Journal of Biotechnology, 24 (1992) 189-194
189
© 1992 Elsevier Science Publishers B.V. All rights reserved 0168-1656/92/$05.00
BIOTEC 00760 Short Communication
Improving purification of recombinant ribonuclease T1 Olfert Landt, Maria Zirpel-Giesebrecht, Andreas Milde and Ulrich Hahn Abteilung Saenger, Institut fiir Kristallographie, Freie Universitiit Berlin, Germany
(Received 21 January 1991; revision accepted 28 April 1991)
Summary Purification of recombinant RNase T1 and its mutants has been improved by optimizing bacterial growth conditions, periplasmic fraction preparation and the use of a precolumn. The main part of the chromatographic separation could be automated due to the reproducibility of the procedure. Recombinant ribonuclease T1; Escherichia coli; Protein engineering; FPLC
Introduction Protein engineering is a collaborative research discipline. It combines the genetechnological production and alteration of proteins with their biochemical and biophysical characterization as well as their structural analyses. The knowledge of the 3D structure is the prerequisite for 'intelligent' protein design and the study of basic questions such as structure-function relationships. One of the best investigated proteins is ribonuclease (RNase) T1 from the fungus Aspergillus oryzae (EC 3.1.27.3, M r 11 085). This enzyme has been studied extensively by 'classical biochemical methods' (for review see Heinemann and Hahn, 1989). Its structure has been determined crystallographically (Heinemann and Saenger, 1982) and N M R spectroscopically (Hoffmann and Riiterjans, 1988). Correspondence to: Ulrich Hahn, Abteilung Saenger, Institut fdr Kristallographie, Freie Universitiit
Berlin, Takustrasse 6, W-1000 Berlin 33, Germany.
190 Recombinant RNase T1 has been made available by constructing overproducers independently in different laboratories (Ikehara et al., 1986; Quaas et al., 1988a, b; Steyaert et al., 1990). A number of mutants has been prepared and characterized (reviewed by Heinemann and Hahn, 1989; Pace, 1990; Kiefhaber et al., 1990c); some of those led to a controversial discussion about the catalytic mechanism of the enzyme (Nishikawa et al., 1987, 1990; Steyaert et al., 1990; Grunert et al., 1991). Furthermore RNase T1 has been used as a model to study protein stability (Pace, 1990; Pace et al., 1991) and protein folding (Kiefhaber et al., 1990a, b, c). For extensive studies, especially for X-ray structure analysis and NMR spe ctroscopy, there is the need of large amounts of pure protein. Therefore the routine production of larger quantities of wild type and mutant RNase T1 is necessary. Here we report about a purification method involving automated FPLC equipment for the main step, anion exchange chromatography.
Experimental Strains, media and growth conditions RNase T1 and mutants were purified from Escherichia coli DH5 harboring the corresponding plasmids (Quaas et al., 1988b). Cells were grown on rich medium according to Shirley and Laurents (1990). Overproduction of RNase T1 was induced at an OD600 of 0.5 by adding isopropyl-/3-D-thiogalactoside to 0.1 mM. 10 × 700 ml cultures were grown in 2-1 flasks at 37°C under shaking (250 rpm) and harvested after 16 h by centrifugation.
Purification of recombinant proteins The cell pellet was resuspended in 0.03 culture volumes of icecold TES (50 mM Tris/HCl, pH 7.5; 10 mM EDTA (TE) containing 15% sucrose). The suspension was shaken for 30 min at 4°C and diluted to 0.15 volumes with icecold TE and centrifuged immediately. The resulting pellet was resuspended in 0.03 volumes TES, shaken and centrifuged. Combined supernatants (1.3 1 from 7 1 cultures) were cleared by centrifugation, pumped through a Dowex 1 × 8 column (20 ml) and loaded on a DEAE CL-6B column (500 ml, 3 ml min-1). The DEAE column were washed with 0.2 M NaC1 and eluted with 0.35 M NaCI in TE (5 ml min-1). Loading of the periplasmic fraction, precolumn shutoff, elution and regeneration of the DEAE column were done automatically. RNase activity containing fractions were dialyzed against water (Spectrapor membrane 3, mwco: 3500). After lyophilization the protein was dissolved in 10 ml water and run through a Sephadex Go50 column (6 × 125 cm, 50 mM NH4HCO3, 7 mlmin-~). Enzyme containing fractions were lyophilized. Activity was detected with toluidine blue indicator plates (Quaas et al., 1989). Inactive mutants were identified by Western blot analysis.
