Plant Physiology and Biochemistry 83 (2014) 57e64

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Impacts of size and shape of silver nanoparticles on Arabidopsis plant growth and gene expression You-yu Syu a, Jui-Hung Hung b, Jui-Chang Chen b, Huey-wen Chuang a, * a b

Department of BioAgricultural Sciences, National Chiayi University, Chiayi, Taiwan Department of Applied Chemistry, National Chiayi University, Chiayi, Taiwan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 31 March 2014 Accepted 14 July 2014 Available online 23 July 2014

Silver nanoparticles (AgNPs) are widely used as antibacterial nanomaterials; however, the environmental impacts of AgNPs remain uncertain. In this study, Arabidopsis physiological responses and gene expression were investigated after exposure to 3 different morphologies of AgNPs. The triangular (47 ± 7 nm) and spherical (8 ± 2 nm) AgNPs exhibited the lowest and highest degrees of antimicrobial activity, respectively. The AgNP-induced phenotypic alterations in Arabidopsis were correlated with nanoparticle morphology and size, in which the decahedral AgNPs (45 ± 5 nm) induced the highest degree of root growth promotion (RGP); however, the spherical AgNPs exhibited no RGP and induced the highest levels of anthocyanin accumulation in Arabidopsis seedlings. The decahedral and spherical AgNPs induced the lowest and highest levels of Cu/Zn superoxide dismutase (CSD2) accumulation, respectively. Moreover, 3 morphologies of AgNPs induced protein accumulations including cell-division-cycle kinase 2 (CDC2), protochlorophyllide oxidoreductase (POR), and fructose-1,6 bisphosphate aldolase (FBA). Regarding transcription, the AgNPs induced the gene expression of indoleacetic acid protein 8 (IAA8), 9cis-epoxycarotenoid dioxygenase (NCED3), and dehydration-responsive RD22. Additional studies have shown that AgNPs antagonized the aminocyclopropane-1-carboxylic acid (ACC)-derived inhibition of root elongation in Arabidopsis seedlings, as well as reduced the expression of ACC synthase 7 (ACS7) and ACC oxidase 2 (ACO2), suggesting that AgNPs acted as inhibitors of ethylene (ET) perception and could interfere with ET biosynthesis. In conclusion, AgNPs induce ROS accumulation and root growth promotion in Arabidopsis. AgNPs activate Arabidopsis gene expression involved in cellular events, including cell proliferation, metabolism, and hormone signaling pathways. © 2014 Elsevier Masson SAS. All rights reserved.

Keywords: AgNPs ROS Plant growth Ethylene response Size Shape

1. Introduction Silver nanoparticles (AgNPs) are used widely as antiseptics in health care delivery, coating material for stainless steel, and treatment for water purification (Duran et al., 2007). They are composed of molecules ranging from 1 to 100 nm. Due to their small size, these particles possess special physical and chemical features (Nowack and Bucheli, 2007). Different types of nanoparticles have been incorporated into diverse commercial products (Kessler. 2011). Omnipresence of AgNPs used in industrial countries has raised a growing concern for the adverse effects of AgNPs on living organisms (Glover et al., 2011). Several lines of evidence have demonstrated detrimental effects of AgNP on living organisms. Animal cells that are treated with

* Corresponding author. Tel.: þ886 5 271 7756; fax: þ886 5 271 7755. E-mail address: [email protected] (H.-w. Chuang). http://dx.doi.org/10.1016/j.plaphy.2014.07.010 0981-9428/© 2014 Elsevier Masson SAS. All rights reserved.

AgNPs generate oxidative stress, induce DNA damage and apoptosis-related changes (Panda et al., 2011; Kim and Ryu, 2013). Moreover, AgNPs could interfere with cellular signaling by modulating phosphotyrosine compounds in bacterial cells (Hwang et al., 2008). Regarding transcription, AgNPs alter the gene expression of matrix metallo-proteinases, tumor necrosis factor (TNF), and interleukin (IL)-12 and IL-1 (Bhol and Schechter, 2005). Proteomic analysis reveals that AgNP exposure results in alterations in the expression of genes that are involved in envelope formation and heat shock proteins in bacterial cells (Lok et al., 2006). More recently, the AgNP treatment of Arabidopsis was found to activate the expression of genes that are associated with the response to metals and oxidative stress but down-regulates the expression of genes that are involved in the response to pathogens and hormonal signals (Kaveh et al., 2013). Although a large number of studies have investigated the impact of AgNPs on mammalian and aquatic animals, research focusing on the realization of the impacts AgNPs on plant cells remains limited.

58

Y.-y. Syu et al. / Plant Physiology and Biochemistry 83 (2014) 57e64

Nanoparticle toxicity, including the inhibition of seed germination and the suppression of root and shoot growth, has been demonstrated in Spirodela polyrrhiza (Jiang et al., 2012). AgNPs negatively affect plant growth, including biomass reduction in Cucurbita pepo (Stampoulis et al., 2009), cytotoxic damage in the root tip cells of Allium cepa (Kumari et al., 2009), and the degradation of the nitrogen contents and photosystem II efficiency in Spirodela polyrhiza (Jiang et al., 2012). AgNPs decrease the chlorophyll contents but increase the superoxide dismutase (SOD) activity in Solanum lycopersicum (Song et al., 2013). Although detrimental effects of AgNPs on plant vegetative growth have been reported periodically, a phytostimulatory effect of AgNP has been revealed in several studies. For instance, AgNP application enhances the root growth of Brassica juncea (Sharma et al., 2012). Under flooding conditions, AgNP may promote root growth by blocking ethylene (ET) signaling in Crocus Sativus (Rezvani et al., 2012). In this study, the impacts of AgNPs on Arabidopsis physiology and gene expression were examined. Our results showed that different morphologies of AgNPs exhibited different levels of phytostimulatory effects in Arabidopsis. Moreover, AgNPs interacted with genes that are involved cell proliferation, photosynthesis, and hormone signaling, including auxin, ABA and ET. Our results showed the multiple effects of AgNPs on plant growth and gene expression.

