Accepted Preprint
Original Article
IMPACT OF PARTICLE SIZE AND LIGHT EXPOSURE ON THE EFFECTS OF TIO2 NANOPARTICLES ON CAENORHABDITIS ELEGANS
JUDITH S. ANGELSTORF, WOLFGANG AHLF, FRANK VON DER KAMMER, and SUSANNE HEISE
Environ Toxicol Chem., Accepted Article • DOI: 10.1002/etc.2674
Accepted Article "Accepted Articles" are peer-reviewed, accepted manuscripts that have not been edited, formatted, or in any way altered by the authors since acceptance. They are citable by the Digital Object Identifier (DOI). After the manuscript is edited and formatted, it will be removed from the “Accepted Articles” Web site and published as an Early View article. Note that editing may introduce changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. SETAC cannot be held responsible for errors or consequences arising from the use of information contained in these manuscripts.
Accepted Preprint
Original Article
Environmental Toxicology and Chemistry DOI 10.1002/etc.2674
IMPACT OF PARTICLE SIZE AND LIGHT EXPOSURE ON THE EFFECTS OF TIO2 NANOPARTICLES ON CAENORHABDITIS ELEGANS
Running title: Light exposure increases nano-TiO2 toxicity
JUDITH S. ANGELSTORF,† WOLFGANG AHLF,‡ FRANK VON DER KAMMER,§ and SUSANNE HEISE†
† Hamburg University of Applied Sciences, Hamburg, Germany
‡ Institute of Environmental Technology and Energy Economics, University of Technology, Hamburg, Germany
§ Department of Environmental Geosciences, University of Vienna, Vienna, Austria.
*Address correspondence to [email protected]
Additional Supporting Information may be found in the online version of this article.
© 2014 SETAC Submitted 14 January 2014; Returned for Revision 13 June 2014; Accepted 13 June 2014
Accepted Preprint
Abstract: The increasing use of engineered nanoparticles in industrial and consumer products leads to a release of the anthropogenic contaminants to the aquatic environment. To obtain a better understanding of the environmental effects of these particles, the nematode Caenorhabditis elegans was used to investigate the organism-level effects and in vivo molecular
responses. Toxicity of bulk-scale (~160 nm) and nano-scale (21 nm) titanium dioxide (TiO2) was tested under dark and light conditions, following ISO 10872. The expression of sod-3, a mitochondrial superoxide dismutase, was quantified as an indicator for oxidative stress induced by the photocatalytically active material. Particle sizes were estimated using dynamic light scattering and scanning electron microscopy. While both materials agglomerated to a comparable secondary particle size of 300 to 1500 nm and were ingested into the intestine, only nano-TiO2
significantly inhibited reproduction (lowest-observed-effect-concentration: 10 mg/L). Light exposure induced the production of reactive oxygen species by nano-TiO2 and increased toxicity
of the nanomaterial from a median effect concentration of more than 100 mg/L to 53 mg/L. No evidence was found for inner cellular photocatalytic activity of nano-TiO2. Therefore, oxidative damage of the membranes of intestinal cells is suggested as a potential mode of action. Results highlight the importance of primary particle size and environmental parameters on the toxicity of TiO2.
Keywords: TiO2-nanoparticles, Toxicity, Caenorhabditis elegans, Photoactivated effects
Accepted Preprint
INTRODUCTION
Engineered nanoparticles (ENPs) are increasingly used in a variety of industrial and
consumer products and can be released to the aquatic environment, e.g., by urban runoff [1]. By modeling environmental emissions of nanoscale titanium dioxide (nano-TiO2), Gottschalk et al. identified sediments as main sink for the anthropogenic contaminants and predicted nano-TiO2
accumulation rates up to 1.4 mg/kg per year (Q0.85 for European sediments) [2]. Nanoparticles pose a higher risk to the exposed environment relative to their bulk-scale counterparts, because their small size (< 100 nm) enables them to penetrate organisms and cells [3, 4]. In addition, their increased surface area generally increases their reactivity. TiO2-particles are assumed to exhibit
higher photocatalytic activity in the nanoparticulate form, as this property strongly depends on the accessibility of the particles’ surface to the environment [5, 6]. Though the number of publications characterizing the ecotoxicological effects of ENPs
are steadily increasing, potential effects of ENPs on the environment are still poorly understood [7, 8]. According to Kahru and Dubourguier, TiO2 nanoparticles are classified as “harmful”, affecting algae and invertebrates with lethal or effect concentrations of 10 to 100 mg/L in liquid test systems [9]. Baun et al. reported similar effect ranges for invertebrates and identified Daphnia magna as the most commonly used test organism when evaluating nanoparticle toxicity [10]. Based on their review, Baun et al. recommended focusing on chronic endpoints for future nanomaterial testing. In the present study, the nematode Caenorhabditis elegans was used to determine chronic
toxicological effects and possible modes of action of TiO2 nanoparticles under light and dark
conditions. C. elegans is considered an excellent test organism to evaluate toxicological effects and mechanisms as they enable both the detection of organism-level endpoints like feeding,
Accepted Preprint
growth and reproduction, as well as the analysis of molecular responses (e.g., stress responses) to the chemical exposure in vivo. Furthermore, C. elegans are of high environmental relevance; nematodes are one of the most abundant and diverse species within the metazoan groups, and they play a key role in nutrient cycling and maintaining the environmental quality of terrestrial and benthic ecosystems [11]. C. elegans is used as an endobenthic test organism for the evaluation of contaminated
soils and sediments with the distinct advantage that it is applicable to sediment, soil and liquid phase testing [12]. Liquid phase testing using C. elegans meets two key requirements in nanoparticle research: simultaneous testing of a soil and sediment organism, and proper characterization of nanoparticles in the test medium. Due to its transparent body, C. elegans
offers the ability to analyze nanoparticle uptake and translocation in the gastrointestinal tract, which delivers information crucial to understanding the particles’ behavior and mode of action. Amongst the few existing studies on the effects of different TiO2 nanoparticles (TiO2
NPs) on C. elegans, reported effect concentrations vary greatly; published values range from 0.5 µg/L for reproduction [13], to 1 mg/L for fertility [14], and 47.9 mg/L for reproduction [15]. Regarding possible modes of action of TiO2 NPs , Bigorgne et al. [16] reported an increased expression of metallothionein for Eisenia fetida coelomocytes, indicating increased metal detoxification. However, this molecular response could not be observed in vivo for C. elegans [14]. Another possible mode of action is the induction of oxidative stress by the production of reactive oxygen species (ROS). This process is well understood for photocatalytic materials like TiO2 under UV-exposure, and has been shown to adversely affect invertebrates [17].
Additionally, even in the absence of light, TiO2 NPs can cause oxidative damage to cell structures such as DNA and lipids in in vitro experiments using different cell lines [18, 19]. An
Accepted Preprint
in vivo study on C. elegans supports this suggested mode of action for the nematode. The authors found a significant correlation between growth, reproduction and movement behavior of the nematode with the observed ROS production resulting from an exposure to TiO2 NPs [20]. The
impact of light exposure on this photocatalytic effects has been studied for C. elegans using ZnO
nanoparticles as another photocatalytically active material. Results provide evidence for an increased phototoxicity that was closely related to the observed ROS production [21]. The present study compares the agglomeration behavior and toxicological effects of a
nano-scale TiO2 (P25, 21 nm) and a bulk-scale TiO2 (NM100, 90 – 230 nm) on the nematode C. elegans with the objective of evaluating the importance of primary particle size, as nominal particle size of a single particle, and secondary particle size, as agglomerate size in the test medium. The terms primary and secondary particle size are defined as single source particles and their agglomerates according to ISO TS27687 2008. To study oxidative stress as a possible mode of action under light and dark conditions, ROS production of the two TiO2 test materials was determined in the test systems. Expression of a superoxide dismutase (sod-3) by C. elegans
indicated the molecular response to the potential oxidative stress induced by ROS during TiO2 exposure. The experiments were designed to answer the following questions: A) Does particle size
affect the toxicity of TiO2 particles? And B) What impact does sunlight has on the toxicity of photocatalytically active nanoparticles?
