fold (300 ppm) concentration of the baseline group, respectively. Rats of another group were given iron at concentration, 0.87 ppm, equivalent to the maximum permissible limits (MPL) for iron specified by WHO (World Health Organization). No animal died and showed any visible sign of toxicity. After 100 days rats were sacrificed under anesthesia and the livers were quickly removed and frozen for experimental stages. Male Sprague-Dawley rats (110–130 g) procured from the Experimental Medical Application And Research Center, Ataturk University (Erzurum, Turkey).
2.3.
Blood and liver collection
At the end of 100 days iron treatment, the rats were anesthetized through intraperitoneal injection of a cocktail containing ketamine and xylazine. Blood was collected into heparinized tubes by heart puncture. Plasma was separated by centrifugation at 3500 rpm and 4 ◦ C for 15 min and stored at −80 ◦ C until further analysis. Liver tissues were removed and immediately stored at −80 ◦ C until further analysis.
2.4. liver
Measurement of the iron contents in blood and
The plasma concentration of non-heme iron was determined using kit (D1I15; DDS Erba, Germany) according to the manufacturer’s protocol. The liver concentration of non-heme iron was analyzed after homogenization using the same commercially available kit as used to analyze plasma.
2.5. RNA isolation and quantitative real-time PCR (qPCR) Total RNA was isolated from frozen rat liver tissues of both treated and control livers using RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany). DNase treatment was performed to avoid residual genomic DNA contamination. RNA concentrations and quality were verified by means of spectrophotometer (Thermo Scientific, Multiskan GO, USA) and RNA gel electrophoresis, respectively. cDNA was synthesized using ThermoScriptTM RT-PCR System for First-Strand cDNA Synthesis Kit (Invitrogen) according to the manufacturer’s protocol. All cDNAs were stored at −20 ◦ C until use. Primers and TaqMan probes were designed and purchased from Roche according to the company’s protocols. Their gene symbol were as follows; glutathione S-transferase alpha-5 (Gsta5), glutathione reductase (Gsr), glutathione peroxidase 2 (Gpx2) (www.roche-applied-science.com). -actin used as reference genes since it was not affected by any of the treatments. Primers and TaqMan probe for rat -actin gene
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 365–370
were designed using Primer3 software program (v. 0.4.0) (http://frodo.wi.mit.edu/) and purchased from Metabion International (Martinsried, Germany). The sequences of the specific primers of rat -actin (GenBank accession number NM 031144) were as follows: -actin forward primer AATCGTGCGTGACATCAAAG; -actin reverse primer CGTTGCCAATAGTGATGACCT; -actin Taqman probe Cy5-ATGGCCACTGCCGCATCCTC-BQ2. Thermal Cycler Real-Time PCR (Stratagene MxPro3000, Agilent Technologies CA, USA) machine was used to perform gene expression profile. The 20 l PCR reaction volume contained template DNA, 8 pmol of forward and reverse primers, 4 pmol TaqMan probe, and 10 l FastStart TaqMan Probe Master Mix (Applied Biosystems). The PCR conditions were as follows: 50 ◦ C for 2 min, 95 ◦ C for 10 min, 45 cycles of 95 ◦ C for 15 s, and annealing and extension at 60 ◦ C for 1 min. -actin expression was used for normalization and relative quantification (CT method).
2.6.
Enzyme assays
2.6.1.
Preparation of the homogenate
Rat liver homogenates were prepared by homogenizing the aged slices at 4 ◦ C, in a Heidolph SilentCrusher M mixer, in 50 mM Tris/HCl buffer, pH 7.6, containing 1 mM DTT, 1 mMEDTA and 1 mM PMSF of 1/5 (w/v). The lysates were centrifuged at 13,000 × g for 1 h, and then the precipitates were removed.
2.6.2.