AgNPs that were used in this study are presented in Fig. 1. The size of decahedral and spherical AgNPs was determined by nanoparticle's diameter, and that of triangular AgNPs was determined by nanoparticle's base breadth. Plant material used in this study included wild-type Arabidopsis Columbia ecotype (Col-0), auxin insensitive mutant transport inhibitor response 1 (tir1), and abscisic acid (ABA) insensitive mutant ABA-insensitive 5 (abi5). Both mutants were obtained from The Arabidopsis Information and Resource (TAIR). Arabidopsis seeds were cold-treated for 3 days and then germinated on 1/2 Murashige and Skoog (MS) medium containing 1% sucrose and 3 g/L phytogel (SigmaeAldrich, Cat. P8169). Four days after sowing, seedlings were transferred to new 1/2 MS solid medium for AgNP treatments conducted by adding 1 mL AgNP solutions of different concentrations to the 4-day-old seedlings. To determine the ET-inhibitory effect of the AgNPs, the 4-day-old seedlings were transferred to 1/2MS medium containing 50 mM 1Aminocyclopropane-1-carboxylic acid (ACC) for AgNP treatments. The AgNPs were added to the medium as described above. Arabidopsis seedlings were co-cultured with AgNPs for 3 days. The root length elongation after 3 days co-culture with AgNPs was measured for statistical analysis. All of the seedlings were grown at 23  C under 16 h of light (100 mmolem2 s1).

2. Materials and methods

The total proteins of seedlings co-cultured with AgNPs for 3 days were prepared by homogenizing the seedlings including shoots and roots in ice cold buffer (50 mM Tris-Cl, 150 mM NaCl, 0.5% NP-40, 1 mM phenylmethanesulfonyl fluoride (PMSF), 1 mL protease inhibitor cocktail [SigmaeAldrich Co, Cat. P8340] pH 7.5). The extracts were centrifuged at 12,000 rpm for 15 min in HERAEUS PICO 17 (Thermo Scientific™), and the total protein concentrations of the supernatants were determined by the Bradford method (Bradford,

2.1. Treatments of AgNPs All of the AgNPs that were used in this study were provided by Dr. Jui-Chang Chen, Department of Applied Chemistry, National Chiayi University, Taiwan. The preparation of the AgNPs was described previously (Tsai et al., 2012). The TEM images of the

2.2. Protein extraction and western blot analysis

Fig. 1. Different AgNPs exhibiting different levels of antimicrobial activity. Transmission Electron Microscopy (TEM) images of three types of AgNPs with different morphologies and sizes. The size of decahedral and spherical AgNPs was determined by nanoparticle's diameter, and that of triangular AgNPs was determined by nanoparticle's base breadth (A). The three AgNPs exhibited different degrees of antimicrobial activity at 100 mM (B). The spherical AgNP-derived antimicrobial activity increased with the increased AgNP concentration (C).

Y.-y. Syu et al. / Plant Physiology and Biochemistry 83 (2014) 57e64

1976) using a standard curve that was prepared from a series dilution of Bovine Serum Albumin (BSA). For the western blot analysis, 15 mg total proteins was loaded onto 10% SDS-PAGE gels. Polyclonal antibodies that were raised by chloroplastic Cu/Zn superoxide dismutase (CSD2), cell-division-cycle kinase 2 (CDC2), protochlorophyllide oxidoreductase (POR) and fructose-1,6bisphosphate aldolase (FBA) were used for hybridization. All of €s, Sweden, Cat. the antibodies were purchased from Agrisera (V€ anna AS06170 for CSD2; AS06153 for CDC2; AS05067 for POR; AS04043 for FBA). The hybridization images were captured by Chemi-Smart 5000 (Vilber Lourmat, France).

59

Arabidopsis cotyledon tissues were extracted using a solution of 99:1 (v/v) methanol:HCl. The extraction solution was centrifuged at 12,000 rpm for 10 min in HERAEUS PICO 17 (Thermo Scientific™), and supernatants were used to measure the optical density (O.D.) using spectrophotometer (Ultrospec 2100 pro, GE Healthcare Life Sciences). The OD530 and OD657 for each sample were determined. The relative anthocyanin levels were determined using equation of following: OD530(0.25  OD657)  extraction volume (mL)  1/ fresh weight of sample (g) ¼ relative units of anthocyanin/g fresh weight. 2.6. Quantitation of H2O2