MATERIALS AND METHODS
Test materials The TiO2 nanomaterial P25 AEROXIDE® (Evonik-Degussa, Essen, Germany) consists
of 86 % anatase and of 14 % rutile. It has a primary particle size of 21 nm and a surface area of 50 ± 15 m2/g (BET) (all data provided by the manufacturer). The bulk material NM100
Accepted Preprint
(Millenium Inorganic Chemicals, Cockeysville, USA) consists of 98 % anatase and has a surface area 10 m2/g (BET) (data provided by the manufacturer). Its primary particle size was measured
by scanning electron microscopy using a Leo Gemini 1530 (Zeiss, Oberkochen, Germany) and showed a particle size of 90 to 230 nm. Both materials were provided and characterized by the Joint Research Center (JRC) as batch-materials of the "Sponsorship Programme for the Testing of Manufactured Nanomaterials" carried out by the Organisation for Economic Co-operation and Development (OECD). All other substances used were purchased from Carl Roth, Merck and Sigma Aldrich, Germany. Preparation and characterization of the test-suspensions TiO2-materials were dispersed in ultrapure water (pH of 6.75, conductivity < 0.055
µS/cm, TOC < 10 µg/kg) using magnetic stirring (900 rpm for 1 min) and sonication (ultrasonic bath, 5 min, 320 W). Test-suspensions were prepared double concentrated and diluted to the final test concentration by the addition of nutrient medium M9. To validate the standard operating procedure of the dispersion method, particle characterization was carried out for all test concentrations in the test suspensions dispersed in ultrapure water. To determine the characteristics of the secondary particles in the test medium, the same characterization procedure was carried out after addition of the test suspension to the test medium M9 for all test concentrations. To avoid any disturbance of the size measurement by other particles, characterization was performed in the absence of food bacteria. The characterization comprised determination of mean particle size, particle size
distribution, poly-dispersity-index (PDI) and zeta-potential by dynamic light scattering (DLS) using a Malvern Zetasizer Nano ZS. DLS measurement was performed according to the test protocol of Nickel et al. [22]. For qualitative validation of the DLS results, scanning electron microscopy (SEM) of the suspended particles was applied for all test concentrations. To image
Accepted Preprint
the particles, suspensions were filtered onto polycarbonate filters with a pore size of 0.03 µm and 0.1 µm for nano-TiO2 and bulk-TiO2, respectively. Filters were dried, sputter coated with a 6 nm
layer of gold and scattered in high vacuum using a Leo Gemini 1530 (Zeiss, Oberkochen, Germany) using a voltage of 5 keV and a magnification of 20,000. Particle sizes were measured for at least 140 particles per concentration using the software Scandium (Zeiss). To further validate the efficiency and the reproducibility of the standard operating procedure, TiO2 concentrations were determined in the test-system (test suspension + M9 medium without bacteria) for each test concentration (for three independently dispersed replicates per concentration) by inductively coupled plasma optical emission spectrometry (PE-Optima 7000 DV OES with ICP, Perkin Elmer, Waltham, Massachusetts, USA) following an extraction with HNO3/HF/H2O. Photocatalytic activity Photocatalytic activity of nano- and bulk material was compared by methylene blue degradation as an indicator of the generation of reactive oxygen species (ROS). Methylene blue (final concentration of 12.5 mg/L) was added to TiO2 suspensions of each test concentration. Light absorption was measured at a wavelength of 663 nm (absorption maxima of the samples at t0) after 30 min of irradiation (intensity of 231 W/m2) by using a UV-1800 240 V IVDD
photometer, Shimadzu (Nakagyo-ku, Kyōto, Japan). Degradation of methylene blue after 30 min
was calculated as percentage of degradation in a non-irradiated control. Irradiation Simulated solar radiation (SSR) was generated by a weathering chamber (Q-Sun Xe - 1-B, Q-Labs Deutschland) equipped with a Chiller and a daylight filter (Daylight Q, Q-Labs Deutschland). Light intensity was adjusted to 231 W/m2 at a wavelength of 300 to 800 nm, temperature was regulated at 19.2°C ± 1.6. For all SSR-treatments, samples were irradiated for
Accepted Preprint
30 min, 4 h after the start of the test (introduction of the test organisms). To minimize evaporation of the test suspension to 2.1 % ± 0.7, samples were covered by 3 mm ± 0.3 quartz glass (EN08) purchased from Aachener Quarz - Glas Technologie Heinrich (Aachen, Germany). Chronic bioassay with C. elegans The test organism C. elegans wildtype ‘Maupus, N2 var. Bristol’ was purchased from the Caenorhabditis Genetics Center (CGC) and maintained on nematode growth medium (NGM) agar plates [23] with a bacterial lawn of Escherichia coli, (OP50 strain, CGC) serving as food source according to ISO 10872. To test for the chronic effects of the TiO2-materials, L1 larvae
(approx. 200 µm in length) of C. elegans were exposed to the test materials for 96 h according to
the standard bioassay ISO 10872. Deviating from the ISO-norm, 20 mL quartz-glass vessels (DURAN®, Carl Roth) were used instead of 12 well multi dishes. Therefore, the test-volume was adapted to 2.5 mL according to the surface/volume ratio of the test solution in the 12 well plates. All tests were realized in the liquid phase consisting of 50 % test-suspension and 50 % growth medium. The growth medium M9 has a total ionic strength of 443 mmol/L (42 mM of Na2HPO4, 22 mM of KH2PO4, 86 mM of NaCl and 1 mM MgSO4 x 7 H2O) and contains Escherichia coli bacteria serving as food source (optical density of 1000 ± 50 FAU (formazine attenuation units)) and 0.2 v/v % of cholesterol. Ecotoxicity: Experimental set up and endpoints Both TiO2-materials were tested at concentrations of 1, 3, 10, 30, and 100 mg/L in
darkness as well as in combined exposure with simulated solar irradiation. For each treatment, four replicates were run with 10 individuals per replicate (4 x 10 = 40 individuals per treatment). For each test, a negative control was run by using ultrapure water as test-substance. The pH of the test system was 7. As ecotoxicological endpoints, growth (increase in length in µm) and
Accepted Preprint
reproduction (number of offspring) were determined after 96 h of exposure. Inhibition of the exposed organisms was calculated in relation to the correspondent control group. Ingestion of TiO2 particles by C. elegans Uptake of TiO2 particles by C. elegans was observed by light microscopy (Olympus BX
41 TF). The transparent test organisms were exposed to the TiO2 particles for exposure times
ranging from 4.75 h to 10 d. Organisms were anesthetized by 0.5 % 1-phenoxy-2-propanol for light microscopic imaging. Scanning electron microscopy and energy dispersive X-ray spectroscopy (SEM-EDX) was applied to prove the ingestion of TiO2 by C. elegans after
exposure. For the SEM analysis, exposed test organisms were fixed with glutaraldehyde and transferred to amyl acetate via an ethanol dilution series to reach complete dehydration before supercritical drying of the nematodes was performed. After sputter coating with 10 nm of gold, an EDX-mapping was performed using a voltage of 20 keV with a Leo Gemini 1530 equipped with EDX. Molecular response: sod-3-expression sod-3, a mitochondrial superoxide dismutase, indicates intracellular oxidative stress. Its expression was measured by quantitative real-time PCR (qRT-PCR). Prior and subsequent to the exposure of C. elegans to different concentrations of nano-TiO2 for 6 h under light and dark conditions, the test organisms were washed by floating on sucrose (60 %) according to Hope [24] to avoid contamination with E.coli bacteria. The worm pellet was frozen on liquid nitrogen and kept at -70°C. Total RNA was extracted by using RNeasy Kits (Qiagen, Venlo, Netherlands) according to the manufacturer’s instruction. To increase the efficiency of the RNA extraction, the samples were pestled and passed through a 22 gauge needle according to Johnstone [25].To avoid contamination with DNA, RNA samples were digested with DNAse I for 15 min at room temperature. First-strand cDNA synthesis was carried out using the RevertAid Premium Enzyme
Accepted Preprint
Mix, 5xRT buffer, dNTP mix, oligo dT and Random Hexamer Primer as recommended by the manufacturer (Fermentas, Thermo Fisher Scientific, Waltham, Massachusetts, USA). For quantification of the amount of sod-3 mRNA, a quantitative real-time polymerase chain reaction
(qRT-PCR) was carried out using Maxima SYBR Green qPCR Master Mix without the passive reference dye ROX. All PCR measurements were performed by a Biorad iQ™5 Multicolor RealTime PCR Detection System equipped with an iCycler under the following conditions: 95 °C for 10 min (one cycle), 95°C for 15 sec and 60°C for 60 sec (35 cycles) and 55°C to 95°C in 0.5°C steps for 10 sec (85 cycles). The efficiency of the PCR was determined by measuring the amplification of a serial dilution of the cDNA for one sample in each run. The level of sod-3 mRNA was normalized to the mRNA level of the act-1 as an endogenous reference gene. To
amplify sod-3 cDNA the following specific primer pair was chosen: AATGCTGCAATCTACTGCTCGCA and GTGTGCTTGGAGCGGACGGC (167 base pairs). To amplify the act-1 gene the specific primer pair CCCCACCAGAGCGCAAGTACTCCGTCT and TGTTGGAAGGTGGAGAGGGAAGCG (70 base pairs) was used. The quantity of the target mRNA was calculated by the efficiency-corrected ΔΔCT method and the quantity of sod-3 mRNA in exposed nematodes was expressed in relation to non-exposed nematodes. Statistics All data were expressed as mean ± standard deviation (SD). All statistics were calculated using Graph Pad Prism 5. For the chronic toxicity test, four replicates were performed with ten individuals per replicate for each treatment. To test for normal distribution, a KolmogorovSmirnov-Test was run. To evaluate statistical significance between treatments, a one-way Analysis of Variance (ANOVA) at α = 0.05, with Dunnett/Bonferroni post hoc multiple
comparison tests was used. The median effective concentration values (EC50) were calculated of log10 transformed inhibition values using a non-linear regression with variable slope. For the
Accepted Preprint
analysis of the gene expression of sod-3, three replicates were run and a one-way ANOVA at α =
0.05 with post-hoc Dunnett's test was calculated. RESULTS AND DISCUSSION
Characteristics and behavior of secondary TiO2-particles in the test system According to DLS analyses, both nano- and bulk-TiO2 particles agglomerated in the M9-
medium to comparable mean secondary particle sizes from about 300 nm at 1 mg/L up to 1500 nm at 100 mg/L. For both test-materials, particle sizes increased within the test system (M9 medium) with increasing concentrations (Table 1). Table S1 (supplemental data) displays much lower particle sizes in ultrapure water, directly before the introduction of the stock suspensions into the test system. A test simulation showed that no further increase in particle sizes occurred for nano-TiO2 during a test period of 96 h (Table S3). However, agglomerates settled visibly within the first 24 h, leading to an increased exposure of the test organisms located at the
bottoms of test vessels. Table 1 Table 2 Fig. 1
Figure 1 shows an example of the SEM images for bulk-TiO2 (Fig. 1A) and nano-TiO2
(Fig. 1B). Compared to the DLS results, agglomeration of TiO2 in M9 was less distinct according to the SEM-analysis. Mean particle sizes ranged from 303 nm to 504 nm for nano-TiO2 and from
309 nm to 702 nm for bulk-TiO2 in M9 medium (Table 2) and were comparable to the particle sizes in water (Table S2). No clear relation was observed between concentration and particle size. The larger particle sizes detected by DLS measurements might simply be caused by the methodical limitations of the DLS applied to polydisperse suspensions. DLS is known to be inherently sensitive to the presence of larger particles in a sample, resulting in an over-estimation
Accepted Preprint
of the mean diameter in polydisperse suspensions [26]. Another reason for the detection of lower particle sizes by SEM imaging could be the preparation procedure of the samples: after 1 mL of suspension was trapped on the filter, 1 mL of H2O was used to rinse off salts originating from the medium M9. This procedure might have caused a separation of loose agglomerates, forming several smaller particles. As this kind of separation processes might also occur within the test system (e.g., in the intestinal tract of the organism), particle sizes gained by SEM are regarded as physiologically relevant. Table S3 displays the particle sizes in ultrapure water before the introduction to the test system. Mean ζ-potentials in M9 medium were at -25.39 ± 6.94 mV and -28.54 ± 3.4 mV for
nano- and bulk TiO2, respectively (data not shown). Thus, both types of particles are negatively charged and have the potential to interact with positively charged ions or molecules in the test system. Recovery of TiO2 from the test-system after dispersion and introduction according to the
standard operation procedure was 103 % ± 7.4 for nano-TiO2 and 103 % ± 9.5 for bulk-TiO2. TiO2 is expected to be stable in the test system at pH 7, as Schmidt and Vogelsberger did not
measure any dissolved titanium from P25 at pH 4 or higher [27]. Impact of particle size on chronic toxicity The nematode test first done at 1, 3, 10, and 30 mg nano-TiO2/L was repeated three times
(using four replicates with ten individuals per test) to determine the toxicity of nano-TiO2 and the
range of variation. The most sensitive endpoint was reproduction with a no observed effect concentration (NOEC) of 3 mg/L. For growth the NOEC was 10 mg/L. The lowest-observedeffect concentration (LOEC) for reproduction was 10 mg/L, showing a significant inhibition of 20.8 % ± 11.8 (p < 0.05) compared to the control group. The LOEC for growth was 30 mg/L, with a significant inhibition of 6.4 % ± 2.0 (p < 0.001) compared to controls. Reproduction was inhibited about 39.1 % ± 11.8 (p < 0.001) (data not shown). According to the Kolmogorov-
Accepted Preprint
Smirnov-Test, data were normally distributed, and the highest SD observed was 11.8 %. To test the impact of particle size on the effects of TiO2-particles, toxicity of nano-TiO2 (nominal particle size of 21 nm) was compared to a bulk-TiO2 (mean nominal particle size of 160 nm) in the following experiment. As previously described and illustrated in Fig. 2A, both materials agglomerated in the test system to a comparable particle size of up to 1500 nm for the highest test concentration of 100 mg/L. Nevertheless, bulk-TiO2 did not cause any significant change in
the number of offspring (reproduction) or the increase in body length (growth) of C. elegans
during 96 h of exposure to up to 100 mg/L, while nano-TiO2 inhibited reproduction and growth significantly (Fig. 2B). At 100 mg/L growth and reproduction were inhibited approximately by 13.9 % ± 2.3 and 45.1 % ± 2.9 in percent of the control, respectively. Fig. 2
This observation leads to the conclusion that the secondary particle size is not the crucial
parameter for the observed toxicity of TiO2-particles: while both materials showed similar
secondary particle sizes, the nanomaterial was significantly more toxic to the test organism than the bulk material. As the SEM analysis of the secondary particles indicated that the agglomerates were only weakly bound, it is likely that agglomerates can disaggregate in the test system. This process could even be induced by natural surfactants in the intestine of the test organism. A similar particle stabilizing effect was observed for exopolymers of bacteria [28]. Furthermore, the pH in the intestine of C. elegans, which oscillates between 6.2 and 7.6 [29], can alter the
particle size in the test organism. In terms of the crystalline structure of the different materials, a higher toxicity was expected for the bulk material NM100. NM100 consists of 98 % anatase, which is the more toxic crystalline form of TiO2 compared to rutile [30]. In contrast, the nanomaterial P25 contains 14 % of the less toxic form rutile. For this reason, primary particle
Accepted Preprint
size was identified as the characteristic variable most likely correlated with increased toxicity of the nano-TiO2 P25 in comparison to the bulk material NM100. To further analyze the impact of
secondary particle sizes on the effects of TiO2 nanomaterials, it would be of interest to investigate the influence of varying pH values on the toxicity and agglomeration behavior of the particles. The pH is known to impact the agglomeration nanoparticles [31] and C. elegans is an ideal test organism for this kind of investigation, as it tolerates a wide range of pH values [32]. Compared to the chronic effects of nano-TiO2 to the soil and sediment organism C.