191 Results and Discussion
Changing the translation initiation region In order to enhance the expression of the R N a s e T1 gene we inserted an additional C G base pair between the Shine-Dalgarno sequence and the initiation codon of the ompA signal p e p t i d e / R N a s e T1 fusion protein (Fig. 1). This base pair had been lost during the construction of the plN-III-ompA secretion vectors (Ghrayeb et al., 1984). This mutation did not give a significantly higher yield as judged by S D S - P A G E analysis (data not shown).
Improving growth conditions and periplasm preparation In Luria-Bertani (LB) Medium (Sambrook et al., 1989) cells grew over night up to an OD600 of 3-4. Higher cell densities (OD600 = 8-12) could be obtained by using rich medium (RM; Shirley and Laurents, 1990). The use of silicon sponge caps which allowed better aeration of the cultures gave O D values up to 20. To speed up the periplasm preparation (Quaas et al., 1988a) the harvested cells were resuspended in a smaller volume of TES and, without intermediate centrifugation, diluted five-fold with T E (osmotic shock). Incubation in T E for longer than 5 min before the following centrifugation step led to remarkably increased amounts of contaminating proteins released from the cells.
Column chromatography Following the proto$ol of Quaas et al. (1988a) sometimes a yellow dye was copurified with RNase T1. In the new procedure this dye was bound to a Dowex 1 × 8 anion exchange precolumn leaving the RNase activity in the flowthrough. Elution of this precolumn with high salt gave a red fraction associated with a negligible R N a s e activity, which could not be separated by a Mono Q chromatography or by a Superose 12 gel filtration run. The flowthrough of the Dowex column was loaded online on a D E A E - S e p h a r o s e CL-6B column. Separation of R N a s e T1 from contaminants was improved by isocratic elution instead of using a linear
5" -
AACTCTAGATAACGAGGCGCAAAAAATG3'
lae r° - G A A C T C T A G A T A A C G A G G
GCAAAAAATG
***,~
AAA AAG
- ompA
C Fig. I. Section of the translation-initiation region of the expression vector pA2TI and the oligonucleotide used for mutagenesis. The sequence between the promoter (]acP°) and the initiation codon
ATG (italics) of the ompA leader peptide lacked a C-G base pair 3' of the Shine-Dalgarno sequence (asterisks). It was introduced by PCR mutagenesis using the oligonucleotide A2 ÷ (TIB MOLBIOL, Berlin; shown above) as 5'-primer together with a Y-universal sequencing primer. The PCR product was cloned as XbaI/HindIII fragment (Landt et al., 1990; the Xbal site is underlined in this figure). The mutant was identified by dideoxy DNA sequencing (data not shown).
192
~rnM NaCI -300
~'~" ./,, ~
.,-"" OD~L
o./.
..
1.
\ ............2
~ 100
t
31111
'
'
'
5"00
~
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-
~
~
~
ml
Fig. 2. Elution profile of the DEAE CL-6B anion exchanger column. Using a linear gradient, contaminating proteins were coeluted with RNase activiN (dotted area). Asterisks indicate the salt concentration measured in collected fractions. With a ~step' gradient the proteins eluted in sharper peaks and were better separated, especially in the case of various amounts of total protein loaded to the column.
gradient (Fig. 2). RNase T1 and all mutants could be recovered under identical conditions. Due to the good reproducibility, this purification step could be automated with a programmable FPLC chromatography system (Fig. 3). RNase activity containing fractions were dialyzed and lyophilized before the final gel filtration. The same resolution as with Bio-Gel P-30 was achieved with Sephadex G-50 (Shirley and Laurents, 1990). The latter was chosen because of higher fl0w rates. All protein preparations isolated according to the procedure described here did not show detectable contaminants on silver stained SDS-PAGEs.