2.3. RNA extraction and quantitative PCR analysis The procedures for the total RNA extraction were described previously (Parcy et al., 1994). The tested seedlings were ground to a fine powder in liquid nitrogen and added to the extraction buffer, which consisted of equal volumes of REB buffer (25 mM TriseHCl pH 8.0, 25 mM EDTA pH 8.0, 75 mM NaCl, and 1% SDS) and water saturated phenol pH 4.0. The extracts were subsequently purified twice with equal volumes of phenol:chloroform:isoamyl alcohol (25:24:1) and chloroform:isoamyl alcohol (24:1), respectively. The total RNAs were precipitated by 8 M LiCl and resolved in 0.1% (v/v) diethylpyrocarbonate (DEPC)-treated H2O. Using 0.1 mg oligo(dT)20 primer, 1 mg RNA solution was reverse transcribed by ImProm-II™ reverse transcriptase (Promega). Quantitative Polymerase Chain Reaction (qPCR) amplification was performed using the EvaGreen qPCR mix (MEDIBENA). The sequences of the primers that were used for the qPCR amplifications are as follow: Actin 8 (ACT8) forward: 50 CAGTCCAATTTTACCTGCTGGAA30 ACT8 reverse: 50 TGCAGACCGTATGAGCAAAGAG30 IAA8 forward: 50 ATGGACGGAC- CTTGACCTCT30 IAA8 reverse: 50 GAACCCTTCATGATCTTCAG3 ACC synthase (ACS7) forward: 50 TTACGGAGAAGTACATTAGG30 ACS7 reverse: 50 AACCTCCTTCGTCGGTCCAT30 ACC oxidase 2 (ACO2) forward 50 GAGTGTGCTGCACCGTGTGG30 ACO2 reverse: 50 CATTGCTGCGAACCGTGGCT30 The gene expression levels were normalized by the CT values of ACT8. An analysis of relative gene expression levels was carried out using the 2DDC method on an ABI PRISM 7500 sequence detection T system (PerkineElmer Applied Biosystems). All of the quantitations were performed in triplicate. 2.4. Antimicrobial activity The bacterial strain of E. col. DH5a was cultured on LB medium with or without the supplement of AgNPs to final concentrations 100 mM for triangle and decahedral AgNPs, and 1, 2, 10 and 100 mM for spherical AgNPs at 37  C. The bacterial growth rate (%) was calculated by dividing number of bacterial colonies that grew on medium that was supplemented with AgNPs by the number of those that grew on LB medium. Three replicates were performed for each test. Bacterial inhibition percentage (%) ¼ [1  average number of colonies from 3 plates containing LB þ AgNP/average number of colonies from 3 plates containing LB only]  100%. Inhibition percentages from 3 independent experiments were statistically analyzed. 2.5. Anthocyanin quantitation The anthocyanin levels were determined by following the procedure described previously (Rabino and Mancinelli, 1986).

After the four-day AgNP treatment, the Arabidopsis seedlings were harvested for H2O2 quantitation using the FOX assay (DeLong et al., 2002). Arabidopsis tissues were extracted in 1 mL 80% ethanol. A 100 mL aliquot of plant extracts was incubated with 1 mL Xylenol Orange (FOX) solution [90% methanol (v/v), 25 mM H2SO4 (v/v), 250 mM ferrous ammonium sulfate hexahydrate and 100 mM xylenol orange] for 30 min. The OD560 was measured, and the H2O2 concentrations were calculated based on the intercept values from standard curves ranging from 0 to 200 mM H2O2. 2.7. Statistical analysis All of the collected data were presented as an average of 3 replicates with standard error. The differences between the treatments were tested in the SAS program (version 9.2) with ANOVA using Tukey's test, in which a P value less than 0.01 was considered significantly different. 3. Results 3.1. Antibacterial activity was correlated with the size and morphology of AgNPs The antibacterial activity of AgNPs has been demonstrated in several studies (Chaloupa et al., 2010; Lok et al., 2006; Xiu et al., 2012). In this study, three different morphologies of AgNPs were tested. The size of 80% spherical AgNPs were 8 ± 2 nm, while that of 80% triangular and decahedral AgNPs were 47 ± 7 nm and 45 ± 5 nm, respectively (Fig. 1A). The spherical AgNPs with the smallest size exhibited the highest levels of antibacterial activity (Fig. 1B). Moreover, the antibacterial activity of the spherical AgNPs increased with the increased concentration (Fig. 1C). However, the antibacterial activity was also affected by the AgNP morphology, in that the triangular and decahedral AgNPs were similar in size but exhibited different degrees of antimicrobial activity (Fig. 1A and B). 3.2. AgNPs exerted both beneficial and adverse effects on plant growth To examine the impacts of AgNPs on plant growth, 4-day-old seedlings after sowing were co-cultured with 3 different morphologies of AgNPs for 3 days. The root growth of the Arabidopsis seedlings that were treated with either triangular or decahedral AgNPs was enhanced, while that of the spherical AgNP-treated seedlings was not changed (Fig. 2A and B). Moreover, in the spherical AgNP-treated seedlings, anthocyanin accumulation increased (Fig. 2C and D). Treatment with the decahedral AgNPs generated the highest degree of root growth promotion (RGP) (Fig. 2B). Moreover, the anthocyanin accumulation in the spherical AgNP-treated seedlings was dose-dependent (Fig. 2C and D). Anthocyanins are natural antioxidants, and their accumulation is increased in response to different biotic and abiotic stresses,