elegans observed by two studies of Wu et al. [13, 20], the present study indicates much lower toxicities. Here, LOECs of 10 mg/L and 30 mg/L are reported for chronic effects on reproduction and growth, respectively, while Wu and colleagues found LOECs of 0.5 µg/L and 50 µg/L for the respective endpoints. High variations in effect concentrations are described systematically for
ecotoxicological data of ENPs, e.g., by Klaine et al. [33], and mostly attributed to differences in the preparation of the test suspensions or in the test conditions. In the present case, Wu et al. used a different test medium (K-medium) and a much higher energy input for the preparation of the nanoparticle-suspensions, which might change the bioavailability and even the reactivity of the materials dramatically. Nevertheless, the results presented here agree well with earlier acute toxicity studies that detected 24-h LC50 values of 80 mg/L for a 50 nm TiO2 [15] and 77 mg/L for a 25 nm TiO2 [34]. Under dark conditions, neither bulk- nor nano-TiO2 induced the production of reactive
oxygen species or a molecular response to oxidative stress (measured as sod-3 expression). Thus, oxidative stress can be excluded as possible mode of action for TiO2 NPs under dark conditions. Since C. elegans belongs to one of the most abundant species groups present in sediments and
soils, the observed toxic effects are highly relevant for sediments as the main sink for
Accepted Preprint
nanoparticle contamination. Sediment and soil phase testing is needed to further validate the potential risk of TiO2 nanomaterials for the environment. Impact of light on the chronic toxicity of TiO2 particles To assess the impact of natural sunlight on the ecotoxicological effects of nano- and bulk-
TiO2 in the environment, test organisms were irradiated with SSR during the exposure period.
Fig. 3 compares the inhibition of reproduction of C. elegans induced by both TiO2-materials in dark conditions (black bars) with the effects under SSR-exposure (white bars). For bulk-TiO2 (Fig. 3A), SSR did not cause any toxic effects. No inhibition of reproduction or growth was observed under light conditions. Conversely, toxic effects of nano-TiO2 were increased in
combined exposure with SSR (Fig. 3B). At the highest test concentration of 100 mg/L the inhibition of reproduction was increased from 45.1 % ± 2.9 to 81.8 % ± 5.2 and the inhibition of growth was increased from 13.9 %± 2.3 to 34.4 % ± 2.9. As titanium dioxide is photocatalytically active, observed photoactivated effects are expected to be induced by oxidative stress. To verify this hypothesis, the photocatalyic activity of the test materials was determined by measuring the photodegradation of methylene blue under the test conditions. As methylene blue degradation indicated a much higher photocatalytic activity of the nanomaterial in comparison to the bulk material (black dots in Fig. 3), results supported the hypothesis of oxidative stress as the mode of action for the photoactivated toxicity. To test for a molecular biological response to oxidative stress caused by the photo-activated NPs, the mRNA level of superoxide dismutase-3 (sod-3) of exposed organisms was measured. sod-3 is one of five sodgenes in C. elegans and is located in the mitochondria [35]. Therefore, sod-3 is expected to respond exclusively to intracellular generation of ROS. According to the results of this study, nano-TiO2 did not induce any gene regulation of sod-3. Expression of sod-3 was comparable to
the control for all tested concentrations under light and dark conditions (Fig. S1). Accordingly,
Accepted Preprint
no evidence was found for the occurrence of intracellular oxidative stress. This observation leads to the assumption that NPs did not cross the cell membrane. Nevertheless, the observation that SSR increased the toxicity of the highly photoactive nano-TiO2 suggests that ROS play a role in
the photoactivated toxicity of the nanomaterial and effects of oxidative stress could be effective extracellularly. Fig. 3
Ingestion of TiO2 by C. elegans With agglomerate sizes ranging between approximately 300 to 1500 µm, both TiO2
materials were in the size range of preferred food particles of C. elegans [36]. However, C. elegans is also expected to select its food particles not only physically, based on size, but also chemically, based on taste and olfaction [37]. Furthermore it was shown that the presence of metals in the test system can significantly alter particle uptake [38]. Therefore, direct evidence of uptake and translocation of the test particles under the applied test conditions was indispensible for a reliable interpretation of the toxicity data. Fig. 4
In the present study, ingestion of both TiO2-materials to the intestinal tract of C. elegans
was indeed observed by light microscopy for all test concentrations (1 mg/L to 100 mg/L) from exposure times of 4.75 h and more (examples shown for nano-TiO2 in Fig. 4 A-C).
An EDX-mapping of C. elegans exposed to 20 mg/L of nano-TiO2 also provided evidence for the uptake of the element titanium (Fig. 5). As demonstrated by the SEM-image in Fig. 5A, no TiO2 agglomerates were attached to the surface of the test organism and the Ti that was detected
by a deep penetrating EDX-mapping (20 keV) occurred subcutaneously (blue area in Fig. 5B).
Accepted Preprint Fig. 5
Effects of long-term exposure Severe accumulation of nano-TiO2 was still found in the intestine of C. elegans after a
10-d exposure period to TiO2. Consolidated agglomerates of sizes up to 130 µm in diameter were formed, leading to blockages and even deformations of the intestinal tract of exposed organisms (Fig. 6A). In contrast, ingested bulk-TiO2 was distributed evenly in the intestine as fine particles,
and no formation of larger agglomerates was observed (Fig. 6B). Fig. 6
The deviating behavior of the two TiO2-materials could be caused by their physico-
chemical characteristics. First, the applied nano-TiO2 contains the more lipophilic crystalline
form of TiO2, rutile, in addition to anatase. Clément et al. [30] observed that rutile is forming larger agglomerates than the less lipophilic form anatase. Additionally, the total surface area of the loose nanomaterial agglomerates is expected to be higher compared to the bulk material agglomerates, as the surface area of agglomerates almost equates the sum of the single particle surfaces (ISO TS27687 2008). Increased surface area increases particle reactivity, which might also enhance agglomeration on the cell surface. It can be concluded that both, crystalline structure and particle size have a strong impact on the agglomeration behavior of the TiO2-materials in the intestine of the exposed nematodes. A
relationship between the observed behavior of the particles in the intestine and their toxicity is most likely.
Accepted Preprint
Probable mode of action of photoactivated TiO2-NPs toxicity As nano-TiO2 accumulates in the intestine of the transparent test organism, production of
reactive oxygen species (ROS) in the intestine of C. elegans is very likely. Assuming an interaction of nano-TiO2 with the polar intestinal cells surface, it is likely that ROS are produced
by attached particles in close contact with the apical membrane of the intestinal cells. Here they
might cause extracellular oxidative stress including lipid or protein peroxidation [33, 39], leading to disruption of the membranes’ stability and functionality. By disrupting the functionality of the epithelial cells in the intestine of C. elegans, accumulated TiO2 NPs will cause adverse effects on exposed organisms. CONCLUSIONS
This study shows that both nano- and bulk-TiO2 agglomerated in the test medium to
secondary sizes of 300 nm to 1500 nm. Both particle types were ingested by C. elegans, to which nano-TiO2 (P25) was considerably more toxic than the bulk-TiO2 (NM100). Nano- and bulk material differ in their crystalline composition but this cannot explain the higher toxicity of the nanomaterial (bulk-TiO2 contains 98 % of the more toxic anatase, nano-TiO2 contains only 86
%). Nevertheless, crystalline structure may be responsible for the observed differing agglomeration behavior in the intestine (the additional crystal form in the nanomaterial is the more lipophilic rutile). However, agglomerates of a comparable size are expected to have a much higher exposed surface area when composed of nanomaterial. Hence, it was concluded that both primary particle size and indirectly also the crystalline structure are major factors regulating the toxicity of the TiO2 material. This toxicity was further increased when nano-TiO2 was exposed to solar radiation.
Nevertheless, no adverse effects from the photocatalytic activity of nano-TiO2 were observed in
C. elegans tissue, as indicated by negative results for oxidative stress in cells. The plasma
Accepted Preprint
membranes of the intestinal cells themselves, however, would be directly exposed to ROS formation by the nanomaterial in the intestines and are a likely site of inhibitory processes that establish the phototoxic effect of nano-TiO2. SUPPLEMENTAL DATA Tables S1 – S3. Figures S1. (68 KB PDF). Acknowledgment—We would like to thank the Institute TMC at the University of Hamburg for providing the Malvern Zetasizer for the DLS measurements and J. Timmermann of the Technical University Hamburg Harburg for his support with REM-EDX. We are grateful to M. Kottwitz and M. Nielsen for lab assistance and to K. Moshenberg for proofreading this manuscript. Work was partly funded by Pro Exzellenzia. TiO2 test materials were provided by the OECD.