Determination of enzyme activities
Glutathione reductase activity was measured spectrophotometrically at 25 ◦ C by the modified method of Carlberg and Mannervik (Carlberg and Mannervik, 1985). One enzyme unit was defined as the amount that oxidizes 1 mol NADPH per min under the assay conditions. In a 1 ml reaction mix, final concentrations are 20 mM K-Phosphate, 0.68 mM EDTA, pH: 7.6, 2 mM GSSG and 0.2 mM NADPH. GST activity with different substrates was determined as described by Habig et al. (1974). One unit conjugates 1.0 mol of 1-chloro-2,4-dinitrobenzene with reduced glutathione per min at pH 6.5 at 25 ◦ C. In a 1 ml reaction mix, final concentrations are 20 mM K-Phosphate, 0.68 mM EDTA, pH: 7.6, 2 mM GSH and 2.5 mM CDNB. Glutathione peroxidase enzymatic activity was measured by Wendel’s method (Wendel, 1980). One unit catalyzes the oxidation by H2 O2 of 1.0 mole of reduced glutathione to oxidized glutathione per min at pH 7.0 at 25 ◦ C. In a 3.05 ml reaction mix, final concentrations are 48 mM sodium phosphate, 0.38 mM EDTA, 0.12 mM NADPH, 0.95 mM NaN3 , 3.2 units of GSR, 1 mM GSH, 0.02 mM DTT, 0.0007% (w/w) H2 O2 and 0.075–0.15 unit of GPX.
2.7.
Protein determination
Quantitative protein determination was performed spectrophotometrically at 595 nm according to Bradford’s method, using bovine serum albumin as a standard.
2.8.
Statistical analysis
Each group contains three animals, and all measurements were triplicated for each animal. Statistical comparisons were
367
performed using GraphPad Prism Software (GraphPad Software, San Diego, CA). Groups were compared by using the unpaired Student t-test and Tukey’s multiple comparison test. p-values below 0.05 were considered significant.
3.
Results and discussion
Many studies in literature have shown that heavy metals like iron, cadmium, and nickel have the ability to produce reactive radicals which may constitute chelates with amino-acids, peptides, and proteins complex to prevent their functions or show genotoxic effects. It is well published that chronic iron toxicity causes genetic disorder related to liver and heart disease, cancer, diabetes, neurodegenerative disorders, immune system abnormalities and hormonal abnormalities (Anderson, 2007; Choi et al., 2013; Lieu et al., 2001; Valko et al., 2005). In this study, we tried to explain the impact of long-term Fe3+ toxicity on the glutathione system. For this reason, effects of iron on the transcription of the glutathione system has been investigated by Quantitative TaqMan real time PCR (Table 1), and then the enzyme activity of these enzymes have been measured in whole liver homogenates (Table 2). Thus, it can be said that toxic or non-toxic level of Fe3+ ions influences the glutathione system on the protein level or mRNA level in rat liver. The iron contents have been investigated for each dose and control in the blood (Fig. 1a) and liver (Fig. 1b). According to our results, hepatic iron content in 300 ppm treatment was statistically higher than other groups (0.87, 3, 30 ppm). In the blood, the iron content significantly increased in nontoxic (0.87 ppm) iron treatment. No statistical differences were found compared other groups (3, 30, 300 ppm) with corresponding control groups. It is known that feeding mice with a high iron-supplemented diet leads hepatic iron deposition, predominantly in Kupffer cells (Choi et al., 2013). Other studies indicated that iron level of the blood was decreased by the chronic-stress which might reflect the transferring of iron from the blood to other target organs (Kelleher and Lonnerdal, 2005; Lieu et al., 2001; Sigman and Lonnerdal, 1990; Teng et al., 2008). Our results clearly indicated that long-term toxic level iron administration had no effects in the blood, but the liver was affected in 300 ppm. Compared each of the treatment groups with control groups, GSR, GPX and GST enzyme activities were significantly increased in 0.87 ppm. While GST activity was increased continuously in the presence of toxic level of iron, GPX and GST activity decreased steadily in liver. Similar results have been shown for cadmium in bovine seminal plasma and spermatozoa (Tvrda et al., 2013) and