Conclusions
In combination with the rapid mutagenesis method developed in our laboratory (Landt et al., 1990) this improved purification protocol gives us the opportunity to produce some 100 mg of a new recombinant RNase T1 mutant within two weeks
LS HS R1 R2 PP
•
193
CO
WASTE
Fig. 3. Scheme of the automated chromatography system. Valve 1 (V1) selected between five solutions (LS, Low Salt, 50 mM Tris-HCl, pH 7.5, 10 mM EDTA; HS, High Salt, 700 mM NaCI in LS; R1, Regeneration 1, 0.5 M NaOH; R2, Regeneration 2, 2 M NaCI; PP, periplasmic fraction) to be pumped through the columns (P1, P2, pumps). The second valve (V2) selected the precolumn (C1, Dowex 1 × 8) to load the periplasmic fraction on the preparative DEAE column (C2) and disconnected the precolumn during the elution of the DEAE column. The third valve (V3) controlled the collection of the eluted protein (500 ml) 200 ml after starting the step gradient (350 mM NaCI) in a fraction collector (FR). The elution profile was recorded (U, UV flow through cell, 280 nm; WR, pinwriter). After elution the DEAE column was regenerated with 200 ml R2, R1 and R2 each and equilibrated with LS buffer. Loading the periplasmic fraction, elution and regeneration was completed within 24 h. The whole process was controlled by a LCC-500 controller (CO). All parts of the system were from Pharmacia, Freiburg.
including mutagenesis. These amounts are sufficient for characterization including protein consuming investigations such as X-ray crystallography.
Acknowledgements We thank Wolfram Saenger and Udo Heinemann for discussion and for critically reading the manuscript. This work was supported by the Deutsche Forschungsgemeinschaft.
References Ghrayeb, J., Kimura, H., Takahara, M., Hsiung, H., Masui, Y. and Inouye, M. (1984) Secretion cloning vectors in Escherichia coli. EMBO J. 3, 2437-2442. Grunert, H.-G., Zouni, A., Beineke, M., Quaas, R., Georgalis, Y., Saenger, W. and Hahn, U. (1991) Studies on ribonuclease T1 mutants affecting enzyme catalysis. Eur. J. Biochem. 197, 203-207. Heinemann, U. and Hahn, U. (1989) Structure and function of ribonuclease T1. In: Saenger, W. and Heinemann, U. (Eds.) Protein-Nucleic Acid Interaction, Macmillan, London/Basingstoke, UK, pp. 111-141. Heinemann, U. and Saenger, W. (1982) Specific protein-nucleic acid recognition in ribonuclease T1-2'-guanylic acid complex: an X-ray study. Nature 299, 27-31.
194 Hoffmann, E. and Riiterjans, H. (1988) Two-dimensional 1H-NMR investigation of ribonuclease T1. Resonance assignments, secondary and low-resolution tertiary structures of ribonuclease T1. Eur. J. Biochem. 177, 539-560. Ikehara, M., Ohtsuka, E., Tokunaga, T., Nishikawa, S., Uesugi, S., Tanaka, T., Aoyama, Y., Kikyodani, S., Fujimoto, K., Yanase, K., Fuchimura, K. and Morioka, H. (1986) Inquiries into the structurefunction relationships of ribonuclease T1 using chemically synthesized coding sequences. Proc. Nat. Acad. Sci. USA 83, 4695-4699. Kiefhaber, T., Quaas, R., Hahn, U. and Schmid, F.X. (1990a) Folding of ribonuclease T1. 1. Existence of multiple unfolded states created by proline isomerization. Biochemistry 29, 3053-3061. Kiefhaber, T., Quaas, R., Hahn, U. and Schmid, F.X. (1990b) Folding of ribonuclease T1. 2. Kinetic models for the folding and unfolding reactions. Biochemistry 29, 3061-3070. Kiefhaber, T., Grunert, H.-P., Hahn, U. and Schmid, F.X. (1990c) Replacement of a cis proline simplifies the mechanism of ribonuclease T1 'folding. Biochemistry 29, 6475-6480. Landt, O., Grunert, H.