60

Y.-y. Syu et al. / Plant Physiology and Biochemistry 83 (2014) 57e64

Fig. 2. Physiological responses affected by the AgNP treatments. The 4-day-old seedlings were treated with triangular, decahedral and spherical AgNPs (100 mM) for 3 days (A). The root lengths of the AgNP-treated seedlings were measured (B). The Arabidopsis seedlings that were treated with 2 and 100 mM spherical AgNP accumulated higher levels of anthocyanin (C). The increased anthocyanin was quantitated (D). The values are means ± SE of 3 replicates. The differences between the treatments were tested in the SAS program using ANOVA in conjunction with Tukey's test, in which a P values less than 0.01 was considered significantly different.

including UV radiation, cold temperature, and drought (Petroni and Tonelli, 2011). Therefore, we further examined whether the anthocyanin accumulation in the AgNP-treated seedlings was correlated with the oxidative stress levels by monitoring the levels of an antioxidant enzyme, Cu/Zn superoxide dismutase 2 (CSD2). As shown in Fig. 3A, the expression of CSD2 was induced to the highest and lowest levels in the seedlings that were treated with the spherical and decahedral AgNPs, respectively. In the decahedral and spherical AgNP-treated seedlings, the CSD2 protein accumulation was dose-dependent (Fig. 3B). Our results indicate that

treatment with the decahedral AgNPs (45 ± 5 nm) resulted in the highest degree of growth promotion with the lowest induction of oxidative stress, while that with the spherical AgNPs (8 ± 2 nm) caused the highest degree of inhibition in cotyledon growth and the highest levels of oxidative stress. 3.3. Correlation of ROS levels and the AgNP-induced RGP ROS molecules are important signals for triggering the appropriate cellular responses to external stimuli when plants encounter

Fig. 3. AgNP-induced protein accumulation in Arabidopsis seedlings. The total proteins that were isolated from the 4-day-old seedlings that were treated without AgNPs (Ctl) and with 100 mM AgNPs, including Tri, Dec and Sph, for 3 days were used for western blot analyses. Antibodies against Cu/Zn superoxide dismutase (CSD2) was used for hybridization (A). The levels of CSD2 increased in the 4-day-old Arabidopsis seedlings that were treated with a series dilution of decahedral and spherical AgNPs (B). Antibodies against celldivision-cycle kinase 2 (CDC2), protochlorophyllide oxidoreductase (POR) and fructose-1,6-bisphosphate aldolase (FBA) were used to hybridize proteins isolated from seedlings treated with different AgNPs. Start (＊) indicated Ponceau staining gels to check for the equal loading of proteins in each lane.

Y.-y. Syu et al. / Plant Physiology and Biochemistry 83 (2014) 57e64

adverse environments (Suzuki et al., 2012). In this study, the decahedral AgNPs induced the highest level of RGP in the treated seedlings (Fig. 2). Moreover, the CSD2 protein accumulation in response to increased oxidative stress increased with increased concentrations of decahedral AgNPs (Fig. 3B). To determine whether ROS signaling plays a role in the AgNP-induced RGP, the root growth was examined in the seedlings that were treated with various concentrations of decahedral AgNPs. As shown in Fig. 4A, the AgNP-induced RGP increased with the increased concentrations of decahedral AgNPs. The spherical AgNPs exhibited no root growth promotion (Fig. 2). However, the spherical AgNP-treated seedlings accumulated the highest levels of CSD2 (Fig. 3). Therefore, it was speculated that high levels of oxidative stress prevented RGP in the spherical AgNP-treated seedlings. To test this hypothesis, the root growth of Arabidopsis seedlings that were treated with various concentrations of spherical AgNPs was examined. As shown in Fig. 4B, the seedlings that were treated with the highest concentrations of spherical AgNPs exhibited no RGP; however, the lower concentrations of spherical AgNPs, including 1, 2 and 10 mM, induced RPG in the AgNP-treated seedlings. These results suggest that a specific ROS level is required for the AgNP-induced RGP; however, high concentrations of oxidative stress could attenuate this growth promotion. 3.4. AgNPs interacted with auxin and ABA signaling transduction ROS molecules serve as signals to coordinate a wide range of plant cellular events, including hormone perception and transduction (Gechev et al., 2006). For instance, by altering Caþ2 signaling, ROS can reduce auxin sensitivity in the root tissues (Jiao et al., 2013). Furthermore, ROS plays a positive role in ABA signaling, which plays a key role in lateral root development when plants are exposed to environmental stress (De Smet et al., 2003; De Smet et al., 2006). In this study, the AgNP treatments increased the oxidative stress and altered the root growth in Arabidopsis seedlings. We further examined the expression of one gene involved in the auxin signaling pathway and two genes in the ABA production and response. One was IAA8, which encodes an auxin-inducible AUX/IAA protein; two were NCED3, which encodes 9-cis-epoxycarotenoid dioxygenase for ABA synthesis, and RD22, which encodes an ABA-mediated dehydration-responsive protein (Fujita et al., 2012; Hao et al., 2009; Liscum and Reed, 2002). As shown in Fig. 5A, the expression of IAA8 was induced over 1.5-fold by