in liver of Swiss albino mice (Zafeer et al., 2012), for nikel in goldfish gills (Kubrak et al., 2013), for lead in bovine seminal plasma and spermatozoa (Tvrda et al., 2013). Intragroup comparisons were analyzed for each enzyme as seen in Table 2. While GPX and GST exhibited significant differences, GSR had no difference in liver. In order to investigate possible relationship between gene and protein expression, mRNA level of these enzymes were observed in the presence of four different (0.87 ppm, 3 ppm, 30 ppm and 300 ppm) iron concentrations. mRNA level of Gsr and Gst were not affected in the presence of iron. For Gpx, transcriptional repression was seen in the presence of toxic
368
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 365–370
Table 1 – Comparison of mRNA levels of glutathione reductase (Gsr), glutathione peroxidase (Gpx) and glutathione S-transferases (Gst) in rat liver treated with distilled water and iron. Groups
Gsr Difference between means
Control & 8.87 ppm Control & 3 ppm Control & 30 ppm Control & 300 ppm 0.87 ppm & 3 ppm 0.87 ppm & 30 ppm 0.87 ppm & 300 ppm 3 ppm & 30 ppm 3 ppm & 300 ppm 30 ppm & 300 ppm
−0.137 −0.086 0.024 0.083 0.052 0.162 0.221 0.110 0.169 0.059
± ± ± ± ± ± ± ± ± ±
0.060 0.057 0.056 0.053 0.045 0.051 0.043 0.048 0.039 0.045
Gpx p values 0.0559ns 0.1777ns 0.6743ns 0.1529ns 0.2941ns 0.0134* 0.0014** 0.0528ns 0.0035ns 0.2226ns
Difference between means −0.005 −0.001 −0.009 0.006 0.004 −0.004 0.011 −0.008 0.007 0.015
± ± ± ± ± ± ± ± ± ±
0.006 0.004 0.002 0.002 0.007 0.006 0.006 0.004 0.004 0.002
Gst p values 0.3977ns 0.8329ns 0.0019** 0.0061** 0.5604ns 0.5366ns 0.0947ns 0.1007ns 0.1366ns 0.05 (not significant, ns); *p < 0.05 (significant); **p < 0.01 (very significant); ***p < 0.001 (extremely significant).
Table 2 – Comparison of enzyme activity of glutathione system in rat liver treated with distilled water and iron. Groups
GSR Difference between means
Control & 0.87 ppm Control & 3 ppm Control & 30 ppm Control & 300 ppm 0.87 ppm & 3 ppm 0.87 ppm & 30 ppm 0.87 ppm & 300 ppm 3 ppm & 30 ppm 3 ppm & 300 ppm 30 ppm & 300 ppm
−0.048 −0.045 −0.06 −0.029 0.003 −0.012 0.019 −0.015 0.016 0.006
± ± ± ± ± ± ± ± ± ±
0.010 0.010 0.016 0.008 0.010 0.015 0.009 0.016 0.010 0.021
GPX p values
Difference between means
0.0003*** 0.0009*** 0.0040** 0.0032** 0.7726ns 0.4257ns 0.0643ns 0.3557ns 0.1380ns 0.7714ns
−0.011 0.009 0.012 0.024 0.019 0.023 0.035 0.004 0.016 0.012
± ± ± ± ± ± ± ± ± ±
0.003 0.003 0.003 0.003 0.002 0.003 0.002 0.002 0.002 0.002
GST p values 0.0034** 0.0129* 0.0022**
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/etap
Impact of long term Fe3+ toxicity on expression of glutathione system in rat liver Harun Budak a,∗, Nurdan Gonul a, Hamid Ceylan a, Enver Fehim Kocpinar b a b
Ataturk University, Science Faculty, Department of Molecular Biology and Genetics, 25240 Erzurum, Turkey Ataturk University, Science Faculty, Department of Chemistry, 25240 Erzurum, Turkey
a r t i c l e
i n f o
a b s t r a c t
Article history:
The free radicals within the body, produced by metabolic activities or derived from envi-
Received 12 July 2013
ronmental sources are relatively related to hepatoxicity. Since heavy metals including iron
Received in revised form
have the ability to produce free radicals, the liver glutathione system neutralizes them
9 December 2013
to protect cells against any damage. The objective of this study is to indicate the toxic
Accepted 13 December 2013
effects of iron on the glutathione system at the enzymatic and molecular level. Thus, any
Available online 22 December 2013
possible correlation between enzymatic and molecular levels can be determined. According to our results, while mRNA expression of glutathione reductase (Gsr) and glutathione
Keywords:
S-transferases (Gsta5) genes were not affected by long-term exposure to various concentra-
Iron
tions of iron (Fe3+ ), transcription level of glutathione peroxidase (Gpx2) was influenced in
Toxic effects
the presence of toxic iron. Whereas the enzyme activites of GSR (GR), GPX and GST were
Glutathione system
significantly affected in rat liver.
mRNA expression
© 2013 Elsevier B.V. All rights reserved.