-P. and Hahn, U. (1990) A general method for rapid site-directed mutagenesis using the polymerase chain reaction. Gene 96, 125-128. Nishikawa, S., Morioka, H., Kim, H.J., Fuchimura, K., Tanaka, T., Uesugi, S., Hakoshima, T., Tomita, K., Ohtsuka, E. and Ikehara, M. (1987) Two histidine residues are essential for ribonuclease T1 activity as is the case for ribonuclease A. Biochemistry 26, 8620-8624. Nishikawa, S., Adiwinata, J., Morioka, H., Fujimura, T., Tanaka, T., Uesugi, S., Hakoshima, T., Tomita, K., Nakagawa, S. and Ikehara, M. (1990) A thermoresistant mutant of ribonuclease T1 having three disulfide bonds. Protein Eng. 443-448. Pace, C.N. (1990) Conformational stability of globular proteins. Trends Biochem. Sci. 15, 14-17. Pace, C.N., Heinemann, U., Hahn, U. and Saenger, W. (1991) Ribonuclease TI: Structure, Function and Stability. Angew. Chem. Int. Ed. Engl. 30, 343-360. Quaas, R., McKeown, Y., Stanssens, P., Frank, R., Bl6cker, H. and Hahn, U. (1988a) Expression of the chemically synthesized gene for ribonuclease T1 in Escherichia coli using a secretion cloning vector. Eur. J. Biochem. 173, 617-622. Quaas, R., Grunert, H.-P., Kimura, M. and Hahn, U. (1988b) Expression of ribonuclease T1 in Escherichia coli and rapid purification of the enzyme. Nucleosides and Nucleotides 7, 619-623. Quaas, R., Landt, O., Grunert, H.-P., Beineke, M. and Hahn, U. (1989) Indicator plates for rapid detection of ribonuclease T1 secreting Escherichia coli clones. Nucl. Acids Res. 17, 3318. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Shirley, B.A and Laurents, D.V. (1990) Purification of recombinant ribonuclease T1 expressed in Escherichia coli. J. Biochem. Biophys. Meth. 20, 181-188. Steyaert, J., Hallenga, K., Wyns, L. and Stanssens, P. (1990) Histidine-40 of ribonuclease T1 acts as base catalyst when the true catalytic base, glutamic acid-58 is replaced by alanine. Biochemistry 29, 9064-9072.
189
© 1992 Elsevier Science Publishers B.V. All rights reserved 0168-1656/92/$05.00
BIOTEC 00760 Short Communication
Improving purification of recombinant ribonuclease T1 Olfert Landt, Maria Zirpel-Giesebrecht, Andreas Milde and Ulrich Hahn Abteilung Saenger, Institut fiir Kristallographie, Freie Universitiit Berlin, Germany
(Received 21 January 1991; revision accepted 28 April 1991)
Summary Purification of recombinant RNase T1 and its mutants has been improved by optimizing bacterial growth conditions, periplasmic fraction preparation and the use of a precolumn. The main part of the chromatographic separation could be automated due to the reproducibility of the procedure. Recombinant ribonuclease T1; Escherichia coli; Protein engineering; FPLC
Introduction Protein engineering is a collaborative research discipline. It combines the genetechnological production and alteration of proteins with their biochemical and biophysical characterization as well as their structural analyses. The knowledge of the 3D structure is the prerequisite for 'intelligent' protein design and the study of basic questions such as structure-function relationships. One of the best investigated proteins is ribonuclease (RNase) T1 from the fungus Aspergillus oryzae (EC 3.1.27.3, M r 11 085). This enzyme has been studied extensively by 'classical biochemical methods' (for review see Heinemann and Hahn, 1989). Its structure has been determined crystallographically (Heinemann and Saenger, 1982) and N M R spectroscopically (Hoffmann and Riiterjans, 1988). Correspondence to: Ulrich Hahn, Abteilung Saenger, Institut fdr Kristallographie, Freie Universitiit
Berlin, Takustrasse 6, W-1000 Berlin 33, Germany.