REFERENCES 1.
Kaegi R, Ulrich A, Sinnet B, Vonbank R, Wichser A, Zuleeg S, Simmler H, Brunner S,
Vonmont H, Burkhardt M, Boller M. 2008. Synthetic TiO2 nanoparticle emission from exterior
facades into the aquatic environment. Environ Pollut 156: 233-239. 2.
Gottschalk F, Sonderer T, Scholz RW, Nowack B. 2009. Modeled environmental
concentrations of engineered nanomaterials (TiO2, ZnO, Ag, CNT, Fullerenes) for different
regions. Environ Sci Technol 43: 9216-9222. 3.
Kim JS, Yoon T-J, Yu KN, Kim BG, Park SJ, Kim HW, Lee KH, Park SB, Lee J-K, Cho
MH. 2006. Toxicity and tissue distribution of magnetic nanoparticles in mice. Toxicol Sci 89: 338-347.
Accepted Preprint 4.
Chen J, Dong X, Xin Y, Zhao M. 2011. Effects of titanium dioxide nano-particles on
growth and some histological parameters of zebrafish (Danio rerio) after a long-term exposure. Aquat Toxicol 101: 493-499. 5.
Hoffman AJ, Mills G, Yee H, Hoffmann MR. 1992. Q-sized cadmium sulfide: Synthesis,
characterization, and efficiency of photoinitiation of polymerization of several vinylic monomers. J Phys Chem 96: 5546-5552. 6.
Li Y, Kunitake T, Fujikawa S. 2006. Efficient fabrication and enhanced photocatalytic
activities of 3d-ordered films of titania hollow spheres. J Phys Chem B 110: 13000-13004.
7.
Kahru A, Ivask A. 2012. Mapping the dawn of nanoecotoxicological research. Acc Chem
Res 46: 823-833. 8.
Handy RD, Cornelis G, Fernandes T, Tsyusko O, Decho A, Sabo-Attwood T, Metcalfe C,
Steevens JA, Klaine SJ, Koelmans AA, Horne N. 2012. Ecotoxicity test methods for engineered nanomaterials: Practical experiences and recommendations from the bench. Environ Toxicol Chem 31: 15-31. 9.
Kahru A, Dubourguier H-C. 2010. From ecotoxicology to nanoecotoxicology. Toxicology
269: 105-119. 10.
Baun A, Hartmann NB, Grieger K, Kusk KO. 2008. Ecotoxicity of engineered
nanoparticles to aquatic invertebrates: A brief review and recommendations for future toxicity testing. Ecotoxicology 17: 387-395.
11.
Leung MCK, Williams PL, Benedetto A, Au C, Helmcke KJ, Aschner M, Meyer JN.
2008. Caenorhabditis elegans: An emerging model in biomedical and environmental toxicology. Toxicol Sci 106: 5-28.
Accepted Preprint 12.
Traunspurger W, Haitzer M, Höss S, Beier S, Ahlf W, Steinberg C. 1997.
Ecotoxicological assessment of aquatic sediments with Caenorhabditis elegans (nematoda) - a method for testing liquid medium and whole sediment samples. Environ Toxicol Chem 16: 245250. 13.
Wu Q, Nouara A, Li Y, Zhang M, Wang W, Tang M, Ye B, Ding J, Wang D. 2013.
Comparison of toxicities from three metal oxide nanoparticles at environmental relevant concentrations in nematode Caenorhabditis elegans. Chemosphere 90: 1123-1131. 14.
Roh J-Y, Park Y-K, Park K, Choi J. 2010. Ecotoxicological investigation of CeO2 and
TiO2 nanoparticles on the soil nematode Caenorhabditis elegans using gene expression, growth,
fertility, and survival as endpoints. Environ Toxicol Pharmacol 29: 167-172. 15.
Wang H, Wick RL, Xing B. 2009. Toxicity of nanoparticulate and bulk ZnO, Al2O3 and
TiO2 to the nematode Caenorhabditis elegans. Environ Pollut 157: 1171-1177.
16.
Bigorgne E, Foucaud L, Caillet C, Giambérini L, Nahmani J, Thomas F, Rodius F. 2012.
Cellular and molecular responses of E. fetida cœlomocytes exposed to TiO2 nanoparticles. J
Nanopart Res 14: 1-17. 17.
Ma H, Brennan A, Diamond SA. 2012. Photocatalytic reactive oxygen species production
and phototoxicity of titanium dioxide nanoparticles are dependent on the solar ultraviolet radiation spectrum. Environ Toxicol Chem 31: 2099-2107. 18.
Reeves JF, Davies SJ, Dodd NJF, Jha AN. 2008. Hydroxyl radicals (OH) are associated
with titanium dioxide (TiO2) nanoparticle-induced cytotoxicity and oxidative DNA damage in fish cells. Mutat Res -Fund Mol M 640: 113-122.
Accepted Preprint 19.
Gurr J-R, Wang ASS, Chen C-H, Jan K-Y. 2005. Ultrafine titanium dioxide particles in
the absence of photoactivation can induce oxidative damage to human bronchial epithelial cells. Toxicology 213: 66-73. 20.
Wu Q, Wang W, Li Y, Li Y, Ye B, Tang M, Wang D. 2012. Small sizes of TiO2-NPs
exhibit adverse effects at predicted environmental relevant concentrations on nematodes in a modified chronic toxicity assay system. J Hazard Mater 243: 161-168. 21.
Ma H, Kabengi NJ, Bertsch PM, Unrine JM, Glenn TC, Williams PL. 2011. Comparative
phototoxicity of nanoparticulate and bulk ZnO to a free-living nematode Caenorhabditis elegans: The importance of illumination mode and primary particle size. Environ Pollut 159: 1473-1480. 22.
Nickel C, Angelstorf J, Bienert R, Burkart C, Gabsch S, Giebner S, Haase A, Hellack B,
Hollert H, Hund-Rinke K, Jungmann D, Kaminski H, Luch A, Maes H, Nogowski A, Oetken M, Schaeffer A, Schiwy A, Schlich K, Stintz M, Kammer F, Kuhlbusch TJ. 2014. Dynamic lightscattering measurement comparability of nanomaterial suspensions. J Nanopart Res 16: 1-12.
23.
Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77: 71-94.
24.
Hope IA. 1999. Background on Caenorhabditis elegans. In Hope IA, ed, C. elegans - A
Practical Approach. Oxford University Press, Oxford, New York, US, pp. 1-15. 25.
Johnstone IL. 1999. Molecular biology. In Hope IA, ed, C.elegans - A Practical
Approach. Oxford University Press, Oxford, New York, US, p. 201-225. 26.
Anderson W, Kozak D, Coleman VA, Jämting ÅK, Trau M. 2013. A comparative study
of submicron particle sizing platforms: Accuracy, precision and resolution analysis of polydisperse particle size distributions. J Colloid Interface Sci 405: 322-330.
Accepted Preprint 27.
Schmidt J, Vogelsberger W. 2006. Dissolution kinetics of titanium dioxide nanoparticles:
The observation of an unusual kinetic size effect. J Phys Chem B 110: 3955-3963.
28.
Horst AM, Neal AC, Mielke RE, Sislian PR, Suh WH, Mädler L, Stucky GD, Holden
PA. 2010. Dispersion of TiO2 nanoparticle agglomerates by Pseudomonas aeruginosa. Appl Environ Microbiol 76: 7292-7298. 29.
Pfeiffer J, Johnson D, Nehrke K. 2008. Oscillatory transepithelial H+ flux regulates a
rhythmic behavior in C. elegans. Curr Biol 18: 297-302. 30.
Clément L, Hurel C, Marmier N. 2013. Toxicity of TiO2 nanoparticles to cladocerans,
algae, rotifers and plants – effects of size and crystalline structure. Chemosphere 90: 1083-1090.
31.
Handy RD, van den Brink N, Chappell M, Mühling M, Behra R, Dušinská M, Simpson P,
Ahtiainen J, Jha A, Seiter J, Bednar A, Kennedy A, Fernandes T, Riediker M. 2012. Practical considerations for conducting ecotoxicity test methods with manufactured nanomaterials: What have we learnt so far? Ecotoxicology 21: 933-972.
32.
Khanna N, Cressman III CP, Tatara CP, Williams PL. 1997. Tolerance of the nematode
Caenorhabditis elegans to ph, salinity, and hardness in aquatic media. Arch Environ Contam Toxicol 32: 110-114. 33.
Klaine SJ, Alvarez PJJ, Batley GE, Fernandes TF, Handy RD, Lyon DY, Mahendra S,
McLaughlin MJ, Lead JR. 2008. Nanomaterials in the environment: Behavior, fate, bioavailability, and effects. Environ Toxicol Chem 27: 1825-1851. 34.
Khare P, Sonane M, Pandey R, Ali S, Gupta KC, Satish A. 2011. Adverse effects of TiO2
and ZnO nanoparticles in soil nematode, Caenorhabditis elegans. J Biomed Nanotech 7: 116117.
Accepted Preprint 35.
Johnston AD, Ebert PR. 2012. The redox system in C. elegans, a phylogenetic approach.
J Toxicol 2012: 1-20. 36.
Fang-Yen C, Avery L, Samuel ADT. 2009. Two size-selective mechanisms specifically
trap bacteria-sized food particles in Caenorhabditis elegans. Proc Natl Acad Sci 106: 2009320096. 37.
Kiyama Y, Miyahara K, Ohshima Y. 2012. Active uptake of artificial particles in the
nematode Caenorhabditis elegans. J Exp Biol 215: 1178-1183. 38.
Boyd WA, Cole RD, Anderson GL, Williams PL. 2003. The effects of metals and food
availability on the behavior of Caenorhabditis elegans. Environ Toxicol Chem 22: 3049-3055. 39.
Cabiscol E, Tamarit J, Ros J. 2000. Oxidative stress in bacteria and protein damage by
reactive oxygen species. Int Microbiol 3: 3-8.