61

100 mM decahedral AgNP. The expression of NCED3 and RD22 was induced less than 2-fold and more than 3.5-fold, respectively, by the AgNP treatments (Fig. 5B). We further tested whether AgNPinduced RGP is mediated through the auxin or ABA signaling pathways by conducting root growth assays in the auxin- and ABAinsensitive mutant, tir1 and abi5, respectively. The Dec AgNPs induced the highest levels of RGP (Fig. 2B). Our results showed that the AgNP-induced RGP was not affected in either mutant (Fig. 5C and D). These results suggest that the AgNP treatments could affect auxin and ABA signaling transduction by interacting with the expression of genes that are involved in these signaling pathways. However, the auxin and ABA signaling pathways do not play roles in the AgNP-induced RGP. 3.5. AgNPs altered Arabidopsis gene expression related to cell cycle and photosynthesis Extensive research has demonstrated the cytotoxicity and antiproliferation activities of AgNP in animal cells. However, the results showed phyto-stimulatory effects of triangular and decahedral AgNPs in roots (Fig. 2B). To gain insight into the molecular mechanisms underlying the phytostimulation effect of AgNP treatment, genes related to the cell cycle and photosynthesis were examined. As shown in Fig. 3C, 3 morphologies of AgNPs induced accumulation of proteins including cell-division-cycle kinase 2 (CDC2), protochlorophyllide oxidoreductase (POR), and fructose 1,6-bisphosphate aldolase (FBA), functioning in cell division, chloroplast biogenesis, and carbohydrate metabolism, respectively (Frick et al., 2003; Kitsios and Doonan, 2011; Reinbothe et al., 1996; Tamoi et al., 2006; Uematsu et al., 2012). These results suggest that AgNP treatments positively affect the cellular pathways that are involved in cell division, chloroplast development and carbohydrate metabolism. 3.6. AgNPs interfere with ET perception The Agþ1 ion effectively inhibits ET perception by replacing the cofactor Cuþ2 for the ET receptor (Rodriguez et al., 1999). For example, AgNO3 is a well-known ethylene inhibitor (Giridhar et al., 2003). To examine whether the Agþ1 ion that is released by AgNPs inhibits ET perception, Arabidopsis seedlings were treated with decahedral and spherical AgNPs in the presence of ACC, a precursor of ET biosynthesis. The application of exogenous ACC results in the

Fig. 4. The decahedral and spherical AgNP-induced root growth. The 4-day-old seedlings were exposed to different concentration of decahedral and spherical AgNPs. The root growth promotion increased with increased concentrations of decahedral AgNPs (A). In the spherical AgNP treatments, the induced root growth increased at the 1, 2, and 10 mM concentrations but was not changed at 100 mM (B).

62

Y.-y. Syu et al. / Plant Physiology and Biochemistry 83 (2014) 57e64

Fig. 5. The decahedral AgNPs interacted with the auxin and ABA signaling pathways. The seedlings that were treated with decahedral AgNPs were harvested for RNA extraction. The relative gene expression levels of IAA8 (A), NCED3 and RD22 (B) in the Arabidopsis seedlings that were treated with AgNPs were analyzed by qPCR. The root lengths of the Arabidopsis seedlings that were treated without AgNPs (Ctl) and with the decahedral AgNPs (Dec) were measured in the tir1 mutant (C) and in the abi5 mutant (D). The calculation of the relative gene expression levels was carried out using the 2TDDC method in an ABI PRISM 7500 sequence detection system. A statistical analysis was conducted as mentioned in Fig. 2.

overproduction of ET leading to increased auxin production and polar transportation in root tissues and decreased primary root elongation and lateral root development (Lewis et al., 2011). As shown in Fig. 6A, the addition of 50 mM ACC inhibited the development of primary and lateral roots in Arabidopsis seedlings; however, the addition of 100 mM decahedral and spherical AgNPs antagonized the ACC-derived inhibition of primary root elongation (Fig. 6A and B). Moreover, the addition of AgNPs resulted in the increased accumulation of H2O2 in Arabidopsis seedlings (Fig. 6C). ET signaling transduction plays a significant role in the plant response to biotic and abiotic stresses. ET production is controlled by feedback regulation in which the suppression of ethylene perception could lead to either increased or reduced ethylene synthesis (Yang, 1980). To determine whether AgNP treatments interfere with ET synthesis, the gene expression of ACC synthase 7 (ACS7) and ACC oxidase 2 (ACO2), which are involved in ET biosynthesis, was examined. ACC synthase, which catalyzes the conversion of SAM to ACC, is a rate-limiting step of ET biosynthesis (Yu et al., 1979). As shown in Fig. 6D, the expression of ACS7 and ACO2 was slightly down-regulated in response to the decahedral AgNP treatment, suggesting that decahedral AgNPs do not interfere with the ET production significantly. Our results indicate that both the decahedral and spherical AgNPs antagonize the ACC-induced root growth inhibition, suggesting that the Agþ1 ions that were derived from both nanoparticles could inhibit ET perception.