190 Recombinant RNase T1 has been made available by constructing overproducers independently in different laboratories (Ikehara et al., 1986; Quaas et al., 1988a, b; Steyaert et al., 1990). A number of mutants has been prepared and characterized (reviewed by Heinemann and Hahn, 1989; Pace, 1990; Kiefhaber et al., 1990c); some of those led to a controversial discussion about the catalytic mechanism of the enzyme (Nishikawa et al., 1987, 1990; Steyaert et al., 1990; Grunert et al., 1991). Furthermore RNase T1 has been used as a model to study protein stability (Pace, 1990; Pace et al., 1991) and protein folding (Kiefhaber et al., 1990a, b, c). For extensive studies, especially for X-ray structure analysis and NMR spe ctroscopy, there is the need of large amounts of pure protein. Therefore the routine production of larger quantities of wild type and mutant RNase T1 is necessary. Here we report about a purification method involving automated FPLC equipment for the main step, anion exchange chromatography.
Experimental Strains, media and growth conditions RNase T1 and mutants were purified from Escherichia coli DH5 harboring the corresponding plasmids (Quaas et al., 1988b). Cells were grown on rich medium according to Shirley and Laurents (1990). Overproduction of RNase T1 was induced at an OD600 of 0.5 by adding isopropyl-/3-D-thiogalactoside to 0.1 mM. 10 × 700 ml cultures were grown in 2-1 flasks at 37°C under shaking (250 rpm) and harvested after 16 h by centrifugation.
Purification of recombinant proteins The cell pellet was resuspended in 0.03 culture volumes of icecold TES (50 mM Tris/HCl, pH 7.5; 10 mM EDTA (TE) containing 15% sucrose). The suspension was shaken for 30 min at 4°C and diluted to 0.15 volumes with icecold TE and centrifuged immediately. The resulting pellet was resuspended in 0.03 volumes TES, shaken and centrifuged. Combined supernatants (1.3 1 from 7 1 cultures) were cleared by centrifugation, pumped through a Dowex 1 × 8 column (20 ml) and loaded on a DEAE CL-6B column (500 ml, 3 ml min-1). The DEAE column were washed with 0.2 M NaC1 and eluted with 0.35 M NaCI in TE (5 ml min-1). Loading of the periplasmic fraction, precolumn shutoff, elution and regeneration of the DEAE column were done automatically. RNase activity containing fractions were dialyzed against water (Spectrapor membrane 3, mwco: 3500). After lyophilization the protein was dissolved in 10 ml water and run through a Sephadex Go50 column (6 × 125 cm, 50 mM NH4HCO3, 7 mlmin-~). Enzyme containing fractions were lyophilized. Activity was detected with toluidine blue indicator plates (Quaas et al., 1989). Inactive mutants were identified by Western blot analysis.
191 Results and Discussion
Changing the translation initiation region In order to enhance the expression of the R N a s e T1 gene we inserted an additional C G base pair between the Shine-Dalgarno sequence and the initiation codon of the ompA signal p e p t i d e / R N a s e T1 fusion protein (Fig. 1). This base pair had been lost during the construction of the plN-III-ompA secretion vectors (Ghrayeb et al., 1984). This mutation did not give a significantly higher yield as judged by S D S - P A G E analysis (data not shown).
Improving growth conditions and periplasm preparation In Luria-Bertani (LB) Medium (Sambrook et al., 1989) cells grew over night up to an OD600 of 3-4. Higher cell densities (OD600 = 8-12) could be obtained by using rich medium (RM; Shirley and Laurents, 1990). The use of silicon sponge caps which allowed better aeration of the cultures gave O D values up to 20. To speed up the periplasm preparation (Quaas et al., 1988a) the harvested cells were resuspended in a smaller volume of TES and, without intermediate centrifugation, diluted five-fold with T E (osmotic shock). Incubation in T E for longer than 5 min before the following centrifugation step led to remarkably increased amounts of contaminating proteins released from the cells.