Figure 1. Scanning electron microscopy images of (A) bulk- and (B) nano-TiO2 suspensions
trapped on polycarbonate filter, covered with a 6 nm gold layer. Magnification: 20,000, detector: In-Lense, EHT: 5 keV (Structures in the background of image B are the pores of the polycarbonate filter). Figure 2. Inhibition of reproduction of C. elegans exposed to TiO2 [mean inhibition and SD in %, n = 4] and particle size as hydrodynamic diameter gained by dynamic light scattering [mean size and SD in nm based on intensity means, n = 6 x 10]; A: bulk-TiO2 (NM100) and B: nano-
TiO2 (P25). p-Values **
Original Article
IMPACT OF PARTICLE SIZE AND LIGHT EXPOSURE ON THE EFFECTS OF TIO2 NANOPARTICLES ON CAENORHABDITIS ELEGANS
JUDITH S. ANGELSTORF, WOLFGANG AHLF, FRANK VON DER KAMMER, and SUSANNE HEISE
Environ Toxicol Chem., Accepted Article • DOI: 10.1002/etc.2674
Accepted Article "Accepted Articles" are peer-reviewed, accepted manuscripts that have not been edited, formatted, or in any way altered by the authors since acceptance. They are citable by the Digital Object Identifier (DOI). After the manuscript is edited and formatted, it will be removed from the “Accepted Articles” Web site and published as an Early View article. Note that editing may introduce changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. SETAC cannot be held responsible for errors or consequences arising from the use of information contained in these manuscripts.
Accepted Preprint
Original Article
Environmental Toxicology and Chemistry DOI 10.1002/etc.2674
IMPACT OF PARTICLE SIZE AND LIGHT EXPOSURE ON THE EFFECTS OF TIO2 NANOPARTICLES ON CAENORHABDITIS ELEGANS
Running title: Light exposure increases nano-TiO2 toxicity
JUDITH S. ANGELSTORF,† WOLFGANG AHLF,‡ FRANK VON DER KAMMER,§ and SUSANNE HEISE†
† Hamburg University of Applied Sciences, Hamburg, Germany
‡ Institute of Environmental Technology and Energy Economics, University of Technology, Hamburg, Germany
§ Department of Environmental Geosciences, University of Vienna, Vienna, Austria.
*Address correspondence to [email protected]
Additional Supporting Information may be found in the online version of this article.
© 2014 SETAC Submitted 14 January 2014; Returned for Revision 13 June 2014; Accepted 13 June 2014
Accepted Preprint
Abstract: The increasing use of engineered nanoparticles in industrial and consumer products leads to a release of the anthropogenic contaminants to the aquatic environment. To obtain a better understanding of the environmental effects of these particles, the nematode Caenorhabditis elegans was used to investigate the organism-level effects and in vivo molecular
responses. Toxicity of bulk-scale (~160 nm) and nano-scale (21 nm) titanium dioxide (TiO2) was tested under dark and light conditions, following ISO 10872. The expression of sod-3, a mitochondrial superoxide dismutase, was quantified as an indicator for oxidative stress induced by the photocatalytically active material. Particle sizes were estimated using dynamic light scattering and scanning electron microscopy. While both materials agglomerated to a comparable secondary particle size of 300 to 1500 nm and were ingested into the intestine, only nano-TiO2
significantly inhibited reproduction (lowest-observed-effect-concentration: 10 mg/L). Light exposure induced the production of reactive oxygen species by nano-TiO2 and increased toxicity
of the nanomaterial from a median effect concentration of more than 100 mg/L to 53 mg/L. No evidence was found for inner cellular photocatalytic activity of nano-TiO2. Therefore, oxidative damage of the membranes of intestinal cells is suggested as a potential mode of action. Results highlight the importance of primary particle size and environmental parameters on the toxicity of TiO2.
Keywords: TiO2-nanoparticles, Toxicity, Caenorhabditis elegans, Photoactivated effects
Accepted Preprint
INTRODUCTION
Engineered nanoparticles (ENPs) are increasingly used in a variety of industrial and
consumer products and can be released to the aquatic environment, e.g., by urban runoff [1]. By modeling environmental emissions of nanoscale titanium dioxide (nano-TiO2), Gottschalk et al. identified sediments as main sink for the anthropogenic contaminants and predicted nano-TiO2
accumulation rates up to 1.4 mg/kg per year (Q0.85 for European sediments) [2]. Nanoparticles pose a higher risk to the exposed environment relative to their bulk-scale counterparts, because their small size (< 100 nm) enables them to penetrate organisms and cells [3, 4]. In addition, their increased surface area generally increases their reactivity. TiO2-particles are assumed to exhibit
higher photocatalytic activity in the nanoparticulate form, as this property strongly depends on the accessibility of the particles’ surface to the environment [5, 6]. Though the number of publications characterizing the ecotoxicological effects of ENPs
are steadily increasing, potential effects of ENPs on the environment are still poorly understood [7, 8]. According to Kahru and Dubourguier, TiO2 nanoparticles are classified as “harmful”, affecting algae and invertebrates with lethal or effect concentrations of 10 to 100 mg/L in liquid test systems [9]. Baun et al. reported similar effect ranges for invertebrates and identified Daphnia magna as the most commonly used test organism when evaluating nanoparticle toxicity [10]. Based on their review, Baun et al. recommended focusing on chronic endpoints for future nanomaterial testing. In the present study, the nematode Caenorhabditis elegans was used to determine chronic
toxicological effects and possible modes of action of TiO2 nanoparticles under light and dark
conditions. C. elegans is considered an excellent test organism to evaluate toxicological effects and mechanisms as they enable both the detection of organism-level endpoints like feeding,
Accepted Preprint
growth and reproduction, as well as the analysis of molecular responses (e.g., stress responses) to the chemical exposure in vivo. Furthermore, C. elegans are of high environmental relevance; nematodes are one of the most abundant and diverse species within the metazoan groups, and they play a key role in nutrient cycling and maintaining the environmental quality of terrestrial and benthic ecosystems [11]. C. elegans is used as an endobenthic test organism for the evaluation of contaminated
soils and sediments with the distinct advantage that it is applicable to sediment, soil and liquid phase testing [12]. Liquid phase testing using C. elegans meets two key requirements in nanoparticle research: simultaneous testing of a soil and sediment organism, and proper characterization of nanoparticles in the test medium. Due to its transparent body, C. elegans
offers the ability to analyze nanoparticle uptake and translocation in the gastrointestinal tract, which delivers information crucial to understanding the particles’ behavior and mode of action. Amongst the few existing studies on the effects of different TiO2 nanoparticles (TiO2
NPs) on C. elegans, reported effect concentrations vary greatly; published values range from 0.5 µg/L for reproduction [13], to 1 mg/L for fertility [14], and 47.9 mg/L for reproduction [15]. Regarding possible modes of action of TiO2 NPs , Bigorgne et al. [16] reported an increased expression of metallothionein for Eisenia fetida coelomocytes, indicating increased metal detoxification. However, this molecular response could not be observed in vivo for C. elegans [14]. Another possible mode of action is the induction of oxidative stress by the production of reactive oxygen species (ROS). This process is well understood for photocatalytic materials like TiO2 under UV-exposure, and has been shown to adversely affect invertebrates [17].
Additionally, even in the absence of light, TiO2 NPs can cause oxidative damage to cell structures such as DNA and lipids in in vitro experiments using different cell lines [18, 19]. An
Accepted Preprint
in vivo study on C. elegans supports this suggested mode of action for the nematode. The authors found a significant correlation between growth, reproduction and movement behavior of the nematode with the observed ROS production resulting from an exposure to TiO2 NPs [20]. The
impact of light exposure on this photocatalytic effects has been studied for C. elegans using ZnO
nanoparticles as another photocatalytically active material. Results provide evidence for an increased phototoxicity that was closely related to the observed ROS production [21]. The present study compares the agglomeration behavior and toxicological effects of a
nano-scale TiO2 (P25, 21 nm) and a bulk-scale TiO2 (NM100, 90 – 230 nm) on the nematode C. elegans with the objective of evaluating the importance of primary particle size, as nominal particle size of a single particle, and secondary particle size, as agglomerate size in the test medium. The terms primary and secondary particle size are defined as single source particles and their agglomerates according to ISO TS27687 2008. To study oxidative stress as a possible mode of action under light and dark conditions, ROS production of the two TiO2 test materials was determined in the test systems. Expression of a superoxide dismutase (sod-3) by C. elegans
indicated the molecular response to the potential oxidative stress induced by ROS during TiO2 exposure. The experiments were designed to answer the following questions: A) Does particle size
affect the toxicity of TiO2 particles? And B) What impact does sunlight has on the toxicity of photocatalytically active nanoparticles?
