.n) 1992 Oxford University Press
Nucleic Acids Research, Vol. 20, No. 5 1147
Improved primer design for POR-based, site-directed mutagenesis Andrew D.Sharrocks and Peter E.Shaw Max-Planck-Institut fur Immunbiologie, Postfach 1169, W-7800 Freiburg, FRG Submitted January 17, 1992 A rapid and widely applicable procedure for site-directed mutagenesis by PCR has been recently described (1). The advantage of this method lies in the need for a single mutagenic primer, which is used in conjunction with two flanking, universal primers in a dual step PCR amplification. An awkward phenomenon associated with this method is the gratuitous addition of one nucleotide to the 3' end of the strand complementary to the mutagenic primer by the polymerase during the first amplification step. It has been noted that, in the case of Taq polymerase, this residue is frequenfly adenosine (2). Unless a counteractive measure is taken, the result will be an unwanted additional mutation within the final PCR fragment and frequently, in the case of protein coding sequences, an unprogrammed amino acid residue change. The use of lower nucleotide concentrations to suppress this activity results in lower yields without necessarily preventing its occurrence. One recent suggestion how to avoid this problem involves designing the mutagenic primer such that its 5' end is immediately preceded by a thymidine moiety so that subsequent addition of an A residue to the complementary strand merely lengthens what will be the primer for the second round of PCR amplification without altering its mutagenic capacity (3). However the occasional addition of a nucleotide other than adenosine or the presence of long GC stretches at the target site for mutagenesis make this measure fallible or expensive. Here it is shown that, for protein coding sequences, a more frequently applicable solution is to design the mutagenic primer such that its 5' end immediately follows the wobble position of a codon. This strategy will tolerate, in most cases, the addition of any nucleotide (or none) at the 3' end of the complementary strand without ensuing consequences and has the further advantage that wobble positions occur, with few exceptions, at every third nucleotide. It is also noteworthy that this activity of Taq polymerase can equally well be harnessed for the specific introduction of mutations simply by positioning the 5' end of the primer immediately adjacent to a nucleotide, which, when changed to thymidine, would result in a codon change. We utilised this strategy for primer selection in carrying out extensive mutagenesis on the DNA binding domain of the serum response factor (SRF) (4). One primer used (to direct the mutation of Arg157 to Gln or Lys) is shown opposite (Figure 1). The 5' end of this primer is immediately adjacent to a 'C' residue in the wobble position of the GAC Aspl52 codon. The non-template directed addition of an 'A' residue to the 3' end of the newly synthesised strand during the first step of the PCR reaction would result in the alteration of this codon to GAT in the final product. This still encodes an Asp residue. Sequencing of four separate clones derived from this mutagenic reaction revealed that all
contained this alteration in the codon for Asp 152. No other changes from the wild type sequence were detected except for those directed by the oligonucleotide at the Arg 157 codon. The use of this strategy in oligonucleotide design in this case required only the addition of 2 nucleotides to the desired 5' end. The positioning of the 5' end next to a 'T' residue would require the addition of a further 4 nucleotides. In other cases, more residues would have had to be added. The utilisation of this strategy in combination with the 'T' rule for oligonucleotide design can therefore lead to reduced expenditure during any extensive site-directed mutagenesis project in addition to helping to ensure that no undesired changes occur to the final amino acid sequence of the engineered protein. PCR conditions: Both steps of the PCR reaction were carried out in 50 Al reaction volumes. During the first step of the reaction, this contained Sng template plasmid DNA, 1 unit of Taq DNA polymerase, 50 mM KCI, 10 mM Tris-HCI (pH 9.0), 1.5 mM MgCl2, 0.01 % gelatin (w/v), 0.1% Triton X-100, 0.1% NP-40, 50 AsM dNTPs, and 10 pmoles of each primer (one primer directs the desired mutation, the second hybridises to the flanking vector sequences). This was overlayed with 50 1l mineral oil and PCR was performed for 30 cycles, each cycle consisting of a denaturation step at 92°C for 1 min, a primer annealing step at 47°C for 1 min, and an extension step at 72°C for 3 mins. This was followed by a single cycle consisting of a further elongation step at 72°C for 5 mins followed by cooling to 4°C. The PCR product was then purified by agarose gel electrophoresis followed by DNA elution using Gene Clean (BIO 101 Inc.). The second step of the PCR reaction was carried out as above except that one of the primers used was in this case derived from the total product of the first PCR reaction (the second primer hybridises to the flanking vector sequences) and the dNTP concentration was raised to 200 ,uM.
REFERENCES 1. Landt,O., Grunert,H.P. and Hahn,U. (1990) Gene 96, 125-128. 2. Mole,S.E., Iggo,R.D. and Lane,D.P. (1989) Nucleic Acids Res. 17, 3319. 3. Kuipers,O.P., et al. (1991) Nucleic Acids Res. 19, 4558. 4. Norman,C., et al. (1988) Cell 55, 989-1003. 3 5 c AACAAGCTGCGGCAATACACGACC
TTCATCGACAACAAGCTGCGGCGCTACACGACCTTCAGCAAGAGGAAG PheIleAspAsnLysLeuArgArgTyrThrThrPheSerLysArgLys
Figure 1. The nucleotide sequence of the region to be mutated within the SRF gene is shown in italics. The amino acids encoded by this stretch of the SRF gene (4) (150-165) are shown below this sequence. The sequence of the oligonucleotide used to mutate Argl57 is shown above (residues to be altered are in bold type).