Column chromatography Following the proto$ol of Quaas et al. (1988a) sometimes a yellow dye was copurified with RNase T1. In the new procedure this dye was bound to a Dowex 1 × 8 anion exchange precolumn leaving the RNase activity in the flowthrough. Elution of this precolumn with high salt gave a red fraction associated with a negligible R N a s e activity, which could not be separated by a Mono Q chromatography or by a Superose 12 gel filtration run. The flowthrough of the Dowex column was loaded online on a D E A E - S e p h a r o s e CL-6B column. Separation of R N a s e T1 from contaminants was improved by isocratic elution instead of using a linear
5" -
AACTCTAGATAACGAGGCGCAAAAAATG3'
lae r° - G A A C T C T A G A T A A C G A G G
GCAAAAAATG
***,~
AAA AAG
- ompA
C Fig. I. Section of the translation-initiation region of the expression vector pA2TI and the oligonucleotide used for mutagenesis. The sequence between the promoter (]acP°) and the initiation codon
ATG (italics) of the ompA leader peptide lacked a C-G base pair 3' of the Shine-Dalgarno sequence (asterisks). It was introduced by PCR mutagenesis using the oligonucleotide A2 ÷ (TIB MOLBIOL, Berlin; shown above) as 5'-primer together with a Y-universal sequencing primer. The PCR product was cloned as XbaI/HindIII fragment (Landt et al., 1990; the Xbal site is underlined in this figure). The mutant was identified by dideoxy DNA sequencing (data not shown).
192
~rnM NaCI -300
~'~" ./,, ~
.,-"" OD~L
o./.
..
1.
\ ............2
~ 100
t
31111
'
'
'
5"00
~
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-
~
~
~
ml
Fig. 2. Elution profile of the DEAE CL-6B anion exchanger column. Using a linear gradient, contaminating proteins were coeluted with RNase activiN (dotted area). Asterisks indicate the salt concentration measured in collected fractions. With a ~step' gradient the proteins eluted in sharper peaks and were better separated, especially in the case of various amounts of total protein loaded to the column.
gradient (Fig. 2). RNase T1 and all mutants could be recovered under identical conditions. Due to the good reproducibility, this purification step could be automated with a programmable FPLC chromatography system (Fig. 3). RNase activity containing fractions were dialyzed and lyophilized before the final gel filtration. The same resolution as with Bio-Gel P-30 was achieved with Sephadex G-50 (Shirley and Laurents, 1990). The latter was chosen because of higher fl0w rates. All protein preparations isolated according to the procedure described here did not show detectable contaminants on silver stained SDS-PAGEs.
Conclusions
In combination with the rapid mutagenesis method developed in our laboratory (Landt et al., 1990) this improved purification protocol gives us the opportunity to produce some 100 mg of a new recombinant RNase T1 mutant within two weeks
LS HS R1 R2 PP
•
193
CO
WASTE
Fig. 3. Scheme of the automated chromatography system. Valve 1 (V1) selected between five solutions (LS, Low Salt, 50 mM Tris-HCl, pH 7.5, 10 mM EDTA; HS, High Salt, 700 mM NaCI in LS; R1, Regeneration 1, 0.5 M NaOH; R2, Regeneration 2, 2 M NaCI; PP, periplasmic fraction) to be pumped through the columns (P1, P2, pumps). The second valve (V2) selected the precolumn (C1, Dowex 1 × 8) to load the periplasmic fraction on the preparative DEAE column (C2) and disconnected the precolumn during the elution of the DEAE column. The third valve (V3) controlled the collection of the eluted protein (500 ml) 200 ml after starting the step gradient (350 mM NaCI) in a fraction collector (FR). The elution profile was recorded (U, UV flow through cell, 280 nm; WR, pinwriter). After elution the DEAE column was regenerated with 200 ml R2, R1 and R2 each and equilibrated with LS buffer. Loading the periplasmic fraction, elution and regeneration was completed within 24 h. The whole process was controlled by a LCC-500 controller (CO). All parts of the system were from Pharmacia, Freiburg.
including mutagenesis. These amounts are sufficient for characterization including protein consuming investigations such as X-ray crystallography.
Acknowledgements We thank Wolfram Saenger and Udo Heinemann for discussion and for critically reading the manuscript. This work was supported by the Deutsche Forschungsgemeinschaft.
References Ghrayeb, J., Kimura, H., Takahara, M., Hsiung, H., Masui, Y. and Inouye, M. (1984) Secretion cloning vectors in Escherichia coli. EMBO J. 3, 2437-2442. Grunert, H.-G., Zouni, A., Beineke, M., Quaas, R., Georgalis, Y., Saenger, W. and Hahn, U. (1991) Studies on ribonuclease T1 mutants affecting enzyme catalysis. Eur. J. Biochem. 197, 203-207. Heinemann, U. and Hahn, U. (1989) Structure and function of ribonuclease T1. In: Saenger, W. and Heinemann, U. (Eds.) Protein-Nucleic Acid Interaction, Macmillan, London/Basingstoke, UK, pp. 111-141. Heinemann, U. and Saenger, W. (1982) Specific protein-nucleic acid recognition in ribonuclease T1-2'-guanylic acid complex: an X-ray study. Nature 299, 27-31.