Enzyme activity
1.
Introduction
The liver performs many functions that are vital to life such as digestion, assimilation, storage for many essential vitamins and minerals including iron, copper, and vitamins that are needed for carrying oxygen around the body (Aisen et al., 2001; Cazzola et al., 1990; Lieu et al., 2001; Munoz et al., 2011). All body cells need a certain amount of iron to perform their metabolic requirements such as cell growth, oxygen utilization, various enzymatic activities, and responses of immune systems (Lieu et al., 2001; Munoz et al., 2011; Stoltzfus, 2001; Valko et al., 2005). Although iron is an essential element for all living organisms, accumulation of iron in the body has ability to produce reactive oxygen species (ROS) which causes genotoxic damage, protein sulfhydryls depletion and other effects in liver (Andrews, 1999; Huang, 2003; Lee et al., 2006; Munoz et al., 2011).
∗
Corresponding author. Tel.: +90 442 2314454; fax: +90 442 2360948. E-mail address: [email protected] (H. Budak). 1382-6689/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.etap.2013.12.007
The detoxification of a wide spectrum of compounds that are produced internally or those coming from the environment are neutralized by the glutathione system (Valko et al., 2005; Weinbaum et al., 2008). In liver, ferric iron (Fe3+ ) is converted into ferrous iron (Fe2+ ) and produce the superoxide radical (Ganz, 2003; Huang, 2003; Jomova and Valko, 2011; Valko et al., 2005), in addition, Fe2+ interacts with hydrogen peroxide and generates the free hydroxyl radical (Fenton reaction) which can react with various biomolecules such as DNA, lipids and proteins. This reaction is an essential event preventing iron-mediated oxidative stress. Breakdown of this reaction causes various biological diseases such as anemia (Ganz and Nemeth, 2012; Liu et al., 2012), cardiovascular diseases (Kruszewski, 2004; Zhao et al., 2010), respiratory diseases (Golovin and Konvai, 1991; Hedlund et al., 2004), cancers (Durigova et al., 2012; Fonseca and Jakszyn, 2013; Lalefar and Ozeran, 2012; Liu et al., 2012), neurodegenerative disorder (Bush and Curtain, 2008; Graham et al., 2006; Ross and
366
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 365–370
Poirier, 2004). Therefore, the amount of iron entering the body and released from storage sites is firmly regulated by liver (Anderson and Shah, 2013; Finberg, 2013). The pancreas and endocrine organs are also sensitive to the toxic effects of iron, but liver is the major target (Anderson, 2007; O’Neil and Powell, 2005; Ramm and Ruddell, 2005). The glutathione system regulates GSH/GSSG ratio which is indispensable for cell survival (Akkemik et al., 2012; Economopoulos and Sergentanis, 2010; Jiao et al., 2007). Glutathione reductase (EC 1.8.1.7) is the key enzyme of glutathione system which is essential for reduction of glutathione disulfide (GSSG) to the reduced form glutathione (GSH) (Aksakal et al., 2011; Karaman et al., 2012). Although oxygen consumption generates reactive oxygen species (ROS), which are active forms of oxygen metabolites and peroxidized molecules, dangerous for the cell (Leonard et al., 2004), oxygen is essential for aerobic organisms. GPX is the main cellular scavenger of H2 O2 whose main biological role is to protect the cell from oxidative damage at the expense of GSH with peroxidase activity in almost all mammalian tissues (Powers and Jackson, 2008). The glutathione S-transferases (EC 2.5.1.18) are a group of multifunctional enzyme that play an important role in the metabolism, especially for the detoxification of environmental pollutants such as chemical toxins, drugs, and metal ions. GSTs are composed of many cytosolic, mitochondrial, and microsomal proteins in eukaryotic and prokaryotic species (Akkemik et al., 2012; Atkinson and Babbitt, 2009; Hayes et al., 2005). Although heavy metals are essential to the control of various metabolic and signaling pathways, toxic and carcinogenic effects of heavy metals have been reported in many studies. Heavy metal accumulation is becoming a serious worldwide problem because of the industrial, commercial, and human activity wastes. Thus, their toxic effects on living organisms have been intensively studied by researchers (Akkemik et al., 2012; Krewski et al., 2007; Yokel et al., 2008). Living organisms might be influenced by iron toxicity in two ways. Primary (genetic) iron overload causes genetic disorders, secondary (acquired) iron overload causes breakdown of homeostasis, which may lead to the metal binding to protein sites (Shander et al., 2012; Shander and Sazama, 2010). The aim of this study was to answer these questions. Does iron effect the glutathione system at the enzymatic or molecular level? And, is there any possible correlation between enzymatic and molecular levels?