4. Discussion Accumulative studies have greatly emphasized the detrimental effects of AgNPs on living organisms (Bhol and Schechter, 2005; Kim and Ryu, 2013; Mailander and Landfester, 2009s). However, in Arabidopsis, both inhibitory (Stampoulis et al., 2009) and stimulatory effects (Rezvani et al., 2012) of AgNPs on plant growth have been reported. Our results show that, although inducing ROS accumulation, AgNPs can enhance root growth and increase the accumulation of proteins that are related to the cell cycle, chloroplast biogenesis, and carbohydrate metabolism. Cell division is intrinsically linked to the cell cycle, in which cyclins are central controllers of the progression of the cell cycle in all eukaryotic cells, and cyclin activity regulates the activity of cyclin-dependent protein kinases (CDKs) (Evans et al., 1983). Moreover, it has been reported that ROS signaling affects the expression of cell cycle-related genes in the meristematic zone of Arabidopsis root tips (Tsukagoshi, 2012). Therefore, it is possible that AgNP-induced RGP is partially regulated by increased ROS molecules, inducing cell division, which is responsible for root elongation. Nevertheless, there is an inconsistency in that 100 mM spherical AgNPs induces a high amount of CSD2 and CDC2 accumulation but exhibits no effect on AgNP-induced RGP (Fig. 1C). The overproduction of the ROS signal by the spherical AgNPs might account for this inconsistency as a specific ROS level is needed to induce RGP. This result is

Y.-y. Syu et al. / Plant Physiology and Biochemistry 83 (2014) 57e64

63

Fig. 6. The decahedral and spherical AgNPs antagonize the ACC-derived root growth inhibition. The 4-day-old Arabidopsis seedlings were treated with ACC, ACC plus decahedral AgNP, and ACC plus spherical AgNP for 3 days (A). The root lengths (B) and H2O2 concentrations (C) were measured from the seedlings that were treated under different conditions. The relative expression levels of ACS7 and ACO2 were analyzed by qPCR in the seedlings that were treated with the decahedral AgNPs (D). A statistical analysis was conducted as mentioned in Fig. 2. The calculation of the relative gene expression levels was carried out as described in Fig. 5.

consistent with the observation of AgNP-induced RGP in seedlings that were treated with lower concentrations of spherical AgNPs. Our results show that AgNPs with different morphologies and sizes induce a differential response regarding plant growth and gene expression in Arabidopsis seedlings. The decahedral AgNPs induce the highest levels of RGP but the lowest levels of CSD2 accumulation. The decahedral and triangular AgNPs are similar in size but induced significant differences in RGP and CSD2 accumulation. Therefore, AgNP morphology plays a significant role in the plant response. Moreover, the spherical AgNPs are the smallest in size, exhibiting the highest level of antimicrobial activity and CSD2 accumulation in the treated plants. These results suggest that the size of AgNPs also plays an important role in AgNP effectiveness. A number of studies have indicated that the cellular uptake of nanoparticles is dependent on their size, charge and surface properties (Hillaireau and Couvreur, 2009; Mailander and Landfester, 2009). Our results are consistent with these reports. In this study, three different morphologies of AgNPs induce genes involved in the ROS scavenging system, cell cycle regulation, chloroplast biogenesis, and carbohydrate metabolism. Our study shows that AgNP treatment induces the expression of genes that are involved in the ABA signaling pathway; moreover, cells that were treated with AgNPs exhibited an up-regulated auxin responsive gene, IAA8, whose overexpression results in the suppression of lateral root development (Arase et al., 2012). Several reports have indicated an interaction of AgNPs with plant signaling pathways. For example, in Arabidopsis, AgNPs down-regulate genes that are involved in systemic acquired resistance (SAR) responses to pathogens and hormone signals, including auxin and ET (Kaveh et al., 2013). In Eruca sativa, AgNP treatment promotes root growth and induces the expression of jacalin-related lectin (JAL), a gene that has been implicated in the release of nitrile, a precursor of auxin synthesis (Vannini et al., 2013). These results suggest that AgNPs can interfere with multiple signaling pathways in plant cells; moreover, physiological responses mediated by auxin and ET signals are most affected by AgNPs.

Currently, applications of AgNPs in agriculture mainly focus on antimicrobial activity. For example, AgNPs are used as antimicrobial agents and inhibitors of ET for cut flower preservation (Solgi et al., 2009). Our results show that both the decahedral and spherical AgNPs exhibit antimicrobial activity and could antagonize the ACCderived root growth inhibition. These results suggest the potential application of AgNPs on disinfection and as an ET inhibitor. 5. Conclusion This study shows that the AgNP treatment exerts phyto-stimulatory effects on plant growth. Our results reveal the impacts of AgNP morphologies on plant growth and gene expression. In addition to affecting the accumulation of antioxidant enzymes, AgNPs also alter the expression of genes that are involved in multiple cellular pathways, including cell proliferation, photosynthesis and hormone signaling pathways, including auxin, ABA, and ET. These results suggest that AgNP application could result in a complex physiological response in the treated tissues. Acknowledgments We would like to thank The Arabidopsis Information and Resource for providing the tir1 and abi5 mutant seeds. Contribution You-yu Syu: 40% Jui-Hung Hung: 5% Jui-Chang Chen: 5% Huey-wen Chuang: 50% References Arase, F., Nishitani, H., Egusa, M., Nishimoto, N., Sakurai, S., Sakamoto, N., Kaminaka, H., 2012. IAA8 involved in lateral root formation interacts with the