Nucleic Acids Research, Vol. 20, No. 5 1147
Improved primer design for POR-based, site-directed mutagenesis Andrew D.Sharrocks and Peter E.Shaw Max-Planck-Institut fur Immunbiologie, Postfach 1169, W-7800 Freiburg, FRG Submitted January 17, 1992 A rapid and widely applicable procedure for site-directed mutagenesis by PCR has been recently described (1). The advantage of this method lies in the need for a single mutagenic primer, which is used in conjunction with two flanking, universal primers in a dual step PCR amplification. An awkward phenomenon associated with this method is the gratuitous addition of one nucleotide to the 3' end of the strand complementary to the mutagenic primer by the polymerase during the first amplification step. It has been noted that, in the case of Taq polymerase, this residue is frequenfly adenosine (2). Unless a counteractive measure is taken, the result will be an unwanted additional mutation within the final PCR fragment and frequently, in the case of protein coding sequences, an unprogrammed amino acid residue change. The use of lower nucleotide concentrations to suppress this activity results in lower yields without necessarily preventing its occurrence. One recent suggestion how to avoid this problem involves designing the mutagenic primer such that its 5' end is immediately preceded by a thymidine moiety so that subsequent addition of an A residue to the complementary strand merely lengthens what will be the primer for the second round of PCR amplification without altering its mutagenic capacity (3). However the occasional addition of a nucleotide other than adenosine or the presence of long GC stretches at the target site for mutagenesis make this measure fallible or expensive. Here it is shown that, for protein coding sequences, a more frequently applicable solution is to design the mutagenic primer such that its 5' end immediately follows the wobble position of a codon. This strategy will tolerate, in most cases, the addition of any nucleotide (or none) at the 3' end of the complementary strand without ensuing consequences and has the further advantage that wobble positions occur, with few exceptions, at every third nucleotide. It is also noteworthy that this activity of Taq polymerase can equally well be harnessed for the specific introduction of mutations simply by positioning the 5' end of the primer immediately adjacent to a nucleotide, which, when changed to thymidine, would result in a codon change. We utilised this strategy for primer selection in carrying out extensive mutagenesis on the DNA binding domain of the serum response factor (SRF) (4). One primer used (to direct the mutation of Arg157 to Gln or Lys) is shown opposite (Figure 1). The 5' end of this primer is immediately adjacent to a 'C' residue in the wobble position of the GAC Aspl52 codon. The non-template directed addition of an 'A' residue to the 3' end of the newly synthesised strand during the first step of the PCR reaction would result in the alteration of this codon to GAT in the final product. This still encodes an Asp residue. Sequencing of four separate clones derived from this mutagenic reaction revealed that all
contained this alteration in the codon for Asp 152. No other changes from the wild type sequence were detected except for those directed by the oligonucleotide at the Arg 157 codon. The use of this strategy in oligonucleotide design in this case required only the addition of 2 nucleotides to the desired 5' end. The positioning of the 5' end next to a 'T' residue would require the addition of a further 4 nucleotides. In other cases, more residues would have had to be added. The utilisation of this strategy in combination with the 'T' rule for oligonucleotide design can therefore lead to reduced expenditure during any extensive site-directed mutagenesis project in addition to helping to ensure that no undesired changes occur to the final amino acid sequence of the engineered protein. PCR conditions: Both steps of the PCR reaction were carried out in 50 Al reaction volumes. During the first step of the reaction, this contained Sng template plasmid DNA, 1 unit of Taq DNA polymerase, 50 mM KCI, 10 mM Tris-HCI (pH 9.0), 1.5 mM MgCl2, 0.01 % gelatin (w/v), 0.1% Triton X-100, 0.1% NP-40, 50 AsM dNTPs, and 10 pmoles of each primer (one primer directs the desired mutation, the second hybridises to the flanking vector sequences). This was overlayed with 50 1l mineral oil and PCR was performed for 30 cycles, each cycle consisting of a denaturation step at 92°C for 1 min, a primer annealing step at 47°C for 1 min, and an extension step at 72°C for 3 mins. This was followed by a single cycle consisting of a further elongation step at 72°C for 5 mins followed by cooling to 4°C. The PCR product was then purified by agarose gel electrophoresis followed by DNA elution using Gene Clean (BIO 101 Inc.). The second step of the PCR reaction was carried out as above except that one of the primers used was in this case derived from the total product of the first PCR reaction (the second primer hybridises to the flanking vector sequences) and the dNTP concentration was raised to 200 ,uM.
REFERENCES 1. Landt,O., Grunert,H.P. and Hahn,U. (1990) Gene 96, 125-128. 2. Mole,S.E., Iggo,R.D. and Lane,D.P. (1989) Nucleic Acids Res. 17, 3319. 3. Kuipers,O.P., et al. (1991) Nucleic Acids Res. 19, 4558. 4. Norman,C., et al. (1988) Cell 55, 989-1003. 3 5 c AACAAGCTGCGGCAATACACGACC
TTCATCGACAACAAGCTGCGGCGCTACACGACCTTCAGCAAGAGGAAG PheIleAspAsnLysLeuArgArgTyrThrThrPheSerLysArgLys
Figure 1. The nucleotide sequence of the region to be mutated within the SRF gene is shown in italics. The amino acids encoded by this stretch of the SRF gene (4) (150-165) are shown below this sequence. The sequence of the oligonucleotide used to mutate Argl57 is shown above (residues to be altered are in bold type).