2.
Materials and methods
2.1.
Iron preparation
One hour before the experiment, Iron(III) chloride hexahydrate (Sigma) was dissolved in deionized water (mpMinipure DEST UP, MES) for a final concentration of 0.87, 3, 30 and 300 ppm elemental iron, respectively.
2.2.
Animals and experimental design
Male Sprague-Dawley rats (110–130 g) were housed in an animal room with a controlled temperature (22 ± 2 ◦ C), humidity
(40–60%), and a regular 12-h light–dark cycle. Food and deionized water were allowed ad libitum. Before initiating the experiments, a period of acclimation of at least 1 week with deionized water was allowed. Animals were exposed daily to the mixture of metals with drinking water (deionized) for 100 days. 15 Male Sprague-Dawley rats were used in this study. They were randomly divided into five groups. First group, served as control, was given only deionized water. The baseline dose group (1X; 3 ppm) was given mode concentration of iron. Other two groups were given 10 (30 ppm) and 100-fold (300 ppm) concentration of the baseline group, respectively. Rats of another group were given iron at concentration, 0.87 ppm, equivalent to the maximum permissible limits (MPL) for iron specified by WHO (World Health Organization). No animal died and showed any visible sign of toxicity. After 100 days rats were sacrificed under anesthesia and the livers were quickly removed and frozen for experimental stages. Male Sprague-Dawley rats (110–130 g) procured from the Experimental Medical Application And Research Center, Ataturk University (Erzurum, Turkey).
2.3.
Blood and liver collection
At the end of 100 days iron treatment, the rats were anesthetized through intraperitoneal injection of a cocktail containing ketamine and xylazine. Blood was collected into heparinized tubes by heart puncture. Plasma was separated by centrifugation at 3500 rpm and 4 ◦ C for 15 min and stored at −80 ◦ C until further analysis. Liver tissues were removed and immediately stored at −80 ◦ C until further analysis.
2.4. liver
Measurement of the iron contents in blood and
The plasma concentration of non-heme iron was determined using kit (D1I15; DDS Erba, Germany) according to the manufacturer’s protocol. The liver concentration of non-heme iron was analyzed after homogenization using the same commercially available kit as used to analyze plasma.
2.5. RNA isolation and quantitative real-time PCR (qPCR) Total RNA was isolated from frozen rat liver tissues of both treated and control livers using RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany). DNase treatment was performed to avoid residual genomic DNA contamination. RNA concentrations and quality were verified by means of spectrophotometer (Thermo Scientific, Multiskan GO, USA) and RNA gel electrophoresis, respectively. cDNA was synthesized using ThermoScriptTM RT-PCR System for First-Strand cDNA Synthesis Kit (Invitrogen) according to the manufacturer’s protocol. All cDNAs were stored at −20 ◦ C until use. Primers and TaqMan probes were designed and purchased from Roche according to the company’s protocols. Their gene symbol were as follows; glutathione S-transferase alpha-5 (Gsta5), glutathione reductase (Gsr), glutathione peroxidase 2 (Gpx2) (www.roche-applied-science.com). -actin used as reference genes since it was not affected by any of the treatments. Primers and TaqMan probe for rat -actin gene
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 365–370
were designed using Primer3 software program (v. 0.4.0) (http://frodo.wi.mit.edu/) and purchased from Metabion International (Martinsried, Germany). The sequences of the specific primers of rat -actin (GenBank accession number NM 031144) were as follows: -actin forward primer AATCGTGCGTGACATCAAAG; -actin reverse primer CGTTGCCAATAGTGATGACCT; -actin Taqman probe Cy5-ATGGCCACTGCCGCATCCTC-BQ2. Thermal Cycler Real-Time PCR (Stratagene MxPro3000, Agilent Technologies CA, USA) machine was used to perform gene expression profile. The 20 l PCR reaction volume contained template DNA, 8 pmol of forward and reverse primers, 4 pmol TaqMan probe, and 10 l FastStart TaqMan Probe Master Mix (Applied Biosystems). The PCR conditions were as follows: 50 ◦ C for 2 min, 95 ◦ C for 10 min, 45 cycles of 95 ◦ C for 15 s, and annealing and extension at 60 ◦ C for 1 min. -actin expression was used for normalization and relative quantification (CT method).