MATERIALS AND METHODS
Test materials The TiO2 nanomaterial P25 AEROXIDE® (Evonik-Degussa, Essen, Germany) consists
of 86 % anatase and of 14 % rutile. It has a primary particle size of 21 nm and a surface area of 50 ± 15 m2/g (BET) (all data provided by the manufacturer). The bulk material NM100
Accepted Preprint
(Millenium Inorganic Chemicals, Cockeysville, USA) consists of 98 % anatase and has a surface area 10 m2/g (BET) (data provided by the manufacturer). Its primary particle size was measured
by scanning electron microscopy using a Leo Gemini 1530 (Zeiss, Oberkochen, Germany) and showed a particle size of 90 to 230 nm. Both materials were provided and characterized by the Joint Research Center (JRC) as batch-materials of the "Sponsorship Programme for the Testing of Manufactured Nanomaterials" carried out by the Organisation for Economic Co-operation and Development (OECD). All other substances used were purchased from Carl Roth, Merck and Sigma Aldrich, Germany. Preparation and characterization of the test-suspensions TiO2-materials were dispersed in ultrapure water (pH of 6.75, conductivity < 0.055
µS/cm, TOC < 10 µg/kg) using magnetic stirring (900 rpm for 1 min) and sonication (ultrasonic bath, 5 min, 320 W). Test-suspensions were prepared double concentrated and diluted to the final test concentration by the addition of nutrient medium M9. To validate the standard operating procedure of the dispersion method, particle characterization was carried out for all test concentrations in the test suspensions dispersed in ultrapure water. To determine the characteristics of the secondary particles in the test medium, the same characterization procedure was carried out after addition of the test suspension to the test medium M9 for all test concentrations. To avoid any disturbance of the size measurement by other particles, characterization was performed in the absence of food bacteria. The characterization comprised determination of mean particle size, particle size
distribution, poly-dispersity-index (PDI) and zeta-potential by dynamic light scattering (DLS) using a Malvern Zetasizer Nano ZS. DLS measurement was performed according to the test protocol of Nickel et al. [22]. For qualitative validation of the DLS results, scanning electron microscopy (SEM) of the suspended particles was applied for all test concentrations. To image
Accepted Preprint
the particles, suspensions were filtered onto polycarbonate filters with a pore size of 0.03 µm and 0.1 µm for nano-TiO2 and bulk-TiO2, respectively. Filters were dried, sputter coated with a 6 nm
layer of gold and scattered in high vacuum using a Leo Gemini 1530 (Zeiss, Oberkochen, Germany) using a voltage of 5 keV and a magnification of 20,000. Particle sizes were measured for at least 140 particles per concentration using the software Scandium (Zeiss). To further validate the efficiency and the reproducibility of the standard operating procedure, TiO2 concentrations were determined in the test-system (test suspension + M9 medium without bacteria) for each test concentration (for three independently dispersed replicates per concentration) by inductively coupled plasma optical emission spectrometry (PE-Optima 7000 DV OES with ICP, Perkin Elmer, Waltham, Massachusetts, USA) following an extraction with HNO3/HF/H2O. Photocatalytic activity Photocatalytic activity of nano- and bulk material was compared by methylene blue degradation as an indicator of the generation of reactive oxygen species (ROS). Methylene blue (final concentration of 12.5 mg/L) was added to TiO2 suspensions of each test concentration. Light absorption was measured at a wavelength of 663 nm (absorption maxima of the samples at t0) after 30 min of irradiation (intensity of 231 W/m2) by using a UV-1800 240 V IVDD
photometer, Shimadzu (Nakagyo-ku, Kyōto, Japan). Degradation of methylene blue after 30 min
was calculated as percentage of degradation in a non-irradiated control. Irradiation Simulated solar radiation (SSR) was generated by a weathering chamber (Q-Sun Xe - 1-B, Q-Labs Deutschland) equipped with a Chiller and a daylight filter (Daylight Q, Q-Labs Deutschland). Light intensity was adjusted to 231 W/m2 at a wavelength of 300 to 800 nm, temperature was regulated at 19.2°C ± 1.6. For all SSR-treatments, samples were irradiated for
Accepted Preprint
30 min, 4 h after the start of the test (introduction of the test organisms). To minimize evaporation of the test suspension to 2.1 % ± 0.7, samples were covered by 3 mm ± 0.3 quartz glass (EN08) purchased from Aachener Quarz - Glas Technologie Heinrich (Aachen, Germany). Chronic bioassay with C. elegans The test organism C. elegans wildtype ‘Maupus, N2 var. Bristol’ was purchased from the Caenorhabditis Genetics Center (CGC) and maintained on nematode growth medium (NGM) agar plates [23] with a bacterial lawn of Escherichia coli, (OP50 strain, CGC) serving as food source according to ISO 10872. To test for the chronic effects of the TiO2-materials, L1 larvae
(approx. 200 µm in length) of C. elegans were exposed to the test materials for 96 h according to
the standard bioassay ISO 10872. Deviating from the ISO-norm, 20 mL quartz-glass vessels (DURAN®, Carl Roth) were used instead of 12 well multi dishes. Therefore, the test-volume was adapted to 2.5 mL according to the surface/volume ratio of the test solution in the 12 well plates. All tests were realized in the liquid phase consisting of 50 % test-suspension and 50 % growth medium. The growth medium M9 has a total ionic strength of 443 mmol/L (42 mM of Na2HPO4, 22 mM of KH2PO4, 86 mM of NaCl and 1 mM MgSO4 x 7 H2O) and contains Escherichia coli bacteria serving as food source (optical density of 1000 ± 50 FAU (formazine attenuation units)) and 0.2 v/v % of cholesterol. Ecotoxicity: Experimental set up and endpoints Both TiO2-materials were tested at concentrations of 1, 3, 10, 30, and 100 mg/L in
darkness as well as in combined exposure with simulated solar irradiation. For each treatment, four replicates were run with 10 individuals per replicate (4 x 10 = 40 individuals per treatment). For each test, a negative control was run by using ultrapure water as test-substance. The pH of the test system was 7. As ecotoxicological endpoints, growth (increase in length in µm) and
Accepted Preprint
reproduction (number of offspring) were determined after 96 h of exposure. Inhibition of the exposed organisms was calculated in relation to the correspondent control group. Ingestion of TiO2 particles by C. elegans Uptake of TiO2 particles by C. elegans was observed by light microscopy (Olympus BX
41 TF). The transparent test organisms were exposed to the TiO2 particles for exposure times
ranging from 4.75 h to 10 d. Organisms were anesthetized by 0.5 % 1-phenoxy-2-propanol for light microscopic imaging. Scanning electron microscopy and energy dispersive X-ray spectroscopy (SEM-EDX) was applied to prove the ingestion of TiO2 by C. elegans after
exposure. For the SEM analysis, exposed test organisms were fixed with glutaraldehyde and transferred to amyl acetate via an ethanol dilution series to reach complete dehydration before supercritical drying of the nematodes was performed. After sputter coating with 10 nm of gold, an EDX-mapping was performed using a voltage of 20 keV with a Leo Gemini 1530 equipped with EDX. Molecular response: sod-3-expression sod-3, a mitochondrial superoxide dismutase, indicates intracellular oxidative stress. Its expression was measured by quantitative real-time PCR (qRT-PCR). Prior and subsequent to the exposure of C. elegans to different concentrations of nano-TiO2 for 6 h under light and dark conditions, the test organisms were washed by floating on sucrose (60 %) according to Hope [24] to avoid contamination with E.coli bacteria. The worm pellet was frozen on liquid nitrogen and kept at -70°C. Total RNA was extracted by using RNeasy Kits (Qiagen, Venlo, Netherlands) according to the manufacturer’s instruction. To increase the efficiency of the RNA extraction, the samples were pestled and passed through a 22 gauge needle according to Johnstone [25].To avoid contamination with DNA, RNA samples were digested with DNAse I for 15 min at room temperature. First-strand cDNA synthesis was carried out using the RevertAid Premium Enzyme
Accepted Preprint
Mix, 5xRT buffer, dNTP mix, oligo dT and Random Hexamer Primer as recommended by the manufacturer (Fermentas, Thermo Fisher Scientific, Waltham, Massachusetts, USA). For quantification of the amount of sod-3 mRNA, a quantitative real-time polymerase chain reaction
(qRT-PCR) was carried out using Maxima SYBR Green qPCR Master Mix without the passive reference dye ROX. All PCR measurements were performed by a Biorad iQ™5 Multicolor RealTime PCR Detection System equipped with an iCycler under the following conditions: 95 °C for 10 min (one cycle), 95°C for 15 sec and 60°C for 60 sec (35 cycles) and 55°C to 95°C in 0.5°C steps for 10 sec (85 cycles). The efficiency of the PCR was determined by measuring the amplification of a serial dilution of the cDNA for one sample in each run. The level of sod-3 mRNA was normalized to the mRNA level of the act-1 as an endogenous reference gene. To
amplify sod-3 cDNA the following specific primer pair was chosen: AATGCTGCAATCTACTGCTCGCA and GTGTGCTTGGAGCGGACGGC (167 base pairs). To amplify the act-1 gene the specific primer pair CCCCACCAGAGCGCAAGTACTCCGTCT and TGTTGGAAGGTGGAGAGGGAAGCG (70 base pairs) was used. The quantity of the target mRNA was calculated by the efficiency-corrected ΔΔCT method and the quantity of sod-3 mRNA in exposed nematodes was expressed in relation to non-exposed nematodes. Statistics All data were expressed as mean ± standard deviation (SD). All statistics were calculated using Graph Pad Prism 5. For the chronic toxicity test, four replicates were performed with ten individuals per replicate for each treatment. To test for normal distribution, a KolmogorovSmirnov-Test was run. To evaluate statistical significance between treatments, a one-way Analysis of Variance (ANOVA) at α = 0.05, with Dunnett/Bonferroni post hoc multiple
comparison tests was used. The median effective concentration values (EC50) were calculated of log10 transformed inhibition values using a non-linear regression with variable slope. For the
Accepted Preprint
analysis of the gene expression of sod-3, three replicates were run and a one-way ANOVA at α =
0.05 with post-hoc Dunnett's test was calculated. RESULTS AND DISCUSSION
Characteristics and behavior of secondary TiO2-particles in the test system According to DLS analyses, both nano- and bulk-TiO2 particles agglomerated in the M9-
medium to comparable mean secondary particle sizes from about 300 nm at 1 mg/L up to 1500 nm at 100 mg/L. For both test-materials, particle sizes increased within the test system (M9 medium) with increasing concentrations (Table 1). Table S1 (supplemental data) displays much lower particle sizes in ultrapure water, directly before the introduction of the stock suspensions into the test system. A test simulation showed that no further increase in particle sizes occurred for nano-TiO2 during a test period of 96 h (Table S3). However, agglomerates settled visibly within the first 24 h, leading to an increased exposure of the test organisms located at the
bottoms of test vessels. Table 1 Table 2 Fig. 1
Figure 1 shows an example of the SEM images for bulk-TiO2 (Fig. 1A) and nano-TiO2
(Fig. 1B). Compared to the DLS results, agglomeration of TiO2 in M9 was less distinct according to the SEM-analysis. Mean particle sizes ranged from 303 nm to 504 nm for nano-TiO2 and from
309 nm to 702 nm for bulk-TiO2 in M9 medium (Table 2) and were comparable to the particle sizes in water (Table S2). No clear relation was observed between concentration and particle size. The larger particle sizes detected by DLS measurements might simply be caused by the methodical limitations of the DLS applied to polydisperse suspensions. DLS is known to be inherently sensitive to the presence of larger particles in a sample, resulting in an over-estimation
Accepted Preprint
of the mean diameter in polydisperse suspensions [26]. Another reason for the detection of lower particle sizes by SEM imaging could be the preparation procedure of the samples: after 1 mL of suspension was trapped on the filter, 1 mL of H2O was used to rinse off salts originating from the medium M9. This procedure might have caused a separation of loose agglomerates, forming several smaller particles. As this kind of separation processes might also occur within the test system (e.g., in the intestinal tract of the organism), particle sizes gained by SEM are regarded as physiologically relevant. Table S3 displays the particle sizes in ultrapure water before the introduction to the test system. Mean ζ-potentials in M9 medium were at -25.39 ± 6.94 mV and -28.54 ± 3.4 mV for
nano- and bulk TiO2, respectively (data not shown). Thus, both types of particles are negatively charged and have the potential to interact with positively charged ions or molecules in the test system. Recovery of TiO2 from the test-system after dispersion and introduction according to the
standard operation procedure was 103 % ± 7.4 for nano-TiO2 and 103 % ± 9.5 for bulk-TiO2. TiO2 is expected to be stable in the test system at pH 7, as Schmidt and Vogelsberger did not
measure any dissolved titanium from P25 at pH 4 or higher [27]. Impact of particle size on chronic toxicity The nematode test first done at 1, 3, 10, and 30 mg nano-TiO2/L was repeated three times
(using four replicates with ten individuals per test) to determine the toxicity of nano-TiO2 and the
range of variation. The most sensitive endpoint was reproduction with a no observed effect concentration (NOEC) of 3 mg/L. For growth the NOEC was 10 mg/L. The lowest-observedeffect concentration (LOEC) for reproduction was 10 mg/L, showing a significant inhibition of 20.8 % ± 11.8 (p < 0.05) compared to the control group. The LOEC for growth was 30 mg/L, with a significant inhibition of 6.4 % ± 2.0 (p < 0.001) compared to controls. Reproduction was inhibited about 39.1 % ± 11.8 (p < 0.001) (data not shown). According to the Kolmogorov-
Accepted Preprint
Smirnov-Test, data were normally distributed, and the highest SD observed was 11.8 %. To test the impact of particle size on the effects of TiO2-particles, toxicity of nano-TiO2 (nominal particle size of 21 nm) was compared to a bulk-TiO2 (mean nominal particle size of 160 nm) in the following experiment. As previously described and illustrated in Fig. 2A, both materials agglomerated in the test system to a comparable particle size of up to 1500 nm for the highest test concentration of 100 mg/L. Nevertheless, bulk-TiO2 did not cause any significant change in
the number of offspring (reproduction) or the increase in body length (growth) of C. elegans
during 96 h of exposure to up to 100 mg/L, while nano-TiO2 inhibited reproduction and growth significantly (Fig. 2B). At 100 mg/L growth and reproduction were inhibited approximately by 13.9 % ± 2.3 and 45.1 % ± 2.9 in percent of the control, respectively. Fig. 2
This observation leads to the conclusion that the secondary particle size is not the crucial
parameter for the observed toxicity of TiO2-particles: while both materials showed similar
secondary particle sizes, the nanomaterial was significantly more toxic to the test organism than the bulk material. As the SEM analysis of the secondary particles indicated that the agglomerates were only weakly bound, it is likely that agglomerates can disaggregate in the test system. This process could even be induced by natural surfactants in the intestine of the test organism. A similar particle stabilizing effect was observed for exopolymers of bacteria [28]. Furthermore, the pH in the intestine of C. elegans, which oscillates between 6.2 and 7.6 [29], can alter the
particle size in the test organism. In terms of the crystalline structure of the different materials, a higher toxicity was expected for the bulk material NM100. NM100 consists of 98 % anatase, which is the more toxic crystalline form of TiO2 compared to rutile [30]. In contrast, the nanomaterial P25 contains 14 % of the less toxic form rutile. For this reason, primary particle
Accepted Preprint
size was identified as the characteristic variable most likely correlated with increased toxicity of the nano-TiO2 P25 in comparison to the bulk material NM100. To further analyze the impact of
secondary particle sizes on the effects of TiO2 nanomaterials, it would be of interest to investigate the influence of varying pH values on the toxicity and agglomeration behavior of the particles. The pH is known to impact the agglomeration nanoparticles [31] and C. elegans is an ideal test organism for this kind of investigation, as it tolerates a wide range of pH values [32]. Compared to the chronic effects of nano-TiO2 to the soil and sediment organism C.