64

Y.-y. Syu et al. / Plant Physiology and Biochemistry 83 (2014) 57e64

TIR1 auxin receptor and ARF transcription factors in Arabidopsis. PloS one 7, e43414. Bhol, K.C., Schechter, P.J., 2005. Topical nanocrystalline silver cream suppresses inflammatory cytokines and induces apoptosis of inflammatory cells in a murine model of allergic contact dermatitis. Br. J. Dermatol. 152, 1235e1242. Bradford, M.M., 1976. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248e254. Chaloupka, K., Malam, Y., Seifalian, A.M., 2010. Nanosilver as a new generation of nanoproduct in biomedical applications. Trends Biotechnol. 28, 580e588. , D., Foyer, C.H., Zhang, H., 2003. An De Smet, I., Signora, L., Beeckman, T., Inze abscisic acid-sensitive checkpoint in lateral root development of Arabidopsis. Plant J 33, 543e555. , D., Beeckman, T., 2006. A novel role for abscisic acid De Smet, I., Zhang, H., Inze emerges from underground. Trends Plant Sci. 11, 434e439. DeLong, J.M., Prange, R.K., Hodges, D.M., Forney, C.F., Bishop, M.C., Quilliam, M., 2002. Using a modified ferrous oxidation-xylenol orange (FOX) assay for detection of lipid hydroperoxides in plant tissue. J. Agric. Food Chem. 50, 248e254. Duran, N., Marcarto, P.D., De Souza, G.I.H., Alves, O.L., Esposito, E., 2007. Antibacterial effect of silver nanoparticles produced by fungal process on textile fabrics and their effluent treatment. J. Biomed. Nanotechnol. 3, 203e208. Evans, T., Rosenthal, E.T., Youngblom, J., Distel, D., Hunt, T., 1983. Cyclin: a protein specified by maternal mRNA in sea urchin eggs that is destroyed at each cleavage division. Cell 33, 389e396. Frick, G., Su, Q., Apel, K., Armstrong, G.A., 2003. An Arabidopsis porB porC double mutant lacking light-dependent NADPH:protochlorophyllide oxidoreductases B and C is highly chlorophyll-deficient and developmentally arrested. Plant J 35, 141e153. Fujita, K., Horiuchi, H., Takato, H., Kohno, M., Suzuki, S., 2012. Auxin-responsive grape Aux/IAA9 regulates transgenic Arabidopsis plant growth. Mol. Biol. Rep 39, 7823e7829. Gechev, T.S., Van Breusegem, F., Stone, J.M., Denev, I., Laloi, C., 2006. Reactive oxygen species as signals that modulate plant stress responses and programmed cell death. Bioessays 28, 1091e1101. Giridhar, P., Indu, E.P., Vijaya Ramu, D., Ravishankar, G.A., 2003. Effect of silver nitrate on in vitro shoot growth of Coffee. Trop. Sci. 43, 144e146. Glover, R.D., Miller, J.M., Hutchison, J.E., 2011. Generation of metal nanoparticles from silver and copper objects: nanoparticle dynamics on surfaces and potential sources of nanoparticles in the environment. ACS Nano 5, 8950e8957. Hao, G.P., Zhang, X.H., Wang, Y.Q., Wu, Z.Y., Huang, C.L., 2009. Nucleotide variation in the NCED3 region of Arabidopsis thaliana and its association study with abscisic acid content under drought stress. J. Integr. Plant Biol. 51, 175e183. Hillaireau, H., Couvreur, P., 2009. Nanocarriers’ entry into the cell: relevance to drug delivery. Cell. Mol. Life Sci. 66, 2873e2896. Hwang, E.T., Lee, J.H., Chae, Y.J., Kim, Y.S., Lang, B., Gu, M.B., 2008. Analysis of the toxic mode of action of silver nanoparticles using stress-specific bioluminescent bacteria. Small 4, 746e750. Jiang, H., Li, M., Chang, F., Li, W., Yin, L., 2012. Physiological analysis of silver nanoparticles and AgNO3 toxicity to Spirodela polyrrhiza. Environ. Toxicol. and Chem. 31, 1880e1996. Jiao, Y., Sun, L., Song, Y., Wang, L., Liu, L., Zhang, L., Liu, B., Li, N., Miao, C., Hao, F., 2013. AtrbohD and AtrbohF positively regulate abscisic acid-inhibited primary root growth by affecting Ca2+ signalling and auxin response of roots in Arabidopsis. J. Exp. Bot. 64, 183e192. Kaveh, R., Li, Y.S., Ranjbar, S., Tehrani, R., Brueck, C.L., Van Aken, B., 2013. Changes in Arabidopsis thaliana gene expression in response to silver nanoparticles and silver ions. Environ. Sci. Technol. 47, 10637e10644. Kessler, R., 2011. Engineered nanoparticles in consumer products: understanding a new ingredient. Environ. Health Perspect 119, 120e125. Kim, S., Ryu, D.Y., 2013. Silver nanoparticle-induced oxidative stress, genotoxicity and apoptosis in cultured cells and animal tissues. J. Appl. Toxicol. 33, 78e89. Kitsios, G., Doonan, J.H., 2011. Cyclin dependent protein kinases and stress responses in plants. Plant Signal Behav. 6, 204e209. Kumari, M., Mukherjee, A., Chandrasekaran, N., 2009. Genotoxicity of silver nanoparticles in Allium cepa. Sci. Total Environ. 407, 5243e5246.