2.6.
Enzyme assays
2.6.1.
Preparation of the homogenate
Rat liver homogenates were prepared by homogenizing the aged slices at 4 ◦ C, in a Heidolph SilentCrusher M mixer, in 50 mM Tris/HCl buffer, pH 7.6, containing 1 mM DTT, 1 mMEDTA and 1 mM PMSF of 1/5 (w/v). The lysates were centrifuged at 13,000 × g for 1 h, and then the precipitates were removed.
2.6.2.
Determination of enzyme activities
Glutathione reductase activity was measured spectrophotometrically at 25 ◦ C by the modified method of Carlberg and Mannervik (Carlberg and Mannervik, 1985). One enzyme unit was defined as the amount that oxidizes 1 mol NADPH per min under the assay conditions. In a 1 ml reaction mix, final concentrations are 20 mM K-Phosphate, 0.68 mM EDTA, pH: 7.6, 2 mM GSSG and 0.2 mM NADPH. GST activity with different substrates was determined as described by Habig et al. (1974). One unit conjugates 1.0 mol of 1-chloro-2,4-dinitrobenzene with reduced glutathione per min at pH 6.5 at 25 ◦ C. In a 1 ml reaction mix, final concentrations are 20 mM K-Phosphate, 0.68 mM EDTA, pH: 7.6, 2 mM GSH and 2.5 mM CDNB. Glutathione peroxidase enzymatic activity was measured by Wendel’s method (Wendel, 1980). One unit catalyzes the oxidation by H2 O2 of 1.0 mole of reduced glutathione to oxidized glutathione per min at pH 7.0 at 25 ◦ C. In a 3.05 ml reaction mix, final concentrations are 48 mM sodium phosphate, 0.38 mM EDTA, 0.12 mM NADPH, 0.95 mM NaN3 , 3.2 units of GSR, 1 mM GSH, 0.02 mM DTT, 0.0007% (w/w) H2 O2 and 0.075–0.15 unit of GPX.
2.7.
Protein determination
Quantitative protein determination was performed spectrophotometrically at 595 nm according to Bradford’s method, using bovine serum albumin as a standard.
2.8.
Statistical analysis
Each group contains three animals, and all measurements were triplicated for each animal. Statistical comparisons were
367
performed using GraphPad Prism Software (GraphPad Software, San Diego, CA). Groups were compared by using the unpaired Student t-test and Tukey’s multiple comparison test. p-values below 0.05 were considered significant.
3.
Results and discussion
Many studies in literature have shown that heavy metals like iron, cadmium, and nickel have the ability to produce reactive radicals which may constitute chelates with amino-acids, peptides, and proteins complex to prevent their functions or show genotoxic effects. It is well published that chronic iron toxicity causes genetic disorder related to liver and heart disease, cancer, diabetes, neurodegenerative disorders, immune system abnormalities and hormonal abnormalities (Anderson, 2007; Choi et al., 2013; Lieu et al., 2001; Valko et al., 2005). In this study, we tried to explain the impact of long-term Fe3+ toxicity on the glutathione system. For this reason, effects of iron on the transcription of the glutathione system has been investigated by Quantitative TaqMan real time PCR (Table 1), and then the enzyme activity of these enzymes have been measured in whole liver homogenates (Table 2). Thus, it can be said that toxic or non-toxic level of Fe3+ ions influences the glutathione system on the protein level or mRNA level in rat liver. The iron contents have been investigated for each dose and control in the blood (Fig. 1a) and liver (Fig. 1b). According to our results, hepatic iron content in 300 ppm treatment was statistically higher than other groups (0.87, 3, 30 ppm). In the blood, the iron content significantly increased in nontoxic (0.87 ppm) iron treatment. No statistical differences were found compared other groups (3, 30, 300 ppm) with corresponding control groups. It is known that feeding mice with a high iron-supplemented diet leads hepatic iron deposition, predominantly in Kupffer cells (Choi et al., 2013). Other studies indicated that iron level of the blood was decreased by the chronic-stress which might reflect the transferring of iron from the blood to other target organs (Kelleher and Lonnerdal, 2005; Lieu et al., 2001; Sigman and Lonnerdal, 1990; Teng et al., 2008). Our results clearly indicated that long-term toxic level iron administration had no effects in the blood, but the liver was affected in 300 ppm. Compared each of the treatment groups with control groups, GSR, GPX and GST enzyme activities were significantly increased in 0.87 ppm. While GST activity was increased continuously in the presence of toxic level of iron, GPX and GST activity decreased steadily in liver. Similar results have been shown for cadmium in bovine seminal plasma and spermatozoa (Tvrda et al., 2013) and in liver of Swiss albino mice (Zafeer et al., 2012), for nikel in goldfish gills (Kubrak et al., 2013), for lead in bovine seminal plasma and spermatozoa (Tvrda et al., 2013). Intragroup comparisons were analyzed for each enzyme as seen in Table 2. While GPX and GST exhibited significant differences, GSR had no difference in liver. In order to investigate possible relationship between gene and protein expression, mRNA level of these enzymes were observed in the presence of four different (0.87 ppm, 3 ppm, 30 ppm and 300 ppm) iron concentrations. mRNA level of Gsr and Gst were not affected in the presence of iron. For Gpx, transcriptional repression was seen in the presence of toxic
368
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 365–370
Table 1 – Comparison of mRNA levels of glutathione reductase (Gsr), glutathione peroxidase (Gpx) and glutathione S-transferases (Gst) in rat liver treated with distilled water and iron. Groups
Gsr Difference between means
Control & 8.87 ppm Control & 3 ppm Control & 30 ppm Control & 300 ppm 0.87 ppm & 3 ppm 0.87 ppm & 30 ppm 0.87 ppm & 300 ppm 3 ppm & 30 ppm 3 ppm & 300 ppm 30 ppm & 300 ppm
−0.137 −0.086 0.024 0.083 0.052 0.162 0.221 0.110 0.169 0.059
± ± ± ± ± ± ± ± ± ±
0.060 0.057 0.056 0.053 0.045 0.051 0.043 0.048 0.039 0.045
Gpx p values 0.0559ns 0.1777ns 0.6743ns 0.1529ns 0.2941ns 0.0134* 0.0014** 0.0528ns 0.0035ns 0.2226ns
Difference between means −0.005 −0.001 −0.009 0.006 0.004 −0.004 0.011 −0.008 0.007 0.015
± ± ± ± ± ± ± ± ± ±
0.006 0.004 0.002 0.002 0.007 0.006 0.006 0.004 0.004 0.002
Gst p values 0.3977ns 0.8329ns 0.0019** 0.0061** 0.5604ns 0.5366ns 0.0947ns 0.1007ns 0.1366ns 0.05 (not significant, ns); *p < 0.05 (significant); **p < 0.01 (very significant); ***p < 0.001 (extremely significant).
Table 2 – Comparison of enzyme activity of glutathione system in rat liver treated with distilled water and iron. Groups
GSR Difference between means
Control & 0.87 ppm Control & 3 ppm Control & 30 ppm Control & 300 ppm 0.87 ppm & 3 ppm 0.87 ppm & 30 ppm 0.87 ppm & 300 ppm 3 ppm & 30 ppm 3 ppm & 300 ppm 30 ppm & 300 ppm
−0.048 −0.045 −0.06 −0.029 0.003 −0.012 0.019 −0.015 0.016 0.006
± ± ± ± ± ± ± ± ± ±
0.010 0.010 0.016 0.008 0.010 0.015 0.009 0.016 0.010 0.021
GPX p values
Difference between means
0.0003*** 0.0009*** 0.0040** 0.0032** 0.7726ns 0.4257ns 0.0643ns 0.3557ns 0.1380ns 0.7714ns
−0.011 0.009 0.012 0.024 0.019 0.023 0.035 0.004 0.016 0.012
± ± ± ± ± ± ± ± ± ±
0.003 0.003 0.003 0.003 0.002 0.003 0.002 0.002 0.002 0.002
GST p values 0.0034** 0.0129* 0.0022**