elegans observed by two studies of Wu et al. [13, 20], the present study indicates much lower toxicities. Here, LOECs of 10 mg/L and 30 mg/L are reported for chronic effects on reproduction and growth, respectively, while Wu and colleagues found LOECs of 0.5 µg/L and 50 µg/L for the respective endpoints. High variations in effect concentrations are described systematically for
ecotoxicological data of ENPs, e.g., by Klaine et al. [33], and mostly attributed to differences in the preparation of the test suspensions or in the test conditions. In the present case, Wu et al. used a different test medium (K-medium) and a much higher energy input for the preparation of the nanoparticle-suspensions, which might change the bioavailability and even the reactivity of the materials dramatically. Nevertheless, the results presented here agree well with earlier acute toxicity studies that detected 24-h LC50 values of 80 mg/L for a 50 nm TiO2 [15] and 77 mg/L for a 25 nm TiO2 [34]. Under dark conditions, neither bulk- nor nano-TiO2 induced the production of reactive
oxygen species or a molecular response to oxidative stress (measured as sod-3 expression). Thus, oxidative stress can be excluded as possible mode of action for TiO2 NPs under dark conditions. Since C. elegans belongs to one of the most abundant species groups present in sediments and
soils, the observed toxic effects are highly relevant for sediments as the main sink for
Accepted Preprint
nanoparticle contamination. Sediment and soil phase testing is needed to further validate the potential risk of TiO2 nanomaterials for the environment. Impact of light on the chronic toxicity of TiO2 particles To assess the impact of natural sunlight on the ecotoxicological effects of nano- and bulk-
TiO2 in the environment, test organisms were irradiated with SSR during the exposure period.
Fig. 3 compares the inhibition of reproduction of C. elegans induced by both TiO2-materials in dark conditions (black bars) with the effects under SSR-exposure (white bars). For bulk-TiO2 (Fig. 3A), SSR did not cause any toxic effects. No inhibition of reproduction or growth was observed under light conditions. Conversely, toxic effects of nano-TiO2 were increased in
combined exposure with SSR (Fig. 3B). At the highest test concentration of 100 mg/L the inhibition of reproduction was increased from 45.1 % ± 2.9 to 81.8 % ± 5.2 and the inhibition of growth was increased from 13.9 %± 2.3 to 34.4 % ± 2.9. As titanium dioxide is photocatalytically active, observed photoactivated effects are expected to be induced by oxidative stress. To verify this hypothesis, the photocatalyic activity of the test materials was determined by measuring the photodegradation of methylene blue under the test conditions. As methylene blue degradation indicated a much higher photocatalytic activity of the nanomaterial in comparison to the bulk material (black dots in Fig. 3), results supported the hypothesis of oxidative stress as the mode of action for the photoactivated toxicity. To test for a molecular biological response to oxidative stress caused by the photo-activated NPs, the mRNA level of superoxide dismutase-3 (sod-3) of exposed organisms was measured. sod-3 is one of five sodgenes in C. elegans and is located in the mitochondria [35]. Therefore, sod-3 is expected to respond exclusively to intracellular generation of ROS. According to the results of this study, nano-TiO2 did not induce any gene regulation of sod-3. Expression of sod-3 was comparable to
the control for all tested concentrations under light and dark conditions (Fig. S1). Accordingly,
Accepted Preprint
no evidence was found for the occurrence of intracellular oxidative stress. This observation leads to the assumption that NPs did not cross the cell membrane. Nevertheless, the observation that SSR increased the toxicity of the highly photoactive nano-TiO2 suggests that ROS play a role in
the photoactivated toxicity of the nanomaterial and effects of oxidative stress could be effective extracellularly. Fig. 3
Ingestion of TiO2 by C. elegans With agglomerate sizes ranging between approximately 300 to 1500 µm, both TiO2
materials were in the size range of preferred food particles of C. elegans [36]. However, C. elegans is also expected to select its food particles not only physically, based on size, but also chemically, based on taste and olfaction [37]. Furthermore it was shown that the presence of metals in the test system can significantly alter particle uptake [38]. Therefore, direct evidence of uptake and translocation of the test particles under the applied test conditions was indispensible for a reliable interpretation of the toxicity data. Fig. 4
In the present study, ingestion of both TiO2-materials to the intestinal tract of C. elegans
was indeed observed by light microscopy for all test concentrations (1 mg/L to 100 mg/L) from exposure times of 4.75 h and more (examples shown for nano-TiO2 in Fig. 4 A-C).
An EDX-mapping of C. elegans exposed to 20 mg/L of nano-TiO2 also provided evidence for the uptake of the element titanium (Fig. 5). As demonstrated by the SEM-image in Fig. 5A, no TiO2 agglomerates were attached to the surface of the test organism and the Ti that was detected
by a deep penetrating EDX-mapping (20 keV) occurred subcutaneously (blue area in Fig. 5B).
Accepted Preprint Fig. 5
Effects of long-term exposure Severe accumulation of nano-TiO2 was still found in the intestine of C. elegans after a
10-d exposure period to TiO2. Consolidated agglomerates of sizes up to 130 µm in diameter were formed, leading to blockages and even deformations of the intestinal tract of exposed organisms (Fig. 6A). In contrast, ingested bulk-TiO2 was distributed evenly in the intestine as fine particles,
and no formation of larger agglomerates was observed (Fig. 6B). Fig. 6
The deviating behavior of the two TiO2-materials could be caused by their physico-
chemical characteristics. First, the applied nano-TiO2 contains the more lipophilic crystalline
form of TiO2, rutile, in addition to anatase. Clément et al. [30] observed that rutile is forming larger agglomerates than the less lipophilic form anatase. Additionally, the total surface area of the loose nanomaterial agglomerates is expected to be higher compared to the bulk material agglomerates, as the surface area of agglomerates almost equates the sum of the single particle surfaces (ISO TS27687 2008). Increased surface area increases particle reactivity, which might also enhance agglomeration on the cell surface. It can be concluded that both, crystalline structure and particle size have a strong impact on the agglomeration behavior of the TiO2-materials in the intestine of the exposed nematodes. A
relationship between the observed behavior of the particles in the intestine and their toxicity is most likely.
Accepted Preprint
Probable mode of action of photoactivated TiO2-NPs toxicity As nano-TiO2 accumulates in the intestine of the transparent test organism, production of
reactive oxygen species (ROS) in the intestine of C. elegans is very likely. Assuming an interaction of nano-TiO2 with the polar intestinal cells surface, it is likely that ROS are produced
by attached particles in close contact with the apical membrane of the intestinal cells. Here they
might cause extracellular oxidative stress including lipid or protein peroxidation [33, 39], leading to disruption of the membranes’ stability and functionality. By disrupting the functionality of the epithelial cells in the intestine of C. elegans, accumulated TiO2 NPs will cause adverse effects on exposed organisms. CONCLUSIONS
This study shows that both nano- and bulk-TiO2 agglomerated in the test medium to
secondary sizes of 300 nm to 1500 nm. Both particle types were ingested by C. elegans, to which nano-TiO2 (P25) was considerably more toxic than the bulk-TiO2 (NM100). Nano- and bulk material differ in their crystalline composition but this cannot explain the higher toxicity of the nanomaterial (bulk-TiO2 contains 98 % of the more toxic anatase, nano-TiO2 contains only 86
%). Nevertheless, crystalline structure may be responsible for the observed differing agglomeration behavior in the intestine (the additional crystal form in the nanomaterial is the more lipophilic rutile). However, agglomerates of a comparable size are expected to have a much higher exposed surface area when composed of nanomaterial. Hence, it was concluded that both primary particle size and indirectly also the crystalline structure are major factors regulating the toxicity of the TiO2 material. This toxicity was further increased when nano-TiO2 was exposed to solar radiation.
Nevertheless, no adverse effects from the photocatalytic activity of nano-TiO2 were observed in
C. elegans tissue, as indicated by negative results for oxidative stress in cells. The plasma
Accepted Preprint
membranes of the intestinal cells themselves, however, would be directly exposed to ROS formation by the nanomaterial in the intestines and are a likely site of inhibitory processes that establish the phototoxic effect of nano-TiO2. SUPPLEMENTAL DATA Tables S1 – S3. Figures S1. (68 KB PDF). Acknowledgment—We would like to thank the Institute TMC at the University of Hamburg for providing the Malvern Zetasizer for the DLS measurements and J. Timmermann of the Technical University Hamburg Harburg for his support with REM-EDX. We are grateful to M. Kottwitz and M. Nielsen for lab assistance and to K. Moshenberg for proofreading this manuscript. Work was partly funded by Pro Exzellenzia. TiO2 test materials were provided by the OECD.