Lewis, D.R., Negi, S., Sukumar, P., Muday, G.K., 2011. Ethylene inhibits lateral root development, increases IAA transport and expression of PIN3 and PIN7 auxin efflux carriers. Development 138, 3485e3495. Liscum, E., Reed, J.W., 2002. Genetics of Aux/IAA and ARF action in plant growth and development. Plant Mol. Biol. 49, 387e400. Lok, C.N., Ho, C.M., Chen, R., He, Q.Y., Yu, W.Y., Sun, H., Tam, P.K., Chiu, J.F., Che, C.M., 2006. Proteomic analysis of the mode of antibacterial action of silver nanoparticles. J. Proteome Res. 5, 916. Mailander, V., Landfester, K., 2009. Interaction of nanoparticles with cells. Biomacromolecules 10, 2379e2400. Nowack, B., Bucheli, T.D., 2007. Occurrence, behaviour and effects of nanoparticles in the environment. Environ. Pollut. 150, 5e22. Panda, K.K., Achary, V.M.M., Krishnaveni, R., Padhi, B.K., Sarangi, S.N., Sahu, S.N., Panda, B.B., 2011. In vitro biosynthesis and genotoxicity bioassay of silver nanoparticles using plants. Toxicol. in vitro 25, 1097e1105. Parcy, F., Valon, C., Raynal, M., Gaubier-Comella, P., Delseny, M., Giraudat, J., 1994. Regulation of gene expression programs during Arabidopsis seed development: roles of the ABI3 locus and of endogenous abscisic acid. Plant Cell 6, 1567e1582. Petroni, K., Tonelli, C., 2011. Recent advances on the regulation of anthocyanin synthesis in reproductive organs. Plant Sci. 181, 219e229. Rabino, I., Mancinelli, A.L., 1986. Light, temperature, and anthocyanin production. Plant Physiol. 81, 922e924. Reinbothe, S.C.R., Lebedev, N., Apel, K., 1996. PORA and PORB, two light-dependent protochlorophyllide-reducing enzymes of angiosperm chlorophyll biosynthesis. Plant Cell 8, 763e769. Rezvani, N., Sorooshzadeh, A., Farhadi, N., 2012. Effect of nano-silver on growth of saffron in flooding stress. World Acad. Sci. Eng. Technol. 61, 606e611. Rodriguez, F.I., Esch, J.J., Hall, A.E., Binder, B.M., Schaller, G.E., Bleecker, A.B., 1999. A copper cofactor for the ethylene receptor ETR1 from Arabidopsis. Science 283, 996e998. Sharma, P., Bhatt, D., Zaidi, M.G., Saradhi, P.P., Khanna, P.K., Arora, S., 2012. Silver nanoparticle-mediated enhancement in growth and antioxidant status of Brassica juncea. Appl. Biochem. Biotechnol 167, 2225e2233. Solgi, M.K.M., Taghavi, T.S., Naderi, R., 2009. Essential oils and silver nanoparticles (SNP) as novel agents to extend vase-life of gerbera (Gerbera jamesonii cv. ‘Dune’) flowers. Postharvest Biol. Technol 53, 155e158. Song, U., Jun, H., Waldman, B., Roh, J., Kim, Y., Yi, J., Lee, E.J., 2013. Functional analyses of nanoparticle toxicity: a comparative study of the effects of TiO2 and Ag on tomatoes (Lycopersicon esculentum). Ecotoxicol. Environ. Saf. 93, 60e67. Stampoulis, D., Sinha, S.K., White, J.C., 2009. Assay-dependent phytotoxicity of nanoparticles to plants. Environ. Sci. Technol. 43, 9473e9479. Suzuki, N., Koussevitzky, S., Mittler, R., Miller, G., 2012. ROS and redox signalling in the response of plants to abiotic stress. Plant Cell Environ. 35, 259e270. Tamoi, M., Nagaoka, M., Miyagawa, Y., Shigeoka, S., 2006. Contribution of fructose1,6-bisphosphatase and sedoheptulose-1,7-bisphosphatase to the photosynthetic rate and carbon flow in the Calvin cycle in transgenic plants. Plant Cell Physiol. 47, 380e390. Tsai, C.M., Hsu, M.S., Chen, J.C., Huang, C.L., 2012. Mechanistic study of shape evolution of silver nanoprisms in the presence of KSCN. J. Phys. Chem. 116, 461e467. Tsukagoshi, H., 2012. Defective root growth triggered by oxidative stress is controlled through the expression of cell cycle-related genes. Plant Sci. 197, 30e39. Uematsu, K., Suzuki, N., Iwamae, T., Inui, M., 2012. Increased fructose 1,6-bisphosphate aldolase in plastids enhances growth and photosynthesis of tobacco plants. J Exp. Bot. 63, 3001e3009. Vannini, C., Domingo, G., Onelli, E., Prinsi, B., Marsoni, M., Espen, L., Bracale, M., 2013. Morphological and proteomic responses of Eruca sativa exposed to silver nanoparticles or silver nitrate. PLoS One 8, e68752. Xiu, Z.-m., Zhang, Q.-b., Puppala, H.L., Colvin, V.L., Alvarez, P.J.J., 2012. Negligible particle-specific antibacterial activity of silver nanoparticles. Nano Lett. 12, 4271e4275. Yang, S.F., 1980. Regulation of ethylene biosynthesis. HortScience 15, 238e243. Yu, Y.B., Adams, D.O., Yang, S.F., 1979. Regulation of auxin-induced ethylene production in mung bean hypocotyls: role of 1-aminocyclopropane-1-carboxylic acid. Plant Physiol 63, 589e590.