194 Hoffmann, E. and Riiterjans, H. (1988) Two-dimensional 1H-NMR investigation of ribonuclease T1. Resonance assignments, secondary and low-resolution tertiary structures of ribonuclease T1. Eur. J. Biochem. 177, 539-560. Ikehara, M., Ohtsuka, E., Tokunaga, T., Nishikawa, S., Uesugi, S., Tanaka, T., Aoyama, Y., Kikyodani, S., Fujimoto, K., Yanase, K., Fuchimura, K. and Morioka, H. (1986) Inquiries into the structurefunction relationships of ribonuclease T1 using chemically synthesized coding sequences. Proc. Nat. Acad. Sci. USA 83, 4695-4699. Kiefhaber, T., Quaas, R., Hahn, U. and Schmid, F.X. (1990a) Folding of ribonuclease T1. 1. Existence of multiple unfolded states created by proline isomerization. Biochemistry 29, 3053-3061. Kiefhaber, T., Quaas, R., Hahn, U. and Schmid, F.X. (1990b) Folding of ribonuclease T1. 2. Kinetic models for the folding and unfolding reactions. Biochemistry 29, 3061-3070. Kiefhaber, T., Grunert, H.-P., Hahn, U. and Schmid, F.X. (1990c) Replacement of a cis proline simplifies the mechanism of ribonuclease T1 'folding. Biochemistry 29, 6475-6480. Landt, O., Grunert, H.-P. and Hahn, U. (1990) A general method for rapid site-directed mutagenesis using the polymerase chain reaction. Gene 96, 125-128. Nishikawa, S., Morioka, H., Kim, H.J., Fuchimura, K., Tanaka, T., Uesugi, S., Hakoshima, T., Tomita, K., Ohtsuka, E. and Ikehara, M. (1987) Two histidine residues are essential for ribonuclease T1 activity as is the case for ribonuclease A. Biochemistry 26, 8620-8624. Nishikawa, S., Adiwinata, J., Morioka, H., Fujimura, T., Tanaka, T., Uesugi, S., Hakoshima, T., Tomita, K., Nakagawa, S. and Ikehara, M. (1990) A thermoresistant mutant of ribonuclease T1 having three disulfide bonds. Protein Eng. 443-448. Pace, C.N. (1990) Conformational stability of globular proteins. Trends Biochem. Sci. 15, 14-17. Pace, C.N., Heinemann, U., Hahn, U. and Saenger, W. (1991) Ribonuclease TI: Structure, Function and Stability. Angew. Chem. Int. Ed. Engl. 30, 343-360. Quaas, R., McKeown, Y., Stanssens, P., Frank, R., Bl6cker, H. and Hahn, U. (1988a) Expression of the chemically synthesized gene for ribonuclease T1 in Escherichia coli using a secretion cloning vector. Eur. J. Biochem. 173, 617-622. Quaas, R., Grunert, H.-P., Kimura, M. and Hahn, U. (1988b) Expression of ribonuclease T1 in Escherichia coli and rapid purification of the enzyme. Nucleosides and Nucleotides 7, 619-623. Quaas, R., Landt, O., Grunert, H.-P., Beineke, M. and Hahn, U. (1989) Indicator plates for rapid detection of ribonuclease T1 secreting Escherichia coli clones. Nucl. Acids Res. 17, 3318. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Shirley, B.A and Laurents, D.V. (1990) Purification of recombinant ribonuclease T1 expressed in Escherichia coli. J. Biochem. Biophys. Meth. 20, 181-188. Steyaert, J., Hallenga, K., Wyns, L. and Stanssens, P. (1990) Histidine-40 of ribonuclease T1 acts as base catalyst when the true catalytic base, glutamic acid-58 is replaced by alanine. Biochemistry 29, 9064-9072.