REFERENCES 1.
Kaegi R, Ulrich A, Sinnet B, Vonbank R, Wichser A, Zuleeg S, Simmler H, Brunner S,
Vonmont H, Burkhardt M, Boller M. 2008. Synthetic TiO2 nanoparticle emission from exterior
facades into the aquatic environment. Environ Pollut 156: 233-239. 2.
Gottschalk F, Sonderer T, Scholz RW, Nowack B. 2009. Modeled environmental
concentrations of engineered nanomaterials (TiO2, ZnO, Ag, CNT, Fullerenes) for different
regions. Environ Sci Technol 43: 9216-9222. 3.
Kim JS, Yoon T-J, Yu KN, Kim BG, Park SJ, Kim HW, Lee KH, Park SB, Lee J-K, Cho
MH. 2006. Toxicity and tissue distribution of magnetic nanoparticles in mice. Toxicol Sci 89: 338-347.
Accepted Preprint 4.
Chen J, Dong X, Xin Y, Zhao M. 2011. Effects of titanium dioxide nano-particles on
growth and some histological parameters of zebrafish (Danio rerio) after a long-term exposure. Aquat Toxicol 101: 493-499. 5.
Hoffman AJ, Mills G, Yee H, Hoffmann MR. 1992. Q-sized cadmium sulfide: Synthesis,
characterization, and efficiency of photoinitiation of polymerization of several vinylic monomers. J Phys Chem 96: 5546-5552. 6.
Li Y, Kunitake T, Fujikawa S. 2006. Efficient fabrication and enhanced photocatalytic
activities of 3d-ordered films of titania hollow spheres. J Phys Chem B 110: 13000-13004.
7.
Kahru A, Ivask A. 2012. Mapping the dawn of nanoecotoxicological research. Acc Chem
Res 46: 823-833. 8.
Handy RD, Cornelis G, Fernandes T, Tsyusko O, Decho A, Sabo-Attwood T, Metcalfe C,
Steevens JA, Klaine SJ, Koelmans AA, Horne N. 2012. Ecotoxicity test methods for engineered nanomaterials: Practical experiences and recommendations from the bench. Environ Toxicol Chem 31: 15-31. 9.
Kahru A, Dubourguier H-C. 2010. From ecotoxicology to nanoecotoxicology. Toxicology
269: 105-119. 10.
Baun A, Hartmann NB, Grieger K, Kusk KO. 2008. Ecotoxicity of engineered
nanoparticles to aquatic invertebrates: A brief review and recommendations for future toxicity testing. Ecotoxicology 17: 387-395.
11.
Leung MCK, Williams PL, Benedetto A, Au C, Helmcke KJ, Aschner M, Meyer JN.
2008. Caenorhabditis elegans: An emerging model in biomedical and environmental toxicology. Toxicol Sci 106: 5-28.
Accepted Preprint 12.
Traunspurger W, Haitzer M, Höss S, Beier S, Ahlf W, Steinberg C. 1997.
Ecotoxicological assessment of aquatic sediments with Caenorhabditis elegans (nematoda) - a method for testing liquid medium and whole sediment samples. Environ Toxicol Chem 16: 245250. 13.
Wu Q, Nouara A, Li Y, Zhang M, Wang W, Tang M, Ye B, Ding J, Wang D. 2013.
Comparison of toxicities from three metal oxide nanoparticles at environmental relevant concentrations in nematode Caenorhabditis elegans. Chemosphere 90: 1123-1131. 14.
Roh J-Y, Park Y-K, Park K, Choi J. 2010. Ecotoxicological investigation of CeO2 and
TiO2 nanoparticles on the soil nematode Caenorhabditis elegans using gene expression, growth,
fertility, and survival as endpoints. Environ Toxicol Pharmacol 29: 167-172. 15.
Wang H, Wick RL, Xing B. 2009. Toxicity of nanoparticulate and bulk ZnO, Al2O3 and
TiO2 to the nematode Caenorhabditis elegans. Environ Pollut 157: 1171-1177.
16.
Bigorgne E, Foucaud L, Caillet C, Giambérini L, Nahmani J, Thomas F, Rodius F. 2012.
Cellular and molecular responses of E. fetida cœlomocytes exposed to TiO2 nanoparticles. J
Nanopart Res 14: 1-17. 17.
Ma H, Brennan A, Diamond SA. 2012. Photocatalytic reactive oxygen species production
and phototoxicity of titanium dioxide nanoparticles are dependent on the solar ultraviolet radiation spectrum. Environ Toxicol Chem 31: 2099-2107. 18.
Reeves JF, Davies SJ, Dodd NJF, Jha AN. 2008. Hydroxyl radicals (OH) are associated
with titanium dioxide (TiO2) nanoparticle-induced cytotoxicity and oxidative DNA damage in fish cells. Mutat Res -Fund Mol M 640: 113-122.
Accepted Preprint 19.
Gurr J-R, Wang ASS, Chen C-H, Jan K-Y. 2005. Ultrafine titanium dioxide particles in
the absence of photoactivation can induce oxidative damage to human bronchial epithelial cells. Toxicology 213: 66-73. 20.
Wu Q, Wang W, Li Y, Li Y, Ye B, Tang M, Wang D. 2012. Small sizes of TiO2-NPs
exhibit adverse effects at predicted environmental relevant concentrations on nematodes in a modified chronic toxicity assay system. J Hazard Mater 243: 161-168. 21.
Ma H, Kabengi NJ, Bertsch PM, Unrine JM, Glenn TC, Williams PL. 2011. Comparative
phototoxicity of nanoparticulate and bulk ZnO to a free-living nematode Caenorhabditis elegans: The importance of illumination mode and primary particle size. Environ Pollut 159: 1473-1480. 22.
Nickel C, Angelstorf J, Bienert R, Burkart C, Gabsch S, Giebner S, Haase A, Hellack B,
Hollert H, Hund-Rinke K, Jungmann D, Kaminski H, Luch A, Maes H, Nogowski A, Oetken M, Schaeffer A, Schiwy A, Schlich K, Stintz M, Kammer F, Kuhlbusch TJ. 2014. Dynamic lightscattering measurement comparability of nanomaterial suspensions. J Nanopart Res 16: 1-12.
23.
Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77: 71-94.
24.
Hope IA. 1999. Background on Caenorhabditis elegans. In Hope IA, ed, C. elegans - A
Practical Approach. Oxford University Press, Oxford, New York, US, pp. 1-15. 25.
Johnstone IL. 1999. Molecular biology. In Hope IA, ed, C.elegans - A Practical
Approach. Oxford University Press, Oxford, New York, US, p. 201-225. 26.
Anderson W, Kozak D, Coleman VA, Jämting ÅK, Trau M. 2013. A comparative study
of submicron particle sizing platforms: Accuracy, precision and resolution analysis of polydisperse particle size distributions. J Colloid Interface Sci 405: 322-330.
Accepted Preprint 27.
Schmidt J, Vogelsberger W. 2006. Dissolution kinetics of titanium dioxide nanoparticles:
The observation of an unusual kinetic size effect. J Phys Chem B 110: 3955-3963.
28.
Horst AM, Neal AC, Mielke RE, Sislian PR, Suh WH, Mädler L, Stucky GD, Holden
PA. 2010. Dispersion of TiO2 nanoparticle agglomerates by Pseudomonas aeruginosa. Appl Environ Microbiol 76: 7292-7298. 29.
Pfeiffer J, Johnson D, Nehrke K. 2008. Oscillatory transepithelial H+ flux regulates a
rhythmic behavior in C. elegans. Curr Biol 18: 297-302. 30.
Clément L, Hurel C, Marmier N. 2013. Toxicity of TiO2 nanoparticles to cladocerans,
algae, rotifers and plants – effects of size and crystalline structure. Chemosphere 90: 1083-1090.
31.
Handy RD, van den Brink N, Chappell M, Mühling M, Behra R, Dušinská M, Simpson P,
Ahtiainen J, Jha A, Seiter J, Bednar A, Kennedy A, Fernandes T, Riediker M. 2012. Practical considerations for conducting ecotoxicity test methods with manufactured nanomaterials: What have we learnt so far? Ecotoxicology 21: 933-972.
32.
Khanna N, Cressman III CP, Tatara CP, Williams PL. 1997. Tolerance of the nematode
Caenorhabditis elegans to ph, salinity, and hardness in aquatic media. Arch Environ Contam Toxicol 32: 110-114. 33.
Klaine SJ, Alvarez PJJ, Batley GE, Fernandes TF, Handy RD, Lyon DY, Mahendra S,
McLaughlin MJ, Lead JR. 2008. Nanomaterials in the environment: Behavior, fate, bioavailability, and effects. Environ Toxicol Chem 27: 1825-1851. 34.
Khare P, Sonane M, Pandey R, Ali S, Gupta KC, Satish A. 2011. Adverse effects of TiO2
and ZnO nanoparticles in soil nematode, Caenorhabditis elegans. J Biomed Nanotech 7: 116117.
Accepted Preprint 35.
Johnston AD, Ebert PR. 2012. The redox system in C. elegans, a phylogenetic approach.
J Toxicol 2012: 1-20. 36.
Fang-Yen C, Avery L, Samuel ADT. 2009. Two size-selective mechanisms specifically
trap bacteria-sized food particles in Caenorhabditis elegans. Proc Natl Acad Sci 106: 2009320096. 37.
Kiyama Y, Miyahara K, Ohshima Y. 2012. Active uptake of artificial particles in the
nematode Caenorhabditis elegans. J Exp Biol 215: 1178-1183. 38.
Boyd WA, Cole RD, Anderson GL, Williams PL. 2003. The effects of metals and food
availability on the behavior of Caenorhabditis elegans. Environ Toxicol Chem 22: 3049-3055. 39.
Cabiscol E, Tamarit J, Ros J. 2000. Oxidative stress in bacteria and protein damage by
reactive oxygen species. Int Microbiol 3: 3-8.
Figure 1. Scanning electron microscopy images of (A) bulk- and (B) nano-TiO2 suspensions
trapped on polycarbonate filter, covered with a 6 nm gold layer. Magnification: 20,000, detector: In-Lense, EHT: 5 keV (Structures in the background of image B are the pores of the polycarbonate filter). Figure 2. Inhibition of reproduction of C. elegans exposed to TiO2 [mean inhibition and SD in %, n = 4] and particle size as hydrodynamic diameter gained by dynamic light scattering [mean size and SD in nm based on intensity means, n = 6 x 10]; A: bulk-TiO2 (NM100) and B: nano-
TiO2 (P25). p-Values **
